Nucleic Acid Research Group Study: A Follow Up on the Comparison of Different Priming Strategies for cdna synthesis by Reverse Transcriptase
|
|
|
- Crystal Neal
- 6 years ago
- Views:
Transcription
1 Nucleic Acid Research Group Study: A Follow Up on the Comparison of Different Priming Strategies for cdna synthesis by Reverse Transcriptase
2 NARG Survey Results for Types of Primers Used for RT Reactions Reverse Transcription Primer Used Random primers Oligo(dT) Gene-specific primer Random primers and oligo(dt) mixed Sample is provided # of respondents
3 Last Year s Study Goals To evaluate priming strategies used in the reverse transcriptase (RT) reaction to make cdna for use in realtime qpcr Compare randomers, oligo(dt), anchored oligo(dt), and GSP Compare randomers of different lengths Compare combinations of randomers and Oligo (dt)
4 Conclusions The use of longer randomers (15-, 18-, and 21-mers) did not perform as well as the shorter randomers (6- and 9-mers) with respect to giving lower Ct values and higher ΔCt differences. Oligo (dt) and anchored oligo (dt) appear to be equally as effective in generating cdna for use in qpcr Oligo (dt) or anchored oligo (dt) appear to be more effective primers than randomers when the assays are designed closer to the end of the transcript.
5 Real-Time qpcr Assay Maps hβ-actin transcript hβ-actin bases (NM_001101) Total length bases 71 bases 344 hβ-glucuronidase transcript 5 bases (NM_000181) hβ-gus Total length bases 66 bases htata Binding Protein transcript 746 bases 5 (NM_003194) htbp Total length bases 80 bases
6 -End Assays 5 Human β-actin transcript Total length bases β-actin2 187 bases 89 bases 2 Stem Structures by m-fold Human β-glucuronidase transcript Total length bases GUS1 344 bases 5 66 bases 3 Stem Structures by m-fold 5 Human TATA Binding Protein Total length bases TBP2 257 bases 77 bases 4 Stem Structures by m-fold
7 Upstream Assays 5 hβ-actin transcript β-actin1 695 bases Total length bases 71 bases 7 Stem Structures by m-fold 5 GUS2 661 bases hβ-glucuronidase transcript Total length bases 80 bases 9 Stem Structures by m-fold 5 htata Binding Protein transcript Total length bases TBP1 746 bases 80 bases 8 Stem Structures by m-fold
8
9 Reverse Transcriptase Method Primers (synthesized by Integrated DNA Technologies) Randomers: 6-mers and 9-mer Oligo(dT) 20 6-mer/Oligo(dT) 20 and 9-mer/Oligo(dT) 20 combinations Gene Specific Primers: β-actin, β-glucuronidase, TATA Binding Protein Gene Specific Primer Pool: pool of GSP from all 7 assays No Primer and No Primer, No RT RNA FirstChoice Human Brain Reference RNA (Ambion) One of the same reference RNAs used as an External RNA Control (ERC) in the MAQC study (Nature Biotechnology: 24, , 2006) RT Assay SuperScript III cdna synthesis kit per manufacturer s (Invitrogen Corp) 100 ng total RNA/reaction Primer (final conc. for 20 μl rxn) Randomer: 4 μm Oligo (dt): 2.5 μm Combos: 2 μm randomer + 2 μm oligo dt Gene specific primer and pool: 400 nm Randomers and Randomer combos: 25 C, 10 min then 50 C, 50 min Oligo (dt), GSP: 50 C, 50 min Triplicate reactions
10 Bioanalyzer Analysis of the Study RNA Liquid Dried (Speed Vac)
11 Quantitative PCR Methods qpcr Conditions: Reaction Components Final Concentration (20 μl vol.) cdna 1/10 cdna (10 ng RNA Equiv) Primer(s) 500 nm Probe 250 nm Chemistry ABI 2x Master Mix qpcr Results Collected Ct values ΔCt = Ct primer -Ct no primer
12 Statistical Analysis The effect of each variable on Ct or ΔCt levels were assessed using a one-way analysis of variance (ANOVA) with the JMP v 5.01 Statistical Discovery Software (SAS Institute, Cary, NC). The green diamonds represent the mean and the standard error which is a pooled estimate of the variance. A Student s t-test was used to assess for significant difference levels (P < 0.05) between the groups contained within each variable.
13 Effect of RT Priming Strategy on Ct and ΔCt Ct ΔCt
14 Effect of Assay on Ct Levels 40 Ct GUS1 GUS2 GUS3 TBP1 TBP2 b-actin1 b-actin2 Assay
15 Effect of Enzyme on Ct and ΔCT
16 Human β-actin Assays 5 β-actin2 89 bases 187 bases 5 β-actin1 695 bases 7 71 bases Stem Structures by m-fold Total length bases NM_001101
17 β-actin Amplificaton Plots β-actin 1 β-actin 2 GSP pool β actin 1 6-mer 9-mer RT-no primer oligo-dt dt+6-mer dt+9mer β actin 2 GSP pool 6-mer 9-mer dt+6-mer dt+9mer oligo-dt RT-no primer
18 Effect of RT Primer on β-actin Assay Ct Levels β-actin1 Assay-695 bases from 3 end P< β-actin2 Assay-187 bases from end P<0.0001
19 Human β-glucuronidase Assays 5 GUS1 344 bases 66 bases 3 Stem Structures by m-fold 5 GUS2 661 bases 80 bases 9 Stem Structures by m-fold 5 GUS bases 72 bases 22 Stem Structures by m-fold Total Transcript Length = 2245 bases NM_000181
20 β-glucuronidase Amplification Plots β-gus 1 β-gus 2 β-gus 3 β-gus 1 6-mer GSP pool β GUS 3 GSP pool dt+6 mer dt+9-mer oligo-dt GSP pool 9-mer RT-no primer 6-mer β-gus 2 dt+6-mer RT-no primer 9-mer dt+9-mer oligo-dt 6-mer 9-mer dt+9-mer oligo-dt RT-no primer dt+6-mer
21 Effect of RT Primer on GUS Assay Ct Levels GUS1 Assay-344 bases from end3 GUS2 Assay-661 bases from 3 end P< P< GUS3 Assay-1282 bases from 3 end P<0.0001
22 Effect of RT Primer on GUS Assay Ct Levels Primer Level* Mean No Primer A OdT B mer/OdT C mer C D mer/OdT C D mer C D E GUS3 D E GSPP E *Levels not connected by same letter are significantly different, P<0.05. N
23 Human TATA Binding Protein Assays 5 TBP2 257 bases 77 bases 4 Stem Structures by m-fold 5 TBP1 746 bases 80 bases 8 Stem Structures by m-fold Total Transcript Length bases NM_003194
24 TATA Binding Protein Amplification Plots TBP 1 TBP 2 oligo-dt TBP2 TBP1 dt+9-mer GSP pool dt+6-mer 9-mer 6-mer 9-mer dt+9-mer oligo-dt 6-mer RT-no primer GSP pool dt+6-mer RT-no primer
25 Effect of RT Primer on TBP Assay Ct Levels TBP1 Assay-746 bases from end P< TBP2 Assay-257 bases from end P<0.0019
26 CONCLUSIONS RNA has a high capability to self prime even when a high temperature ture RT enzyme like SuperScript III is used. Gene specific RT priming generates the lowest Ct values for β-actin,, TBP and β- GUS. But, a gene specific priming strategy may not always be the t best fit for studies in which levels of multiple transcripts would be assessed from the same sample. The Gene Specific Primer Pool may be a possible alternative to generate g cdna from multiple transcripts from the sample. However, the cdna generated should be tested in all assays prior to beginning a study. While no discernable differences were observed between the Oligo(dT) and randomer priming for all three transcripts measured in the most 3 assays, Oligo(dT) by itself fared poorly in the assays designed further away from the -end. 3 The behavior of the GUS2 primers is attributed to similarity between the transcript sequence to sequence of non-coding RNA.
27 What is the Best Priming Strategy to Use to Generate cdna for Use in qpcr? The use of randomer-oligo(dt) combinations in the RT reaction appear to give universally lower Ct values and higher ΔCt differences regardless of the assay location. If the cdna will be used for only 1 gene assay, the appropriate gene-specific primer may be a better choice. A gene specific primer pool might be considered as well, but the cdna product should be tested in all assays.
28 Nucleic Acids Research Group Sridar V. Chittur Kevin L. Knudtson Deborah S. Grove Deborah J. Hollingshead Timothy C. Hunter Gregory L. Shipley Katia Sol-Church William L. Taylor Anthony Yeung (EB liaison) University at Albany, SUNY University of Iowa Penn State University University of Pittsburgh University of Vermont UTHSC- Houston A. I. dupont Hospital for Children UTHSC- Memphis Fox Chase Cancer Center
SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
SYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna
BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign
PrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
Real-Time PCR Validations
Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed
Score winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O
www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100
Real-time, or quantitative reverse transcription
Journal of Biomolecular Techniques 16:266 271 2005 ABRF R AB F Analysis of One-Step and Two- Step Real-Time RT-PCR Using SuperScript III Michael J. Wacker and Michael P. Godard Applied Physiology Laboratory,
PrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
Stratagene QPCR Human Reference Total RNA
Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits
qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
Amino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
II First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
Gene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
Quant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
DNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
AMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
PrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
ReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months
www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT
Premix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
PrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
T7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
SYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
Globin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...
Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline
Quant-X One-Step qrt-pcr TB Green Kit User Manual
Takara Bio USA Quant-X One-Step qrt-pcr TB Green Kit User Manual Cat. No. 638317 PT5058-1 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United
RT 2 Easy First Strand Handbook
March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
IDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol
IDEAL TM Spike-In RNA Kit Individual Assays Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Workflow
Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR
BioBank cdna kit Instructions for the use of BioBank control cdna in real-time PCR Contents Introduction 3 Kit contents 4 Reagents and equipment to be supplied by user 4 Kit storage and stability 4 Primerdesign
GeneChip Eukaryotic Small Sample Target Labeling Assay Version II *
GENE EXPRESSION MONITORING TECHNICAL NOTE GeneChip Eukaryotic Small Sample Target Labeling Assay Version II * Introduction There is an overwhelming and continuing demand for a well characterized protocol
Introduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
B r1 US M
References: 1. Van Gelder, R.N. et al. (1990) Proc Natl Acad Sci USA 87: 1663-1667 2. Cox and Singer (2004) Biotechniques 36 (1): 114 3. Cox, et al. (2004) Analytical Biochemistry 331(2): 243-254 4. Ståhlberg
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
PCR Add-on Kit for Illumina Instruction Manual
PCR Add-on Kit for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina) 015 (QuantSeq 3 mrna-seq Library
Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
Roche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation
Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation
AdnaTest ProstateCancerDetect
AdnaTest ProstateCancerDetect RT-PCR Kit for detection of prostate cancer associated gene expression in enriched tumor cells For diagnostic use Manual T-1-521 Contents Order Information... 3 Purpose...
SYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR
User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data
Agilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
Real-Time PCR: Practical Issues and Troubleshooting Mehmet Tevfik DORAK, MD PhD
Real-Time PCR: Practical Issues and Troubleshooting Mehmet Tevfik DORAK, MD PhD Dept of Environmental & Occupational Health Robert Stempel College of Public Health and Social Work Florida International
mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis
mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis A Maxwell RSC mirna Tissue Kit Application Note Materials Required: Maxwell RSC mirna Tissue Kit (Cat.# AS1480) QuantiFluor RNA System
Introduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
Section 2: Eukaryotic Sample and Array Processing Rev. 3
Section 2: Eukaryotic Sample and Array Processing 701024 Rev. 3 Section 2 Contents Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2.1.3 Eukaryotic Chapter 2 Eukaryotic
User Bulletin #2. ABI PRISM 7700 Sequence Detection System. Introduction. Contents. December 11, 1997
User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be performed to standardize
SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk
Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Kit Components... 4 IV. Materials Required but
Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
DyNAmo Flash SYBR Green qpcr Kit
DyNAmo Flash SYBR Green qpcr Kit Instruction manual F-415S F-415L 40 reactions (50 µl each) or 100 reactions (20 µl each) 200 reactions (50 µl each) or 500 reactions (20 µl each) Description... 2 Kit Components...
Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN
Instructions for Use RealStar Lassa Virus RT-PCR Kit 1.0 04/2017 EN RealStar Lassa Virus RT-PCR Kit 1.0 For research use only! (RUO) 641003 INS-641000-EN-S01 96 04 2017 altona Diagnostics GmbH Mörkenstr.
DyNAmo HS SYBR Green qpcr Kit
DyNAmo HS SYBR Green qpcr Kit Instruction manual F-410S Sufficient for 40 reactions (50 µl each) F-410L Sufficient for 200 reactions (50 µl each) Description... 2 Applications... 2 Kit Components... 2
REAL-TIME PCR: FROM THEORY TO PRACTICE REAL-TIME PCR.
REAL-TIME PCR: FROM THEORY TO PRACTICE REAL-TIME PCR Put the odds in your favor with SuperScript RT. Engineered to be RNase H and incredibly thermostable, SuperScript III RT delivers robust first-strand
Laboratory #7 PCR PCR
1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis
PCR mini-catalog. Premium enzymes & kits
PCR mini-catalog Premium enzymes & kits PCRP C R PCR / RT-PCR and Real Time PCR Since its discovery by Kary Mullis, PCR has become the corner stone of molecular biology leading to developments in genetic
Amplify RP. Assay Design Help Book. Discover what AmplifyRP can do for you. Discovery Kits. Page 1
Amplify RP Discovery Kits Assay Design Help Book Discover what AmplifyRP can do for you. Page 1 Table Contents Permitted Use of Product 3 Storage of Product 3 Warranty Information 3 AmplifyRP Overview
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Benchmarking of qpcr and qrt-pcr master mixes Resistance to common inhibitors in animal matrix extracts
Benchmarking of qpcr and qrt-pcr master mixes Resistance to common inhibitors in animal matrix extracts Rick Conrad, Sarah A. Read, Sharon A. Matheny Thermo Fisher Animal Health R&D The world leader in
User Guide. Full-Length cdna Amplification Kit. Catalog Numbers: 013 (TeloPrime Full-Length cdna Amplification Kit) 018 (TeloPrime PCR Add-on Kit)
Full-Length cdna Amplification Kit User Guide Catalog Numbers: 013 (TeloPrime Full-Length cdna Amplification Kit) 018 (TeloPrime PCR Add-on Kit) 013UG022V0105 FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC
All-in-One TM mirna qrt-pcr Detection Kit
mirna qrt-pcr Detection Kit For quantitative detection of mature mirna Cat. No. QP015 (20 RT and 200 qpcr reactions) Cat. No. QP016 (60 RT and 600 qpcr reactions) Used in combination with the All-in-One
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
Lecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples
APPLICATION NOTE SuperScript IV Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples Introduction Most commercially available reverse transcription products do not perform well with difficult
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
QuantiTect Primer Assay Handbook
July 2011 QuantiTect Primer Assay Handbook For genomewide, ready-to-use real-time RT-PCR assays using SYBR Green detection Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
Thermo Scientific DyNAmo Probe qpcr Kit
PRODUCT INFORMATION Thermo Scientific DyNAmo Probe qpcr Kit #F-450L Lot Store F at -20 C Expiry Date _ www.thermoscientific.com/onebio Rev. 2 f 2 COMPONENTS OF THE KIT Contents COMPONENTS OF THE KIT...
LAMP User Guide Assay Design & Primers
Contents Page Page Content 2 Assay Design overview 3 Assay Design Custom Design Service 4 Assay Design - Software 5 Assay Design Target Sequence 7 Primers Primer Concentrations 9 Primers Preparing Primer
Precision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR
Precision MULTIPLEX qpcr Master Mix Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents
Molekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien
Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change
CLASSI DI LAUREA IN BIOTECNOLOGIE Corso di Laurea in Biotecnologie Mediche e Medicina Molecolare
CLASSI DI LAUREA IN BIOTECNOLOGIE Corso di Laurea in Biotecnologie Mediche e Medicina Molecolare CORSO IN BIOTECNOLOGIE APPLICATE ALLA FISIOPATOLOGIA ENDOCRINA REAL-TIME PCR DOCENTE: PROF.SSA ANNALISA
TaqMan Advanced mirna Assays
PRODUCT BULLETIN TaqMan Advanced mirna Assays TaqMan Advanced mirna Assays Key features Universal reverse transcription (RT) one RT step for all Applied Biosystems TaqMan Advanced mirna Assays Sensitive
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
Lecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
Real-time PCR. TaqMan Protein Assays. Unlock the power of real-time PCR for protein analysis
Real-time PCR TaqMan Protein Assays Unlock the power of real-time PCR for protein analysis I can use my real-time PCR instrument to quantitate protein? Do protein levels correlate with related mrna levels
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
A peer-reviewed version of this preprint was published in PeerJ on 16 March 2018.
A peer-reviewed version of this preprint was published in PeerJ on 16 March 2018. View the peer-reviewed version (peerj.com/articles/4473), which is the preferred citable publication unless you specifically
The Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
PRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
Same TaqMan Assay quality, new format
Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable