Screening Of Fungal Isolates For Keratinase Production By Submerged Fermentation

Transcription

1 Screening Of Fungal Isolates For Keratinase Production By Submerged Fermentation K. D. Mini Asst. Professor, Sree Sankara College, Kalady J. Mathew Professor, School of Biosciences, Mahatma Gandhi University, Kottayam Abstract: The fungal strains were isolated from the soil samples collected from different localities in Ernakulam and Thrissur districts. The keratinolytic nature of the fungus made it easy to isolate using Vanbreuseghem s hair baiting technique. The fungi collected were cultured in keratin agar medium. The keratinolytic nature of the fungi were noted by observing the zone of clearance in the keratin agar medium. In this study, out of 350 fungi isolated, 42 presented clear zones in the agar media. The selected fungi were tested for enzyme production by submerged fermentation using keratin substrate. The highest production of extracellular keratinase activity was recorded in S125 which was identified as Aspergillus flavus on the basis of the colony morphology on Sabouraud Dextrose Agar (SDA) plates and mycelial pattern was identified by Lactophenol Cotton Blue staining. Molecular identification using ITS gene sequence analysis was done for confirmation. Keywords: Keratinoytic fungus, keratinase, Aspergillus flavus, Vanbreuseghem s hair baiting technique, submerged fermentation. I. INTRODUCTION The term keratin stood for all of the proteins extracted from skin modifications, such as horns, claws and hooves. Subsequently, it was realized that this keratin is actually a mixture of keratins, keratin filament-associated proteins and other proteins. Currently, the term keratin covers all intermediate filament-forming proteins with specific physicochemical properties. The protein chains are packed tightly either in α-chain (α-keratin) or in -sheet ( -keratins) structures. A group of proteolytic enzymes which are able to hydrolyze insoluble keratins more efficiently than other proteases are called keratinases (Onifade et al., 1998). They are produced by some insects and mostly by microorganisms. Keratinases [EC ] belong to the group of serine proteases capable of degrading keratin. There are many reports on the isolation and identification of keratinases from different microbial sources. Keratinases can be produced by several species of fungi, bacteria and actinomycetes. Microbial keratinase has many industrial applications due to their biochemical diversity and wide applications in tanneries, food industries, waste treatment etc. Further the keratinous wastes are accumulating and there is a demand for developing biotechnological alternatives for recycling such wastes [1]. II. MATERIALS AND METHODS COLLECTION OF SOIL SAMPLES Fungal strains were isolated from the soil samples collected from poultry farm premises in Ernakulum and Thrissur districts of Kerala state. Hair baiting technique [2] was used for isolating the fungi. In this study, the predominant strains of fungi degrading the substrate keratin were selected for identification. EXAMINATION OF KERATINOLYTIC PROPERTY OF FUNGUS The fungi collected were plated on keratin agar medium. Plates were incubated at 37 C for 5 days. The plates in which clear zones were seen indicated the fungi with keratinolytic activity. They were carefully isolated and stored in Sabouraud dextrose agar medium (SDA). SELECTION OF HIGH YIELDING STRAIN High yielding strains were selected from the isolated keratinolytic fungi based on the production of enzymes in feather keratin medium. Page 19

2 PREPARATION OF FEATHER KERATIN SUBSTRATE Large amount of chicken feather was collected from the poultry farm and washed well with chloroform-methanol mixture (1:1, v/v) and finally with distilled water. It was then dried in sunlight, tyndallised at 100 C for 20 min for five successive days and then powdered. PREPARATION OF FEATHER KERATIN MEDIUM 2 gm. of feather keratin substrate was added to 100ml. of mineral salt solution and the ph was adjusted to 8. The medium was sterilized by autoclaving at 121 C for 15 min. INOCULUM PREPARATION Spore suspension of the fungal isolates was prepared by adding 10 ml. of normal saline to 5 day old fungal isolates growing on SDA agar slants. Final concentration of the spore suspension was adjusted to about 2x10 8 /ml (using a hemocytometer). INOCULATION AND INCUBATION 100 ml of feather keratin medium was taken in 250ml Erlenmeyer flasks. The flasks were inoculated with 2ml. fungal spore suspension (2x10 8 /ml) and incubated at 37 o C for a period of 5 days in an incubator shaker (Labline) with agitation rate 100rpm. ENZYME ASSAY The enzymatic action in the mixture containing 1 ml keratin (Sigma) (1% w/v) and 0.5 ml of enzyme was carried out at 45 C for 30 min. The reaction was stopped by adding 4 ml of 5% TCA (Trichloro acetic acid) and incubated at room temperature for 1 hr. and then filtered. To 1 ml of the filtrate, 5 ml of 0.4 M sodium carbonate solution and 0.5 ml of Folin- Ciocalteau reagent were added. After the reaction mixture was incubated for 30 min, the absorbance was measured at 660 nm using spectrophotometer. Simultaneously a blank was read using the same steps except that 10% TCA was added prior to the addition of enzyme. The activity was expressed as units per ml (U/ml). IDENTIFICATION OF FUNGUS The fungus was identified on the basis of the colony morphology on Sabourad Dextrose Agar (SDA) plates and mycelial pattern was identified by Lactophenol Cotton Blue staining and slide culture technique. The isolated fungus was maintained on SDA slants at room temperature. MOLECULAR IDENTIFICATION For molecular identification, the genomic DNA was isolated from the keratinolytic fungi. The internal transcribed spacer (ITS) regions were amplified by polymerase chain reaction (PCR) using the ITS primers, ITS1 and ITS2. ISOLATION OF GENOMIC DNA Total genomic DNA was isolated from fresh mycelium according to a miniprep protocol described by [3]. Aseptically, 500 µ L of Sabouraud dextrose broth (Himedia) was inoculated with fungal hyphal threads and left at room temperature for 72 h. The resulting mycelial mat was pelleted by centrifugation at 13,000 rpm (Remi refrigerated centrifuge) for 5 min and was washed with 500 µl of Tris-EDTA (ph 8.0). The mat was then homogenized using mortar and pestle in 300 µ L of extraction buffer (200 mm Tris-HCl [ph 8.5], 250 mm NaCl, 25 mm EDTA, and 0.5% sodium dodecyl sulfate) for 5 min. One hundred and fifty micro liters of 3 M sodium acetate (ph 5.2) was added, and the mixture was cooled to 20 C for 10 min. Fungal debris was pelleted by centrifugation at 13,000 rpm for 5 min, the supernatant was transferred to a fresh tube, and an equal volume of isopropanol was added. DNA was then pelleted by centrifugation at 13,000 rpm for 10 min. Excess salt was removed by washing with 70% ethanol, and DNA was resuspended in Tris-EDTA (10 mm Tris-HCl [ph 8.0, 1mM EDTA. The isolated DNA was quantified spectrophotometrically (A 260 ) and the purity checked on 0.8% agarose gel. MOLECULAR IDENTIFICATION OF FUNGAL ISOLATE For the molecular identification of keratinolytic fungi the ITS regions were amplified using polymerase chain reaction (PCR) using the ITS primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (GCTGCGTTCTTCATCGATGC) described by [4]. PCR was performed at a final volume of 50 µl reaction containing 50 ng of genomic DNA, 20moles of each primer, 1.25 units of Taq DNA polymerase (Bangalore Genei), 200 M of each dntps and 1 PCR buffer. The PCR was performed for 35 cycles in a thermocyclern (Applied biosystems) with an initial denaturation at 94 C for 5 min, followed by cyclic denaturation at 94 C for 1 min, annealing at 55.5 C for 2 min and extension at 72 C for 2 min with a final extension at 72 C for 7 min. The PCR product formation was confirmed by agarose gel electrophoresis for which 5µ L of the above PCR product was electrophoresised on 1% agarose gel prepared in 1X TBE buffer (Working solution Stock: 5 X, 54 g Tris base, 27.5 g boric acid, 20 ml 0.5 M EDTA, ph 8). The gel was run at 80 Volt for 90 min in 1 X TBE running buffer. The gel was stained in 1% ethidium bromide for 45 min and was observed under UV illumination (Gel Doc EZ system; BioRad). PURIFICATION OF PCR AMPLIFIED PRODUCT To 20 µ L PCR amplified product, 12 µ L of 20% PEG-NaCl (Polyethylene glycol - NaCl) solution was added and incubated at 37 C for 30 min. It was then centrifuged at 12,000 rpm for 20 min. The supernatant was discarded and the pellet was washed twice with 70% ethanol and separated by centrifuging at 12,000 rpm for 20 min. The pellet was dried and dissolved in 10 µ L of double distilled water and stored at -20 C. Page 20

3 SEQUENCING OF THE PURIFIED PCR PRODUCT DNA sequencing was carried out on ABI 1500 Automated Sequencer at the DNA sequencing facility at SciGenom Labs Pvt Ltd. Kakanad, Cochin, Kerala.Both the forward and reverse primers were used in separate sequencing reactions to obtain the complete sequence of the PCR product. The DNA sequence thus obtained was used for detailed comparative sequence and phylogenetic analysis. A similarity search for the nucleotide sequence of ITS region of the test isolate was carried out using a BLAST search at NCBI [5]. SEQUENCE ALIGNMENT AND BLAST SEARCH The sequences obtained by sequencer were in graphic form and hence it was converted to the word format by BioEdit (computer program). The sequences obtained were in small fragments and hence it was aligned properly by overlapping the sequences. The nucleotide sequence was analyzed Forward and reverse sequences were assembled and sequence was generated after trimming the low quality bases. Basic local alignment search tool (BLAST), at the NCBI site ( and the data were compared with the NCBI/Gene bank database. STABILITY OF HIGH YIELDING STRAINS The selected fungi were stored in SDA medium and their stability in high yielding nature was assessed by sub culturing and assaying enzyme production at intervals. III. RESULTS Fungus Enzyme Activity U/ml S S S S S S S Chrysosporium keratinophilum MTCC The strain S125 was found highest in enzyme production. It produced 7.83U/ml of keratinase. IDENTIFICATION OF HIGH YIELDING FUNGI The high yielding strains were identified based on growth characters and microscopic morphology are listed below: No Fungi isolated Aspergillus niger Aspergillus flavus 1 Aspergillus fumigatus 2 Aspergillus niduluns 3 Chrysosporium 4 keratinophilum 5 Microsporum gypseum 6 Trichophyton 7 mentagrophytes Table 2 List of fungi identified A total of more than 350 fungal isolates were obtained from 420 soil samples by hair baiting technique. They were tested for keratinolytic property by sub culturing on keratin agar medium. Among the 350 isolates, only 42 produced zone of clearance. Clear zone formed by a fungal isolate is shown in Plate 3.1. SELECTION OF HIGH YIELDING STRAINS Plate 1: Zone of clearance showed by A.flavus S125 on keratin agar medium Page 21

4 Plate 2: Growth of Aspergillus flavus S125 on SDMA medium Plate 3: Stained microscopic preparation of isolate S125 Figure 2: Phylogenetic tree depicting the position of A.flavus S125 STABILITY OF HIGHEST YIELDING STRAINS Figure 1: ITS region sequence of S125 MOLECULAR IDENTIFICATION OF THE SELECTED FUNGUS AMPLIFIED ITS REGION IN AGAROSE GEL Amplified ITS region gene in agarose gel is shown in Fig 1. The partial ITS region sequence of the isolate is shown in Fig. 2. Phylogenetic tree is given in Fig 3. Plate 3.4 PCR amplification of ITS region from fungal genomic DNA. The size of the amplified fragment was found to be 250bp. Lane a is the DNA marker Lane b is the amplified ITS region. A variation in the enzyme yield on repeated subculturing was noticed in most of the fungi. The fungi reacted differently in enzyme activity to repeated subculture. Only S125 and S252 were seen stable in their enzyme production. The results obtained in subsequent subcultures are summarized in Table 3 Enzyme production ( U/ml ) after Fungus periodical subcultures in months S S S S S S Chrysospori um keratinophil um MTCC Table 3: The yield of keratinase obtained after subsequent subcultures Page 22

5 IV. DISCUSSION The fungal strains were isolated from the soil samples collected from different localities in Ernakulam and Thrissur districts. The keratinolytic nature of the fungus made it easy to isolate using Vanbreuseghem s hair baiting technique initially developed by R. Vanbreuseghem, a Belgian mycologist in1952. The fungi collected were cultured in keratin agar medium. The keratinolytic nature of the fungi were noted by observing the zone of clearance in the keratin agar medium. A similar method was developed by [6] using azure dyeimpregnated sheep s wool keratin (keratin azure) incorporated in a high ph medium and overlaid on a keratin-free basal medium. The release and diffusion of the azure dye into the lower layer indicated the production of keratinase. Casein agar plates were used for screening keratinolytic bacteria by [7]. The organisms producing zone of hydrolysis in casein agar plates were considered as keratinolytic organisms. The major drawback of using casein agar for keratinolytic fungal screening is that the isolates obtained need not be strictly keratinolytic. The stratum corneum substrate was used for the culture of keratinolytic fungi by [8]. Horn powder is also used as a substrate for culturing the keratinolytic fungi. [9] presented convincing photographic evidence that particles of horn which had been suspended in 2 % agar medium in petri dish cultures, were digested by Microsporum gypseum. In this study out of 350 fungi isolated, 42 presented clear zones in the keratin agar media. The selected fungi were tested for enzyme production by SmF using keratin substrate. The highest production of extracellular keratinase activity was recorded in S125 which was identified as A. flavus. This was followed by A.niger S7, A.fumigatus S199, A.nidulans S220, Microsporum gypseum S324, Trichophyton mentagrophytes S328 and Chrysosporium keratinophilum S252. A variation in the enzyme yield on repeated subcultures was noticed in most of the fungi except in isolates S125 and S252. The other 5 fungi were found responding differently in repeated subcultures. The stability loss in enzyme activity can be due to several reasons. Cultural history is a factor affecting the stability of the strain as reported in the case of α-amylase production by Bacillus subtilis [10]. A. flavus S125, a fungal isolate in the present study, which was found to be highest yielding and possessing stability in production was selected for further studies. REFERENCES [1] Gupta, R., and Ramnani, P. (2006). Microbial keratinases and their prospective applications: an overview. Applied Microbiology and Biotechnology, 70(1), [2] Vanbreuseghem, R.(1952). Technique biologique pour l isolement des dermatophytes du sol.ann. Annales de la Societe belge de medecine tropicale, 32, in Bacillus subtilis. Genes and development, 10(16), [3] Cenis, J. L. (1992). Rapid extraction of fungal DNA for PCR amplification. Nucleic acids research, 20(9), 2380 [4] White, T. J., Bruns, T., Lee, S. J. W. T., & Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, 18, [5] Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), [6] Scott, J. A., and Untereiner, W. A. (2004). Determination of keratin degradation by fungi using keratin azure.medical Mycology, 42(3), [7] Prasad, H.V., Kumar, G., Karthik, L., and Rao, B. K.V. (2010). Screening of extracellular keratinase producing bacteria from feather processing areas in Vellore, Tamil Nadu, India, Journal of Scientific Research, 2 (3), [8] Samdani, A. J.(2005). dermatophyte growth and degradation of human Stratum corneum in vitro pathogenesis of dermatophytosis. Journal of Ayub Medical College Abbottabad, 17(4), [9] Page, R. M. (1950). Observations on keratin digestion by Microsporum gypseum. Mycologia,42, [10] Solomon, J. M., Lazazzera, B. A., and Grossman, A. D. (1996). Purification and characterization of an extracellular peptide factor that affects two different developmental pathway Page 23