Alzheimer s Disease. Table of Contents. Differential processing of APP Hyperphosphorylation of Tau
|
|
|
- Violet Ray
- 6 years ago
- Views:
Transcription
1
2
3 Alzheimer s Disease Alzheimer s disease (AD) is one of the most common neurodegenerative diseases worldwide. Clinically, it is characterized by the presence of extracellular amyloid plaques and intracellular neurofibrillary tangles, resulting in neuronal dysfunction and cell death. Two hypotheses for the onset of AD receive the majority of research attention today. The Amyloid beta hypothesis focuses on the differential processing of the Amyloid Precursor Protein (APP). The Tau hypothesis focuses on the hyperphosphorylation of the Microtubule-Associated Protein Tau (MAPT). Besides these two main areas, the inflammation related overexpression of Arginase in the brain and the depletion of the key nutrient Arginine in the brain has also received increasing interests. Table of Contents Differential processing of APP Hyperphosphorylation of Tau
4 Differential Processing of APP In the normal state, APP is cleaved by alpha secretase and generates the soluble APP (sapp) which is an important neurotrophic factor involved in synaptic signaling, synaptic plasticity, learning and memory, emotional behaviors, and neuronal survival. In the diseased state, APP is cleaved by beta secretase and gamma secretase to generate sapp and a special form of Amyloid Beta (Abeta) called A40/42. This form of Amyloid Beta tends to aggregate and form plaques and oligomers, both are neurotoxic. Beta Amyloid Anti-beta Amyloid Antibody Beta Amyloid, also called Abeta or Abeta, denotes peptides of amino acidsthat are crucially involved in Alzheimer's disease as the main component of the amyloid plaques found in the brains of Alzheimer patients. It is mapped to 19q Several potential activities have been discovered for beta Amyloid, including activation of kinase enzymes, functioning as a transcription factor, and anti-microbial activity (potentially associated with beta Amyloid's proinflammatoryactivity). Moreover, monomeric beta Amyloid is indicated to protect neurons by quenching metal-inducible oxygen radical generation and thereby inhibiting neurotoxicity. Neprilysin Anti-CD10 Antibody Neprilysin, also known as membrane metalloendopeptidase, neutral endopeptidase (NEP), CD10, is a zinc-dependent metalloprotease enzyme that degrades a number of small secreted peptides, including amyloid beta peptide. By cdna transfection analysis, CD10 is confirmed as a functional neutral endopeptidase of the type that has previously been called enkephalinase. 02
5 Gene Name APP NAE1 ADAM10 APBB1 GAPDH PSEN2 LPL APOE LRP1 MME APP MME Product Name Anti-ABCG4 Anti-ACHE Anti-ADAM17 Anti-Alpha 2a Adrenergic Receptor Anti-Alpha 2A Adrenergic Receptor Anti-GRK3 Anti-RAGE Anti-RAGE Anti-AIMP2/p38 Anti-ALDH1A1 Anti-ALDH1A2 Anti-ALK Applications WP WP 03
6 Hyperphosphorylation of Tau MAPT is an important component of the cytoskeleton. The hyperphosphorylation of Tau can result in its dissociation from microtubules, which in turn, destabilize and form neurofibrillary entanglements. These entanglements prevent the transportation of nutrients and materials within the cell and eventually lead to cell death. GSK-3 and CDK5 are the kinases primarily responsible for phosphorylation of Tau, although other kinases such as PKC, PKA, and Erk2 are also involved. MAPT (Tau) Anti-Tau Antibody Microtubule-associated protein tau (MAPT), is enriched in axons. The tau proteins are the product of alternative splicingfrom a single gene that in humans is designated MAPT. Tau proteins are proteins that stabilize microtubules. They are abundant in neurons in the central nervous system and are less common elsewhere. When tau proteins are hyperphosphorylated, it can no longer stabilize microtubules properly, creating entanglements in the neuronal cytoskeletons. This leads to cell death and causes Alzheimer's disease. Anti-Tau antibody, Western blotting All lanes: Anti at 0.5ug/ml Lane 1: Rat Brain Tissue Lysate at 50ug Lane 2: Mouse Brain Tissue Lysate at 50ug Lane 3: HT1080 Whole Cell Lysate at 40ug Lane 4: MCF-7 Whole Cell Lysate at 40ug Predicted bind size: 79KD Observed bind size: 79KD Caspase-3 Anti-Caspase-3 Antibody Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspase-3 exists as inactive a proenzyme that undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Caspase-3 is the predominant caspase involved in the cleavage of amyloid-beta 4A precursor protein, which creates a positive feedback loop that contributes to the onset of Alzheimer s 04
7 Gene Name MAPT CDK5R1 CDK5 CAPN1 CASP7 GAPDH GRIN1 GRIN2A PPP3CA ADAM10 ADAM17 APAF1 APAF1 APBB1 APH1A APOE APP APP APP APP ATF6 ATF6 ATP2A1 ATP2A1 ATP2A2 ATP2A2 Product Name Anti-Tau Antibody Anti-CDK5R1 Antibody Anti-Cdk5 Antibody Anti-Calpain 1 Antibody Anti-Caspase-3 Antibody Anti-Caspase-7 Antibody Anti-GAPDH Antibody Anti-NMDAR1 Antibody Anti-NMDAR2A Antibody Anti-Calcineurin A Antibody Human s Kit Mouse Kit Anti-ADAM10 Antibody Anti-ADAM17 Antibody Anti-APAF1 Antibody Anti-APAF1 Antibody Anti-FE65 Antibody Anti-APH1a Antibody Anti-Apolipoprotein E Antibody Anti-beta Amyloid Antibody Anti-Amyloid beta precursor protein Antibody Human APP Kit Anti-beta-Amyloid Protein Antibody (monoclonal) Anti-ATF6 Antibody Anti-ATF6 Antibody Anti-SERCA1 ATPase Antibody Anti-ATP2A1 Antibody Anti-SERCA2 ATPase Antibody Anti-ATP2A2 Antibody Applications, IHC-F, ICC IHC-P WP 05
8 Gene Name ATP2A3 ATP5H ATP5J BID BID CACNA1C CACNA1D CACNA1D CAPN1 CAPN1 CASP12 CASP7 CASP7 CASP8 CASP8 CASP8 CASP8 CASP9 CASP9 CDK5 CDK5R1 CYCS Product Name Anti-ATP2A3 Antibody Anti-ATP5H Antibody Anti-ATP5J Antibody Anti-Bid Antibody Anti-Bid Antibody Anti-CACNA1C Antibody Anti-CaV1.3 Antibody Anti-CaV1.3 Antibody Anti-Calpain 1 Antibody Anti-Calpain 1 Antibody Anti-Caspase-12 Antibody Anti-Caspase-3 Antibody Anti-Caspase-3(P10) Antibody Anti-Caspase-3(P10) Anti-Caspase-3(P10) Antibody Anti-Caspase 3 Antibody Anti-Caspase-3(P17) Antibody Anti-Caspase-3(P17) Antibody Anti-Caspase-7 Antibody Anti-Caspase-7(P11) Antibody Anti-Caspase-8 Antibody Anti-Caspase-8(P18) Antibody Anti-Caspase-8(P10) Antibody Anti-Caspase-8 Antibody Anti-Caspase-9 Antibody Anti-Caspase 9 Antibody Anti-Cdk5 Antibody Anti-CDK5R1 Antibody Anti-Cytochrome C Antibody Applications, ICC, ICC, IHC-F, ICC, ICC, ICC 06
9 Gene Name CYCS EIF2AK3 FADD GAPDH GAPDH GAPDH GRIN1 GRIN2A GRIN2A GRIN2A GRIN2B GRIN2B GRIN2B GRIN2C HSD17B10 ITPR1 ITPR1 Product Name Anti-Tau Antibody Anti-CDK5R1 Antibody Anti-Cdk5 Antibody Anti-Calpain 1 Antibody Anti-Caspase-3 Antibody Anti-Caspase-7 Antibody Anti-GAPDH Antibody Anti-NMDAR1 Antibody Anti-NMDAR2A Antibody Anti-Calcineurin A Antibody Human s Kit Mouse Kit Anti-ADAM10 Antibody Anti-ADAM17 Antibody Anti-APAF1 Antibody Anti-APAF1 Antibody Anti-FE65 Antibody Anti-APH1a Antibody Anti-Apolipoprotein E Antibody Anti-beta Amyloid Antibody Anti-Amyloid beta precursor protein Antibody Human APP Kit Anti-beta-Amyloid Protein Antibody (monoclonal) Anti-ATF6 Antibody Anti-ATF6 Antibody Anti-SERCA1 ATPase Antibody Anti-ATP2A1 Antibody Anti-SERCA2 ATPase Antibody Anti-ATP2A2 Antibody Applications, IHC-F, ICC, ICC, ICH-F, IHC-F, ICC,, 07
10 Gene Name ITPR3 LPL LRP1 MAPK1 MAPK1 MAPK1 MAPK3 MAPT MAPT MME MME MME NAE1 NCSTN NDUFA1 NOS1 Product Name Anti-ITPR3 Antibody Anti-Lipoprotein lipase Antibody Anti-LRP1 Antibody Anti-MAPK1/3 Antibody Anti-ERK2 Antibody Anti-ERK2 Antibody Anti-ERK1 Antibody Anti-Tau Antibody Anti-Tau Antibody (monoclonal) Anti-CD10 Antibody Human CD10/Neprilysin Kit Mouse Neprilysin/CD10 Kit Anti-APPBP1 Antibody Anti-NCSTN Antibody Anti-NDUFA1 Antibody Anti-nNOS(neuronal) Antibody Applications, ICC, IHC-F, ICC NOS1 PLCB1 PPP3CA PPP3R1 PSEN2 SDHA SDHA SDHA SDHB SDHC Anti-Nitric Oxide Synthase, Brain(1-181) NOS1 Antibody (monoclonal) Anti-PLCB1 Antibody Anti-Calcineurin A Antibody Anti-Calcineurin alpha Antibody (monoclonal) Anti-Presenilin 2 Antibody Anti-SDHA Antibody Anti-SDHA Antibody Anti-SDHA Antibody Anti-SDHB Antibody Anti-SDHC Antibody Anti- alpha Antibody Anti- alpha Antibody Anti- alpha Antibody 08
11 Gene Name RSF1A RSF1A RSF1A Product Name Human alpha Kit Rat alpha Kit Mouse alpha Kit Anti-mouse alpha Antibody Anti- Receptor I Antibody Anti-RSF1A Antibody Human sr I Kit Applications,, Neu, IP 09
12
Alzheimer s Disease. Joachim Herz. STARS January 11, 2010
Alzheimer s Disease Joachim Herz STARS January 11, 2010 1 The Hallmarks of Alzheimer Disease Amyloid Plaques Neurofibrillary Tangles From: Medical Library of Utah 1906 First description of Alzheimer s
Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in
Supplementary information Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer s disease Zhentao Zhang, Mingke Song, Xia Liu, Seong Su Kang, Il-Sun Kwon, Duc
CELLULAR SIGNALING IN NEUROSCIENCE
Neuro_Broch all pgs 11/3/05 10:16 AM Page 1 CELLULAR SIGNALING IN NEUROSCIENCE General Neuronal Signaling Alzheimer s, Parkinson s and other Neurological Disorders Neuronal Injury and Regeneration www.cellsignal.com
Original Article Whether Alzheimer s diseases related genes also differently express in the hippocampus of Ts65Dn mice?
Int J Clin Exp Pathol 2015;8(4):4120-4125 www.ijcep.com /ISSN:1936-2625/IJCEP0005137 Original Article Whether Alzheimer s diseases related genes also differently express in the hippocampus of Ts65Dn mice?
GenScript. Neuroscience Products & Services. Your Innovation Partner in Drug Discovery! Tools for Neurological Disease Research:
Neuroscience Products & Services Reliable, well-selected antibodies are one of the most effective tools in the neuroscience researcher's arsenal with regard to identifying and locating specific proteins.
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:MUC1 (EMA) mouse monoclonal antibody, clone OTI2F6 (formerly 2F6) Product Data Sheet - TRUEMAB Catalog: TA800790 Components: MUC1 (EMA) mouse monoclonal
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:MUC1 (EMA) mouse monoclonal antibody, clone OTI2E3 (formerly 2E3) Product Data Sheet - TRUEMAB Catalog: TA800794 Components: MUC1 (EMA) mouse monoclonal
Using zebrafish in human disease research: some advantages, disadvantages and ethical considerations.
Using zebrafish in human disease research: some advantages, disadvantages and ethical considerations. Svanhild Nornes Morgan Newman Michael Lardelli - Uni. Of Adelaide Giuseppe Verdile Ralph Martins -
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
Human cysteinyl aspartate specific proteinases 3, Caspase-3/CPP32 ELISA Kit
Human cysteinyl aspartate specific proteinases 3, Caspase-3/CPP32 ELISA Kit Catalog No: E0626h 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS!
ER STRESS PRODUCT FOCUS
ptglab.com 1 ER STRESS PRODUCT FOCUS www.ptglab.com Introduction The endoplasmic reticulum (ER) is a cellular organelle responsible for lipid or steroid synthesis, folding or maturation of proteins, calcium
Human β Amyloid 42 ELISA Kit
Human β Amyloid 42 ELISA Kit Cat. No.:DEIA1146 Pkg.Size:96T Intended use The Human β Amyloid 42 ELISA kit is designed to detect and quantify the level of human β Amyloid 42 in cell culture supernatant,
Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-18 CELL BIOLOGY BIO-5005B Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
ER STRESS PRODUCT FOCUS
ptglab.com 1 ER STRESS PRODUCT FOCUS www.ptglab.com Introduction The endoplasmic reticulum (ER) is a cellular organelle responsible for lipid or steroid synthesis, folding or maturation of proteins, calcium
Supplementary Information
Supplementary Information Figure S1. Transiently overexpressed ECFP-TIAF1/EYFP-TIAF1 causes apoptosis of Mv1Lu cells. Mv1Lu cells were transfected by electroporation with ECFP, EYFP, ECFP-TIAF1, EYFP-
InnoZyme TACE Activity Kit Cat. No. CBA042
User Protocol CBA042 Rev. 26 January 2006 JSW Page 1 of 5 InnoZyme TACE Activity Kit Cat. No. CBA042 Note that this user protocol is not lot-specific and is representative of the current specifications
Hossini et al. BMC Genomics (2015) 16:84 DOI /s
Hossini et al. BMC Genomics (2015) 16:84 DOI 10.1186/s12864-015-1262-5 RESEARCH ARTICLE Open Access Induced pluripotent stem cell-derived neuronal cells from a sporadic Alzheimer s disease donor as a model
BACE1 ELISA Kit. Cat. No.:DEIA3191 Pkg.Size:96T. Intended use. General Description. Principle Of The Test. Reagents And Materials Provided
BACE1 ELISA Kit Cat. No.:DEIA3191 Pkg.Size:96T Intended use This immunoassay kit allows for the use in quantitative determination of human β-site APP-Cleaving Enzyme 1, BACE1 concentrations in cell culture
About OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
TAU AGGREGATION ASSAY D. JAGA
TAU AGGREGATION ASSAY D. JAGA Contents General introduction Assay format Assay protocol Product specifications Assay performance Ordering information 2 TAU aggregation : General Introduction TAU (Tubulin
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:VAPA mouse monoclonal antibody, clone OTI10E10 (formerly 10E10) Product Data Sheet - TRUEMAB Catalog: TA809100 Components: VAPA mouse monoclonal
Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
Multi-compartmental modeling of SORLA s influence on amyloidogenic processing in Alzheimer s disease
Lao et al. BMC Systems Biology 2012, 6:74 RESEARCH ARTICLE Multi-compartmental modeling of SORLA s influence on amyloidogenic processing in Alzheimer s disease Angelyn Lao 1, Vanessa Schmidt 2, Yvonne
AmplideX PCR/CE TOMM40 Kit (RUO)
AmplideX PCR/CE TOMM40 Kit (RUO) 2500-0665 Types of Dementia Alzheimer's Deposits of the protein fragment beta-amyloid (plaques) and twisted strands of the protein tau (tangles) Vascular Occurs most commonly
Switch On Protein-Protein Interactions
Switch On Protein-Protein Interactions Rapid and specific control of signal transduction pathways, protein activity, protein localization, transcription, and more Dimerizer protein 1 protein 2 Clontech
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
from α- to β-cleavage
Supplementary Information Specific antibody binding to the APP 672-699 region shifts APP processing from α- to β-cleavage Song Li 1,6,8, Juan Deng 1,7,8, Huayan Hou 1,8, Jun Tian 1, Brian Giunta 2,3, Yanjiang
Supplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a
COPYRIGHT 2006 SCIENTIFIC AMERICAN, INC.
C R E D I T 72 S C I E N T I F I C A M E R I C A N M AY 2 0 0 6 AL ZHEIMER S DISE A SE gradually severs even one s oldest memories, but scientists are working on promising treatments. Some therapies could
Characterization of Tau Isoforms Expressed in Cultured Human Cortical Neurons on Poly-L-lysine and Laminin Substrates
Characterization of Tau Isoforms Expressed in Cultured Human Cortical Neurons on Poly-L-lysine and Laminin Substrates Introduction Alzheimer s disease is characterized by two main lesions, extra-cellular
!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345()
!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345() Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
7.06 Problem Set #3, 2006
7.06 Problem Set #3, 2006 1. You are studying the EGF/Ras/MAPK pathway in cultured cells. When the pathway is activated, cells are signaled to proliferate. You generate various mutants described below.
Molecular Techniques. 3 Goals in Molecular Biology. Nucleic Acids: DNA and RNA. Disclaimer Nucleic Acids Proteins
Molecular Techniques Disclaimer Nucleic Acids Proteins Houpt, CMN, 9-30-11 3 Goals in Molecular Biology Identify All nucleic acids (and proteins) are chemically identical in aggregate - need to identify
Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic
Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic dose of P +/- GB. ROS production (a) and cell death (b)
New family of Alzheimer s disease-modifying agents that hit multiple biological targets
New family of Alzheimer s disease-modifying agents that hit multiple biological targets Barcelona, 4 de julio de 2013 Content 1. The Research Group 2. The Product a) Target Indications b) Innovative mechanisms
Introduction. Background Information. WORKSHOP: Transforming Your Classroom into a Neuroscience Laboratory. Visit our website at
Introduction The brain is an incredibly important and complex organ. It is responsible for everything your body does, from eating and breathing to playing soccer and learning the violin. When something
Supplementary information for Secretory pathway retention of mutant prion protein
Supplementary information for Secretory pathway retention of mutant prion protein induces p38-mapk activation and lethal disease in mice Berta Puig, Hermann C. Altmeppen, Sarah Ulbrich, Luise Linsenmeier,
A 3D human triculture system modeling neurodegeneration and neuroinflammation in Alzheimer s disease
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0175-4 In the format provided by the authors and unedited. A 3D human triculture system modeling neurodegeneration and neuroinflammation
idimerize Endless Possibilities
idimerize Endless Possibilities signaling pathways mouse models for disease Homodimerization gene expression Heterodimerization enzyme activation apoptosis Reverse dimerization relocalization of proteins
Active full-length DNA Aβ 42 immunization in 3xTg-AD mice reduces not only amyloid deposition but also tau pathology
Rosenberg et al. Alzheimer's Research & Therapy (2018) 10:115 https://doi.org/10.1186/s13195-018-0441-4 RESEARCH Active full-length DNA Aβ 42 immunization in 3xTg-AD mice reduces not only amyloid deposition
ELISA Kit Catalog #KHB0041 (96 tests) #KHB0042 (192 tests)
ELISA Kit Catalog #KHB0041 (96 tests) #KHB0042 (192 tests) Human Tau (Total) www.invitrogen.com Invitrogen Corporation 542 Flynn Road, Camarillo, CA 93012 Tel: 800-955-6288 E-mail: techsupport@invitrogen.com
Ma, et al. Supplemental Data
Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli
AD/PD Conference, Nice, Fr, 2015
AD/PD Conference, Nice, Fr, 2015 Overview, novelties and conclusions for domestic research NAP B MTA TTK MS Neuroproteomics Group Overlaping molecular mechanisms of miss-folded protein based neurodegenerative
Cell biology.
Cell biology Cell biology, formerly called cytology, is a branch of biology that studies the different structures and functions of the cell and focuses mainly on the idea of the cell as the basic unit
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
Scientists don t yet fully
Alzheimer s Disease Genetics FACT SHEET Scientists don t yet fully understand what causes Alzheimer s disease. However, the more they learn about this devastating disease, the more they realize that genes*
Calmodulin Monoclonal Antibody (2D1) Catalog Number MA3-917 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 Calmodulin Monoclonal Antibody (2D1) Catalog Number MA3-917 Product data sheet Details
Identification of a novel cleavage site within the transmembrane domain of β-amyloid precursor protein and its implications in Aβ generation
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2005 Identification of a novel cleavage site within the transmembrane domain
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:CD99 mouse monoclonal antibody, clone OTI1D5 (formerly 1D5) Product Data Sheet - TRUEMAB Catalog: TA800824 Components: CD99 mouse monoclonal antibody,
ALZHEIMER S DISEASE (AD)
ALZHEIMER S DISEASE (AD) AD IS COMMON, PROGRESSIVE, AND INCURABLE ONLY A FEW TREATMENTS KNOWN-HAVE MINIMAL EFFECT SYNAPSE LOSS EVENTUAL MASSIVE NEURONAL DEATH PLAQUES THE AMYLOID CASCADE HYPOTHESIS TANGLES
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:PIK3CG mouse monoclonal antibody, clone OTI1A9 (formerly 1A9) Product Data Sheet - TRUEMAB Catalog: TA505222 Components: PIK3CG mouse monoclonal
TEPZZ 64647ZB_T EP B1 (19) (11) EP B1 (12) EUROPEAN PATENT SPECIFICATION
(19) TEPZZ 64647ZB_T (11) EP 2 646 470 B1 (12) EUROPEAN PATENT SPECIFICATION (4) Date of publication and mention of the grant of the patent: 01.03.17 Bulletin 17/09 (21) Application number: 11794336. (22)
Hsp27 Reduces Phosphorylated Tau and Prevents Cell Death in the Human Neuroblastoma Cell Line SH-SY5Y
Hsp27 Prevents Phosphorylated Tau-induced Cell Death in the SH-SY5Y Bull. Korean Chem. Soc. 2013, Vol. 34, No. 5 1503 http://dx.doi.org/10.5012/bkcs.2013.34.5.1503 Hsp27 Reduces Phosphorylated Tau and
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:F13A1 (Factor XIIIa) mouse monoclonal antibody, clone OTI3E3 (formerly 3E3) Product Data Sheet - TRUEMAB Catalog: TA800346 Components: F13A1 (Factor
C) Based on your knowledge of transcription, what factors do you expect to ultimately identify? (1 point)
Question 1 Unlike bacterial RNA polymerase, eukaryotic RNA polymerases need additional assistance in finding a promoter and transcription start site. You wish to reconstitute accurate transcription by
Regulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
Product Datasheet. ATF3 Antibody NBP Unit Size: 0.1 ml. Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Product Datasheet ATF3 Antibody NBP1-02935 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 2 Protocols, Publications, Related Products,
Compound Re-Profiling. Dr Robert Scoffin CEO, Cresset
Compound Re-Profiling Dr Robert Scoffin CEO, Cresset What is it? F F F N N H 2 N S O O Br > Compound Re-Profiling or Re-Purposing is the process of finding a new clinical use for an existing treatment
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:IL6 mouse monoclonal antibody, clone OTI3G9 (formerly 3G9) Product Data Sheet - TRUEMAB Catalog: TA500067 Components: IL6 mouse monoclonal antibody,
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:PIK3CG mouse monoclonal antibody, clone OTI2B1 (formerly 2B1) Product Data Sheet - TRUEMAB Catalog: TA505221 Components: PIK3CG mouse monoclonal
Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2013-2014 CELL BIOLOGY BIO-2B06 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in
The complexity and multifactorial etiology of AD pose unique
Articles https://doi.org/.38/s459-8-4-z Gain of toxic apolipoprotein E4 effects in human ipsc-derived neurons is ameliorated by a small-molecule structure corrector Chengzhong Wang,, Ramsey Najm,,3, Qin
Product Line Overview
Product Line Overview Your Toolbox for Apoptosis and Necrosis Measurement Product Line Products for accurate quantification of Apoptosis and Necrosis The PEVIVA Product Line is manufactured by VLVbio,
GSI Equine TNF alpha ELISA Kit- Whole Blood DataSheet
GSI Equine TNF alpha ELISA Kit- Whole Blood DataSheet TNF-α, the prototypical member of the TNF protein superfamily, is a homotrimeric type-ii membrane protein (1,2). Membrane bound TNF-α is cleaved by
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:F13A1 (Factor XIIIa) mouse monoclonal antibody, clone OTI1H2 (formerly 1H2) Product Data Sheet - TRUEMAB Catalog: TA800305 Components: F13A1 (Factor
Department of Neurology David Geffen School of Medicine at UCLA Los Angeles, USA
Supervisors: Lars Lannfelt, Professor Department of Public Health and Caring Sciences Uppsala University Uppsala, Sweden Frida Ekholm Pettersson, Assistant Professor Department of Public Health and Caring
Aβ reduction in BACE1 heterozygous null 5XFAD mice is associated with transgenic APP level
Sadleir et al. Molecular Neurodegeneration 2015, 10:1 RESEARCH ARTICLE Open Access Aβ reduction in BACE1 heterozygous null mice is associated with transgenic APP level Katherine R Sadleir 1, William A
Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
Designed Zinc Finger Protein Transcription Factors for Single-Gene Regulation Throughout the Central Nervous System
Designed Zinc Finger Protein Transcription Factors for Single-Gene Regulation Throughout the Central Nervous System Bryan J Zeitler 1 *, Sarah L DeVos 2 *, Susanne K Wegmann 2 *, Kimberly Marlen 1, Qi
SNAP i.d. Protein Detection System. Superior Blots in a Snap!
SNAP i.d. Protein Detection System Superior Blots in a Snap! SNAP i.d. Protein Detection System Superior Blots in a Snap! The SNAP i.d. Protein Detection System revolutionizes immunodetection every time
Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells.
Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells. (A) Non-transformed (Control cells) and v-srctransformed 3T3 cells
7.06 Cell Biology EXAM #2 March 20, 2003
7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
TARGET VALIDATION. Maaike Everts, PhD (with slides from Dr. Suto)
TARGET VALIDATION Maaike Everts, PhD (with slides from Dr. Suto) Drug Discovery & Development Source: http://dlab.cl/molecular-design/drug-discovery-phases/ How do you identify a target? Target: the naturally
MODELING FTDP-17 LINKED TAUOPATHIES AND ALZHEIMER S DISEASE WITH GENETICALLY MODIFIED HUMAN IPSC
MODELING FTDP-17 LINKED TAUOPATHIES AND ALZHEIMER S DISEASE WITH GENETICALLY MODIFIED HUMAN IPSC An Verheyen, PhD Janssen R&D AVerhey1@its.jnj.com Tauopathies & neurodegeneration Frontotemporal dementia
EXPRESSION STUDIES OF THE PROTEOLYTIC p10 FRAGMENT OF THE NEURONAL CDK5 ACTIVATOR IN MAMMALIAN CELLS. CHEN YILIANG (B.Sc.
EXPRESSION STUDIES OF THE PROTEOLYTIC p10 FRAGMENT OF THE NEURONAL CDK5 ACTIVATOR IN MAMMALIAN CELLS CHEN YILIANG (B.Sc. Fudan University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT
INVESTIGATION OF THE BINDING SPECIFICITY OF IGF-IR USING MONOCLONAL ANTIBODIES
INVESTIGATION OF THE BINDING SPECIFICITY OF IGF-IR USING MONOCLONAL ANTIBODIES By Mehrnaz Keyhanfar, Pharm.D. A thesis submitted to the University of Adelaide, South Australia in fulfilment of the requirements
SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
Improved Immunoblot by Brief Application of Low Dose Paraformaldehyde
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 12 29 12 1187 ~ 1193 1 1 2 * 1 310012 2 310053 protein immunoblot Western blot 0 4% 0
Characterization and Functional Analysis of a Newly Identified Human MT5-MMP Transcript Variant Isolated from Multipotent NT2 Cells
Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2006 Characterization and Functional Analysis of a Newly Identified Human MT5-MMP Transcript Variant Isolated
Alzheimer's disease immunization strategies : a review of current research
The University of Toledo The University of Toledo Digital Repository Master s and Doctoral Projects Alzheimer's disease immunization strategies : a review of current research Laura Ona Sirgedas The University
Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by
Supplementary Methods and Figures Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by methylene blue for Alzheimer s disease treatment Wenchao Sun 1, Seongsoo Lee 1,2, Xiaoran
Translation. Protein Synthesis
Protein Structure Translation Protein Synthesis Size and Shape Comparison of Proteins Levels of Protein Structure 1 o 2 o 3 o 4 o Amino Acids Peptide Bonds Proteins are formed by creating peptide bonds
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:KRT7 mouse monoclonal antibody, clone OTI1C5 (formerly 1C5) Product Data Sheet - TRUEMAB Catalog: TA802932 Components: KRT7 mouse monoclonal antibody,
CNS Gene Regulation Platform
CNS Gene Regulation Platform 2018 Forward Looking Statements This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation
Our mission is to advance mitochondrial research and to develop diagnostic tools for mitochondrial disease and drug-induced mitochondrial toxicity.
About MitoSciences Our mission is to advance mitochondrial research and to develop diagnostic tools for mitochondrial disease and drug-induced mitochondrial toxicity. We offer the world s largest library
Quantification of Alzheimer Disease Amyloid β Peptide 43 in Human Brain With a Newly Developed Enzyme-Linked Immunosorbent Assay (ELISA)
Quantification of Alzheimer Disease Amyloid β Peptide 43 in Human Brain With a Newly Developed Enzyme-Linked Immunosorbent Assay (ELISA) Erik Nicklagård 1 1. Department of IFM, Institution for physics,
Figure S1: NIK-deficient cells resist to Tweak/TNFα-induced cell death (a) Two independent clones of NIK WT and NIK KO MEFs were treated for 24 hours with Tweak (200 ng/ml) and TNFα (200 U/ml) and cell
supplementary information
Figure S1 Distribution of heterokaryons in vermis and hemispheres of the cerebellum. Schematic dorsal view of an adult cerebellum with the vermis in the middle (red) flanked by the two hemispheres (grey).
Structure modeling and dynamics driven mutation and phosphorylation analysis of Beta-amyloid peptides
www.bioinformation.net Hypothesis Volume 10(9) Structure modeling and dynamics driven mutation and phosphorylation analysis of Beta-amyloid peptides Sunil kumar Singh, Ankita singh, Ved Prakash* & Selvaa
Human Caspase-3 FlowCytomix Simplex Kit
PRODUCT INFORMATION & MANUAL Human Caspase-3 FlowCytomix Simplex Kit BMS82012FF For research use only. Not for diagnostic or therapeutic procedures. Human Caspase-3 FlowCytomix Simplex Kit North America
APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual
APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual FOR RESEARCH USE ONLY NOT FOR USE IN CLINICAL DIAGNOSTIC PROCEDURES [ PROPERTIES ] 1th Edition
Zool 3200: Cell Biology Exam 3 3/6/15
Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either
RayBio Human jun-b Transcription Factor Activity Assay Kit
RayBio Human jun-b Transcription Factor Activity Assay Kit Catalog #: TFEH-JUNB User Manual Mar 28, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
The role of the E2 copper binding domain in the cell biology of the amyloid precursor protein
The role of the E2 copper binding domain in the cell biology of the amyloid precursor protein Sophee Blanthorn-Hazell BSc. (Hons) A thesis submitted to the University of Lancaster for the degree of Master
Immunoglobulins. (1 of 2)
Immunoglobulins (1 of 2) Immunoglobulins (Igs) = antibodies Each B cell synthesizes Igs of single specificity for a specific epitope B cell receptors (BCRs) are the Igs on B cell surface Humoral immunity