Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells.

Size: px
Start display at page:

Download "Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells."

Transcription

1 Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells. (A) Non-transformed (Control cells) and v-srctransformed 3T3 cells expressing active Src (v-src 37 C) or heat-inactivated Src (v-src 39.5 C) were exposed to a variety of apoptosis-inducing stimuli and caspase-3 activation was detected by anti-cleaved caspase-3 Western-blotting on whole cell lysates. (B) Mitochondria isolated from non-transformed (Control) and v-src-transformed 3T3 cells with either active (v-src 37 C), or heat-inactivated Src (v-src 39.5 C) were incubated with 10 nm tbid for the indicated times and recovered by centrifugation. Cyt-c release was revealed by anti-cyt-c Western blot of mitochondria pellets and supernatants. These results indicated that v-src-transformed 3T3 cell resistance to apoptosis did depend on Src activity. (C) Bax mitochondrial relocation and activation upon staurosporine treatment were revealed by immunostaining of activated Bax with mab5b7 (red) in control cells but not in v-src cells. (D) tbid-induced Bax insertion into mitochondria isolated from control cells was assessed by anti-bax Western blots after alkali treatment (Na2CO3) of pellets previously incubated with 10 nm tbid for the indicated times. First lane shows the total amount of Bax present in isolated mitochondria. Under these conditions, no Bax insertion is observed in mitochondria from v-src cells. (E) Isolated iitochondria from control and v-src-transformed cells were incubated with increasing concentrations of tbid for 30 min. Then, anti-tbid Western blots were performed on pellets and supernatants to reveal the amount of inserted tbid. These results showed that tbid bound to mitochondria from v-src-transformed cells and control cells in an identical manner. (F) Isolated mitochondria from v-src-transformed cells were incubated with increasing concentrations of tbid for 30 min, as in Fig. 1B. Then, mitochondrial pellets were treated with sodium carbonate (Na 2 CO 3 ) and Bax insertion was checked by anti-bax Western blots of the resulting pellets. These results showed that the cyt-c release machinery was functional in mitochondria of v-src-transformed cells, that it depended upon Bax activation, but that higher concentrations of tbid were required to activate it.

2 Figure S2 (related to Fig. 2): (A) Contributions of Bik and Bad to the release of cyt- c from isolated mitochondria from 3T3 untransformed cells (Ctrl Mitochondria) were studied by incubating mitochondria with increasing tbid concentrations with vehicle (Mock) or anti- Bik BH3- domain antibodies or anti- Bad Y208 antibodies. The tbid concentration allowing cyt- c release (*) decreased significantly when Bik, but not Bad, was inhibited. (B) Control cells were transfected with shrna against Bik, Bad, Puma or Bim. Knockdown of endogenous proteins were validated by western-blotting. (C) Control and v-src-transformed cells transiently transfected with a HA-Bik expression plasmid for 36 hours were treated for 6 hours with either vehicle or staurosporine (Stauro). HA-Bik (red) was revealed by immunostaining with anti-ha antibody and nuclei were stained by Hoechst Percentages of cells expressing HA- Bik with pyknotic nuclei are indicated (mean ± SD (in brackets) in three independent experiments). These results show that v-srctransformed cells that express Bik undergo normal apoptosis upon staurosporine induction.

3 Figure S3 (related to Fig. 4): (A) Validation of inhibitors used in Fig.4A. v-src-transformed cells were treated as described in Fig 4A. Lysates were analyzed by western-blotting for phospho- and total amount of substrates of the targeted kinases. (B) Control of expression of plasmids used in Fig. 4B and 4D. (C) Validation of inhibitors and activators of the RAS-RAF-MEK1/2-ERK1/2 pathway used in Figs. 4A and 4B.

4

5 Figure S4 (related to Fig. 6): (A) Bik mrna expression was evaluated by RT-PCR in the four human cell lines. GAPDH expression was used as a control. LS174T do not express BIK. (B) COLO205 were treated overnight with BRAF inhibitor PLX4720. Endogenous BIK and activation of ERK1/2 (perk1/2) were monitored by western-blotting. Inhibition of BRAF restores BIK expression in these cells. (C) Validation of BIM and BIK knockdown in the four human cell lines. Cells were previously treated with PD in order to re-express BIK. (D) Apoptosis was triggered by thapsigargin in NCI-H460, COLO205, HCT116 and LS174T cells silenced for bik or/and bim. SRC was inhibited by dasatinib when indicated. Apoptosis was restored by dasatinib in NCI-H460 and LS174T cells and depended respectively on BIK and BIM. Dasatinib failed to resensitize COLO205 and HCT116. (E) Apoptosis was triggered as in (D) but upon PD treatment instead of SRC inhibition. MEK1/2 inhibition restored sensitivity to apoptosis in NCI- H460 where it depended on BIK and in COLO205 and HCT116 where it depended on both BIK and BIM. In COLO205, BRAF inhibition by PLX4720 was similarly able to resensitize cells to apoptosis.

Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation

Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation *Silvia Laura Locatelli, 1 Giuseppa Careddu, 1 Giuliano Giuseppe Stirparo, 1 Luca Castagna,

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4

More information

Supplementary Figure 1 (related to Figure 1) a. SVEC cells stably expressing egfp tbid 2A BCL xl were analysed by Western blot for expression of egfp

Supplementary Figure 1 (related to Figure 1) a. SVEC cells stably expressing egfp tbid 2A BCL xl were analysed by Western blot for expression of egfp Supplementary Figure 1 (related to Figure 1) a. SVEC cells stably expressing egfp tbid 2A BCL xl were analysed by Western blot for expression of egfp tbid and BCL xl. TOM20 was used as a loading control.

More information

Post-translational modification

Post-translational modification Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/5/233/ra50/dc1 Supplementary Materials for Epidermal Growth Factor Receptor Is Essential for Toll-Like Receptor 3 Signaling Michifumi Yamashita, Saurabh Chattopadhyay,

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

Baxb: A Constitutively Active Human Bax Isoform that Is under Tight Regulatory Control by the Proteasomal Degradation Mechanism

Baxb: A Constitutively Active Human Bax Isoform that Is under Tight Regulatory Control by the Proteasomal Degradation Mechanism Article b: A Constitutively Active Human Isoform that Is under Tight Regulatory Control by the Proteasomal Degradation Mechanism Nai Yang Fu, 1 Sunil K. Sukumaran, 1 Sze Yen Kerk, 1 and Victor C. Yu 1,2,

More information

Supplemental Methods Cell lines and culture

Supplemental Methods Cell lines and culture Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53 Supplementary Information ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53 Kelly D. Sullivan 1, Nuria Padilla-Just 1, Ryan E. Henry 1, Christopher C. Porter 2, Jihye Kim 3,

More information

supplementary information

supplementary information DOI: 10.1038/ncb1864 Figure S1 Apak specifically inhibits p53 transcriptional activity. Transcription activity of p53 was measured in U2OS (p53 wild-type) and H1299 (p53 deficient) cells which were transfected

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs

More information

FSC-H FSC-H FSC-H

FSC-H FSC-H FSC-H Supplement Figure A 4 h control + h B 4 h control + h Supplement Figure A-H BV6/TNF-α + ctrl A B 9 h C D h E F 8 h G H Supplement Figure I-P + ctrl I J 8 h K L 4 h M N h O P Supplement Figure 3 A Survival

More information

VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor

VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor Liang Xue 1, Emily E. Blythe 1, Elyse C. Freiberger 2, Jennifer Mamrosh 1, Alexander S. Hebert

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Supplemental Figure Legends:

Supplemental Figure Legends: Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in

Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro Xia Zhong*, Qian-Qian Wang*, Jian-Wei Li, Yu-Mei Zhang, Xiao-Rong

More information

Li et al., Supplemental Figures

Li et al., Supplemental Figures Li et al., Supplemental Figures Fig. S1. Suppressing TGM2 expression with TGM2 sirnas inhibits migration and invasion in A549-TR cells. A, A549-TR cells transfected with negative control sirna (NC sirna)

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/85/ra48/dc1 Supplementary Materials for The VDAC2-BAK Rheostat Controls Thymocyte Survival Decheng Ren, Hyungjin Kim, Ho-Chou Tu, Todd D. Westergard, Jill K.

More information

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

supplementary information

supplementary information DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or

More information

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10. α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells

More information

DLD1 * cl OD 570nm. OD 570nm NEAA

DLD1 * cl OD 570nm. OD 570nm NEAA Figure S A. ATF4 mrna levels.2.8.6.4.2 HT8 shatf4- cl3 shatf4- cl4 ATF4 mrna levels.2.8.6.4.2 DLD shatf4-cl3 B. C. OD 57nm.7.6.5.4.3 shatf4 cl3 shatf4 cl4 OD 57nm.6.5.4.3.2.2. 2 4 6 day.. NEAA - + - +

More information

Supplemental Information. DNp63 Inhibits Oxidative Stress-Induced Cell. Death, Including Ferroptosis, and Cooperates with

Supplemental Information. DNp63 Inhibits Oxidative Stress-Induced Cell. Death, Including Ferroptosis, and Cooperates with Cell Reports, Volume 21 Supplemental Information DNp63 Inhibits Oxidative Stress-Induced Cell Death, Including Ferroptosis, and Cooperates with the BCL-2 Family to Promote Clonogenic Survival Gary X. Wang,

More information

Fig. S1 Fig. S3 Fig. S4 Fig. S5 Fig. S9 Legend for supplementary figures Fig. S1. RFLP analysis of A7339G clones Platelets from the patient were isolated by centrifugation mixed with mtdna-less rho-0

More information

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

Figure S1: NIK-deficient cells resist to Tweak/TNFα-induced cell death (a) Two independent clones of NIK WT and NIK KO MEFs were treated for 24 hours with Tweak (200 ng/ml) and TNFα (200 U/ml) and cell

More information

TE5 KYSE510 TE7 KYSE70 KYSE140

TE5 KYSE510 TE7 KYSE70 KYSE140 TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac

More information

In-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION

In-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION In-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION IMMUNOFLUORESCENT-BASED ASSAY MULTIPLE TARGETS In-Cell Western QUANTITATIVE

More information

Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter

Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site

More information

Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic

Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic dose of P +/- GB. ROS production (a) and cell death (b)

More information

Supplemental Information

Supplemental Information Supplemental Information RSPO3-LGR4 regulates osteogenic differentiation of human adipose-derived stem cells via ERK/FGF signaling Min Zhang a,b1, Ping Zhang a,b1, Yunsong Liu a,b, Longwei Lv a,b, Xiao

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information

Supplementary Information

Supplementary Information Supplementary Information Negative regulation of initial steps in skeletal myogenesis by mtor and other kinases Raphael A. Wilson 1*, Jing Liu 1*, Lin Xu 1, James Annis 2, Sara Helmig 1, Gregory Moore

More information

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Department of Anatomy, Yong Loo Lin School of Medicine, National University of Singapore MD10, 4 Medical Drive, Singapore 117597 ABSTRACT

More information

Technical tips Session 4

Technical tips Session 4 Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules

More information

Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in

Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Supplementary information Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer s disease Zhentao Zhang, Mingke Song, Xia Liu, Seong Su Kang, Il-Sun Kwon, Duc

More information

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

More information

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated

More information

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in BL2 cells. The Ponceau S staining of the membranes or

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology

More information

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al., Supplemental material JCB Kimura et al., http://www.jcb.org/cgi/content/full/jcb.201503023/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. TRIMs regulate IFN-γ induced autophagy. (A and B) HC image analysis

More information

Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning

Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty

More information

a. Increased active HPSE (50 kda) protein expression upon infection with multiple herpes viruses: bovine

a. Increased active HPSE (50 kda) protein expression upon infection with multiple herpes viruses: bovine Fold change vs uninfeced MOI 0.1 MOI 1 MOI 0.1 MOI 1 MOI 0.001 MOI 0.01 Fold change vs uninfected a 6 4 2 50 kda HPSE * ** * * BHV PRV HSV-2 333 ** * 0 - + + - + + - + + b 50 kda HPSE 3 2 ** *** mock inf

More information

Figure 1-Figure Supplement 1 Validation of knockdown efficiency for trpa1 RNAi and RyR RNAi lines.

Figure 1-Figure Supplement 1 Validation of knockdown efficiency for trpa1 RNAi and RyR RNAi lines. Figure 1-Figure Supplement 1 Validation of knockdown efficiency for trpa1 RNAi and RyR RNAi lines. (A) Cartoon depicting the four characterized trpa1 isoforms. The target regions of trpa1 RNAi lines used

More information

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

More information

b alternative classical none

b alternative classical none Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh

More information

Figure S1. Mechanism of ON induced MM cell death.

Figure S1. Mechanism of ON induced MM cell death. Figure S1. Mechanism of ON123300 induced MM cell death. To elucidate whether ON123300 induced decrease of viability of MM cells was associated with induction of apoptosis, the number of apoptotic cells

More information

Advanced phospho-erk1/2 (Thr202/Tyr204) 500 tests

Advanced phospho-erk1/2 (Thr202/Tyr204) 500 tests Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64aerpeg USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were

More information

MCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes

MCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes Supplemental Information Supplemental figure legends Figure S. Supplemental figure for Fig... Different methods of cell detachment similarly induce YP phosphorylation. MCF0 cells were trypsinized and attached

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136

More information

p53 is activated in response to disruption of the pre-mrna splicing machinery.

p53 is activated in response to disruption of the pre-mrna splicing machinery. p53 is activated in response to disruption of the pre-mrna splicing machinery. Nerea Allende-Vega, Saurabh Dayal, Usha Agarwala, Alison Sparks, Christophe Bourdon and Mark K. Saville. Jean- Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 0 DOI: 0.0/NMICROBIOL.0. The host protein CLUH participates in the subnuclear transport of influenza virus ribonucleoprotein complexes Tomomi Ando,, Seiya Yamayoshi, Yuriko Tomita,, Shinji

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Transiently overexpressed ECFP-TIAF1/EYFP-TIAF1 causes apoptosis of Mv1Lu cells. Mv1Lu cells were transfected by electroporation with ECFP, EYFP, ECFP-TIAF1, EYFP-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12138 Supplementary Figure 1. Knockdown of KRAS leads to a reduction in macropinocytosis. (a) KRAS knockdown in MIA PaCa-2 cells expressing KRASspecific shrnas

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

Mitochondria/Cytosol Fractionation Kit

Mitochondria/Cytosol Fractionation Kit Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1 Effect of ROCK inhibition on lumen abnormality in MDCK cysts. (A) MDCK cells as indicated cultured in Matrigel were treated with and without Y27632 (10

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,

More information

Supplementary methods Shoc2 In Vitro Ubiquitination Assay

Supplementary methods Shoc2 In Vitro Ubiquitination Assay Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the

More information

Supplementary Infomation

Supplementary Infomation Supplementary Infomation Mycobacterium avium MAV2054 protein induces macrophage apoptosis through targeting to mitochondria and reduces intracellular growth of the bacteria. Kang-In Lee 1,2, Jake Whang

More information

7.06 Problem Set #3, 2006

7.06 Problem Set #3, 2006 7.06 Problem Set #3, 2006 1. You are studying the EGF/Ras/MAPK pathway in cultured cells. When the pathway is activated, cells are signaled to proliferate. You generate various mutants described below.

More information

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Immunity, Volume 39 Supplemental Information Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Jorg van Loosdregt, Veerle Fleskens, Juan

More information

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

(a) Immunoblotting to show the migration position of Flag-tagged MAVS Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

More information

Supplementary Information. HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis

Supplementary Information. HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis Supplementary Information HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis by recruiting EZH2 and repressing p27kip1/cdk2 signaling Jiao-Jiao Hu 1, Wei Song 1, Shao-Dan Zhang 1, Xiao-Hui

More information

B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.

B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor. DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt

More information

Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells

Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells A Dissertation for the Degree of Doctor of Philosophy Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells Department of Pharmacy Graduate School Chungnam National University By Minh

More information

ER stress and autophagy: new players in the mechanism of action and drug resistance of SUPPLEMENTAL DATA

ER stress and autophagy: new players in the mechanism of action and drug resistance of SUPPLEMENTAL DATA ER stress and autophagy: new players in the mechanism of action and drug resistance of the cyclin-dependent kinase inhibitor SUPPLEMENTAL DATA METHODS Confocal immunofluorescence microscopy of fixed cells:

More information

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were 1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies

More information

Supplementary Information

Supplementary Information Supplementary Information Supplemental Material and Methods sirna, plasmids and antibodies Cell were transfected with 10 nm Hs_WIG1_1 sirna (siw1), Hs_WIG1_2 sirna (siw2), Hs_XRN1_1 (sixrn1), Hs_DCP1A_6

More information