CLONTECH. TITANIUM TM One-Step RT-PCR Kit User Manual PT (PR12222) Published 29 January Catalog #: K1403-1, -2

Size: px

Start display at page:

Download "CLONTECH. TITANIUM TM One-Step RT-PCR Kit User Manual PT (PR12222) Published 29 January Catalog #: K1403-1, -2"

Derek Stafford
6 years ago
Views:

1 CLONTECH Innovative Tools to Accelerate Discovery TITANIUM TM One-Step RT-PCR Kit User Manual PT (PR12222) Published 29 January 2001 Catalog #: K1403-1, -2 See List of Components for storage conditions FOR RESEARCH USE ONLY

2 Table of Contents I. Introduction & Protocol Overview 3 II. List of Components 6 III. Additional Materials Required 6 IV. General Considerations 7 V. One-Step RT-PCR Procedure 9 VI. Troubleshooting Guide 10 VII. References 11 VII. Related Products 11 List of Figures Figure 1. Analysis of HSP70 gene expression after heat shock 3 Figure 2. Amplification of genes expressed at both high and low levels 5 Figure 3. High sensitivity of TITANIUM TM One-Step RT-PCR 5 Notice to Purchaser This product is intended to be used for research purposes only. It is not to be used for drug or diagnostic purposes nor is it intended for human use. CLONTECH products may not be resold, modified for resale, or used to manufacture commercial products without written approval of CLONTECH. This product is optimized for use in the Polymerase Chain Reaction ( PCR ) covered by patents owned by Hoffmann-La Roche, Inc., and F. Hoffmann-La Roche, Ltd. ( Roche ). No license under these patents to use the PCR process is conveyed expressly or by implication to the purchaser by the purchase of this product. A license to use the PCR process for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers such as CLONTECH Laboratories, Inc., when used in conjunction with an authorized thermal cycler, or is available from Perkin-Elmer Corporation. Further information on purchasing licenses to practice the PCR process may be obtained by contacting the Director of Licensing at the Perkin-Elmer Corporation, 850 Lincoln Centre Drive, Foster City, CA 94404, or at Roche Molecular Systems, Inc., 1145 Atlantic Avenue, Alameda, CA TaqStart TM Antibody is licensed under U.S. Patent #5,338,671 and corresponding patents in other countries. GC-Melt is licensed under U.S. Patent #5,545,539 and corresponding patents in other countries. Advantage is a registered trademark and GC-Melt TM, TaqStart TM, and TITANIUM TM are trademarks of CLONTECH Laboratories, Inc. NucleoBond and NucleoSpin are registered trademarks of Macherey-Nagel GmbH & Co. GeneAmp is a registered trademark of Roche Molecular Systems, Inc., licensed to PE Corporation. 2001, CLONTECH Laboratories, Inc. CLONTECH Laboratories, Inc. Protocol # PT Version # PR12222

3 I. Introduction & Protocol Overview TITANIUM TM One-Step RT-PCR Kit User Manual The TITANIUM TM One-Step RT-PCR Kit offers a unique system for performing RT-PCR in a single step, in a single tube. Four attributes an engineered reverse transcriptase mutant, a Thermostabilizing Reagent, GC-Melt TM, and TITANIUM TM Taq DNA Polymerase set Advantage apart from other similar RT-PCR kits. This novel technique allows you to detect and estimate the amounts of specific mrnas with high sensitivity and unparalleled convenience. Advantage One- Step RT-PCR (patent pending) is recommended for general use in analyzing gene expression in tissue samples or cell culture systems. This method is particularly useful for applications in which the expression of a single or few genes must be analyzed in many different total RNA samples (Figure 1). In contrast, for applications in which many genes must be analyzed in few RNA samples, two-step RT-PCR is usually a better approach. For these cases, we recommend our Advantage RT-for-PCR Kit (#K1402-1, -2). RT-PCR is a highly sensitive and versatile technique that is widely used for measuring gene expression in tissues and cultured cells (Powell et al., 1987; Wilkinson, 1998). Traditionally, RT-PCR is performed in two steps: a first-strand cdna synthesis step using reverse transcriptase, followed by a PCR step using a thermostable DNA polymerase. These two-step procedures require either multiple tubes or the sequential addition of enzymes and other reagents to a single tube. In contrast, the TITANIUM One-Step RT-PCR Kit allows cdna synthesis and PCR to be performed in a single optimized buffer, with a single enzyme mix no additional reagents are needed after the reaction is initiated. This method reduces the possibility of cross-contamination and provides a very convenient technique for detecting gene expression (Murakawa et al., 1988; Aatsinki et al., 1994; Sellner and Turbett, 1998). 1,000 bp M 0' 20' 40' 60' HSP G3PDH Figure 1. Analysis of HSP70 gene expression after heat shock. TITANIUM One-Step RT-PCR was performed using 1 µg of total RNA isolated from HeLa cells after heat shock at 42 C for 0, 20, 40, and 60 minutes. A 263-bp HSP70 mrna fragment was reverse transcribed at 50 C for 1 hr and amplified using 32 PCR cycles. As a normalization control, a 450-bp G3PDH mrna fragment was reverse transcribed at 50 C for 1 hr and amplified using 26 PCR cycles. RT-PCR products were analyzed on an agarose/etbr gel. Lane M: DNA size markers. Protocol # PT CLONTECH Laboratories, Inc. Version # PR

4 I. Introduction & Protocol Overview continued TITANIUM One-Step RT-PCR offers the following additional benefits: Wide dynamic range Reliably amplifies cdnas for low-abundance and high-abundance mrnas (Figure 2). High yields Low-level gene expression is not missed. High sensitivity Amplifies target transcripts from as little as 10 pg of total RNA or 50 molecules of a synthetic RNA (Figure 3). Robust RT-PCR Successfully amplifies high-abundance transcripts from very crude total RNA preparations. Flexible amplicon Our proprietary Moloney murine leukemia virus design (MMLV) reverse transcriptase mutant has reduced RNase H activity. This characteristic enhances cdna synthesis processivity, producing longer cdnas. As a result, you can target PCR primers near the 5' end of transcripts, if necessary. Reduces RNA Inclusion of our Thermostabilizing Reagent in the secondary structure reaction allows reverse transcription to be performed at 50 C, minimizing problems due to RNA folding (Carninci et al., 1998). Advanced PCR Our TITANIUM TM Taq DNA Polymerase contains enzyme system a 5'-exonulcease-deficient, thermostable DNA polymerase and TaqStart TM Antibody for automatic hot-start PCR. Furthermore, because TITANIUM Taq works best at the high Mg 2+ concentrations favored by reverse transcriptases, it is far superior for RT-PCR applications than Taq-based systems. Reads through This powerful PCR feature is made possible by GC-rich templates our GC-Melt reagent which destabilizes basepairing in GC-rich regions. CLONTECH Laboratories, Inc. Protocol # PT Version # PR12222

5 I. Introduction & Protocol Overview continued bp M , Relative # PCR Lane Transcript abundance cycles 1 EGFR-3 low 40 2 p53 low 30 3 IFN-8-R med 25 4 ILGF-1 low 40 5 PDGF-B low 25 6 IFN-8 low 30 7 β-actin high 30 8 IL-8 low/med 30 9 G3PDH high 25 Figure 2. Amplification of genes expressed at both high and low levels. TITANIUM One-Step RT-PCR reactions were performed, and products were analyzed via agarose/etbr gel electrophoresis. 1 µg of human placenta total RNA was used as template for each reaction, and nine different human transcripts were amplified. Relative abundances were derived from established expression levels and our unpublished data. Lane M: DNA size markers. A 1,000 bp M B 1,000 bp M Figure 3. High sensitivity of TITANIUM TM One-Step RT-PCR. The target transcript was reverse transcribed at 50 C for 1 hr and amplified using 40 PCR cycles; RT-PCR products were analyzed via agarose/etbr gel electrophoresis. Panel A. Serial 10-fold dilutions of a synthetic RNA (synthesized in vitro using T7 RNA polymerase) served as templates for TITANIUM One-Step RT-PCR. Lane 1: 5 x 10 5 molecules of synthetic RNA. Lane 2: 5 x 10 4 molecules. Lane 3: 5 x 10 3 molecules. Lane 4: 500 molecules. Lane 5: 50 molecules. Lane 6: 5 molecules. Lane 7: 1 molecule. Lane 8: no template. Lane M: DNA size markers. Panel B. Different amounts of mouse liver total RNA were used as a template for Advantage One-Step RT-PCR to amplify the β-actin transcript. Lane 1: 1 µg of total RNA. Lane 2: 100 ng. Lane 3: 10 ng. Lane 4: 1 ng. Lane 5: 100 pg. Lane 6: 10 pg. Lane 7: 1 pg. Lane 8: no template. Lane M: DNA size markers. Protocol # PT CLONTECH Laboratories, Inc. Version # PR

6 II. List of Components Store Control Mouse Liver Total RNA at 70 C. Store all other components at 20 C. Sufficient reagents are supplied for 30 (#K1403-1) or 100 (#K1403-2) RT-PCR reactions. 30 rxns 100 rxns 30µl 100 µl 50X RT-TITANIUM TM Taq Enzyme Mix (includes MMLV-RT mutant, TITANIUM Taq DNA Polymerase, and TaqStart Antibody) 150 µl 500 µl 10X One-Step Buffer (400 mm Tricine, 200 mm KCl, 30 mm MgCl 2, 37.5 µg/ml BSA) 30µl 100 µl 50X dntp Mix (10 mm each of datp, dctp, dgtp, and dttp; final rxn concentration: 0.2 mm each) 750 µl 2.8 ml Thermostabilizing Reagent Thaw Thermostabilizing Reagent at room temperature before use and vortex to resuspend crystals. If residual precipitate fails to dissolve, spin and use supernatant. 300 µl 1 ml GC-Melt TM 30µl 100 µl Oligo(dT) Primer (20 µm; dt[18]) 15µl 50µl Recombinant RNase Inhibitor (40 units/µl; cloned from human placenta) 30µg 100 µg Control Mouse Liver Total RNA (1 µg/µl) 30µl 100 µl Control Mouse β-actin Primer Mix (45 µm each) 5' Primer: 5' GTGGGCCGCTCTAGGCACCAA 3' 3' Primer: 5' CTCTTTGATGTCACGCACGATTTC 3' 1.5 ml 3 ml RNase-Free H 2 O III. Additional Materials Required The following reagents are required but not supplied. [optional] Mineral oil (We recommend Sigma Cat. #M-3516.) 0.5-ml PCR reaction tubes (We recommend Perkin-Elmer GeneAmp 0.5-ml reaction tubes [Cat. #N or N ].) Dedicated pipettors PCR pipette tips suitable to the above pipettors and preferably equipped with hydrophobic filters. DNA size markers 5X Stop/loading buffer (Sambrook et al. [1989] provides several recipes.) CLONTECH Laboratories, Inc. Protocol # PT Version # PR12222

7 IV. General Considerations A. RNA Preparation The use of non-degraded, pure total RNA is critical for synthesizing highquality cdna for PCR. RNA should have an A 260 /A 280 ratio of 1.7 or higher and should be evaluated on a denaturing formaldehyde/agarose gel to verify integrity prior to cdna synthesis. The sensitivity of TITANIUM One- Step RT-PCR decreases as RNA purity decreases. For detecting mediumand low-abundance transcripts, an A 260 /A 280 ratio 1.8 is recommended. Total RNA can be prepared by any standard method. See Sambrook, et al. (1989) as a reference. For optimal results use 1 µg 1 ng of RNA per RT- PCR reaction. To avoid contamination and degradation of RNA, follow these precautions: Wear gloves to avoid RNase contamination from hands. Wipe all pipettes with 70% ethanol or isopropanol before RNA work. Use sterile pipette tips. Store pure RNA at 70 C or as an ethanol precipitate at 20 C. B. PCR Primer Design Primer design is the single largest variable in PCR applications and the single most important factor in determining the success or failure of PCR reactions. Always check and recheck your primer design before constructing or ordering primers. 1. Location of primers Our robust RT ensures the synthesis of long cdnas, enabling you to target primers to any location in the transcript. However, for best results, we recommend that primers anneal within 4 kb of the transcript s 3' end and that they amplify a fragment that is less than 1.5 kb in length. If necessary, primers can be targeted to the transcript s 5' end and can amplify fragments longer than 1.5 kb. Additionally, to distinguish between cdna and genomic DNA amplification, target primers to different exons that are separated by one or more introns. Such primers will produce larger fragments when amplified from genomic DNA. Alternatively, if intron-separated primer sites cannot be used, a negative control reaction can be performed as described in Section IV.D. 2. Length and G-C content Primers should have a T m of around 70 C and, whenever possible, primers should be at least 22 nucleotides (nt) long (25 30-mers are preferred) and should have a G-C content of 45 60%. Furthermore, the 3'-terminal ends of each primer should not be complementary to each other and should have a low G-C content. 3. Concentration Prepare a mix of your 5' and 3' primers that is 45 µm in concentration for each primer. Protocol # PT CLONTECH Laboratories, Inc. Version # PR

8 IV. General Considerations continued C. Good PCR practices 1. Use dedicated pipettors in a dedicated work space Due to the tremendous amplification power of PCR, minute amounts of contaminating DNA can produce nonspecific amplification; in some instances, contaminants can cause DNA bands even in the absence of added template DNA. We recommend that you use small aliquots of starting material to avoid contaminating your stocks. Set up your PCR reactions in a dedicated lab area or noncirculating containment hood and use dedicated pipettors, PCR pipette tips with hydrophobic filters, and dedicated solutions. We also recommend performing post-pcr analysis in a separate area with a separate set of pipettors. 2. Pipetting Because of the small volumes used in PCR experiments and the potential for tube-to-tube variation, careful pipetting technique is extremely important. Always be sure that no extra solution is on the outside of the pipette tip before transfer. When adding solution to a tube, immerse the tip into the reaction mixture and deliver the contents from the pipette tip into the mixture, then rinse the tip by pipetting up and down several times. 3. Use a Master Mix Assembling a Master Mix, which contains the appropriate volumes of all the reagents required for multiple RT-PCR reactions, eliminates the need for repeated pipetting of individual reaction components into each reaction tube. We highly recommend using a Master Mix for setting up multiple reactions because it greatly reduces tube-to-tube variation. The Master Mix should be thoroughly mixed before use (i.e., vortexed without bubbling). D. Control Reactions You should perform a positive control reaction using the enclosed Control Mouse Liver Total RNA and Control Mouse β-actin Primer Mix. This reaction amplifies a 540-bp fragment of the mouse β-actin cdna. An optional negative control can be performed to help distinguish between fragments amplified from cdna and those derived from genomic DNA contaminants in your RNA sample. In this control, use a PCR enzyme mix without RT (such as TITANIUM Taq DNA Polymerase; ) instead of the RT-TITANIUM Taq Enzyme Mix included in the One-Step kit. This reaction will require a separate PCR Master Mix in Section V.A. Alternatively, a standard One-Step reaction can be preheated at 94 C for 5 min to inactivate reverse transcriptase before using the thermal cycler procedure in Section V.B. For the latter option, preheat the thermal cycler to 94 C before adding the tube(s) to ensure that minimal cdna synthesis occurs prior to inactivation. CLONTECH Laboratories, Inc. Protocol # PT Version # PR12222

9 V. One-Step RT-PCR Procedure A. Preparing an RT-PCR Master Mix 1. Quickly thaw each tube by warming in your hands; place on ice. Note: Thaw Thermostabilizing Reagent at room temperature before use and vortex to resuspend crystals. If residual precipitate fails to dissolve, spin and use supernatant. 2. Spin each tube briefly in a microcentrifuge and return to ice. 3. Prepare a Master Mix as described below. Prepare sufficient Master Mix for all of your reactions plus one additional reaction to ensure adequate volume. You should plan to perform one positive control reaction in addition to your experimental reactions. An optional negative control (described in Section IV.D) can be performed as well. 5 µl 10X One-Step Buffer 1 µl 50X dntp Mix 0.5 µl Recombinant RNase Inhibitor (40 units/µl) 25 µl Thermostabilizing Reagent 10 µl GC-Melt 1 µl Oligo(dT) Primer 1 µl 50X RT-TITANIUM Taq Enzyme Mix 43.5 µl Total volume B. Setting Up the Reactions Set up reactions as shown in Table I. TABLE I. ONE-STEP RT-PCR REACTIONS Positive Experimental Reagent control reaction(s) Control Mouse Liver Total RNA 1 µl Control Mouse β-actin Primer Mix 1 µl Experimental RNA sample (1 ng 1 µg) µl Experimental PCR primer mix (45 µm each) 1 µl Master Mix 43.5 µl 43.5 µl RNase-Free H 2 O 4.5 µl to 50 µl Final volume 50 µl 50µl Protocol # PT CLONTECH Laboratories, Inc. Version # PR

10 V. One-Step RT-PCR Procedure continued C. Running the Reactions Commence thermal cycling using the following program. These parameters were optimized for amplifying the control 540-bp mouse β-actin fragment using a PE Biosystems DNA Thermal Cycler 480. This program can be used for hot-lid or non-hot-lid thermal cyclers. 50 C for 1 hr 94 C for 5 min cycles a : 94 C 30 sec 65 C 30 sec 68 C 1 min b 68 C for 2 min a Optimal number of cycles depends on transcript abundance and template complexity and must be determined empirically. b For experimental reactions, use min of extension time per kb. VI. Troubleshooting Guide A. Low Yield or No Products Your RNA may be degraded. RNA should be evaluated by running a denaturing formaldehyde/agarose gel to verify integrity prior to cdna synthesis. There may be impurities in your RNA sample that interfere with the RT- PCR reaction. Ensure that your sample has an A 260 /A 280 ratio of 1.7 or higher. Reprecipitate or re-isolate RNA from the source if necessary. Poor primer design. Be sure to follow the guidelines in Section IV.B when designing primers. PCR parameters may need to be optimized for your transcript of interest. Your target gene may be very weakly expressed in the analyzed sample. B. Multiple Amplification Products Your sample may contain alternatively spliced forms of the target transcript. The gene may be a member of a multigene family, in which case your gene-specific primers may simultaneously amplify several highly homologous cdnas. Poor primer design. Be sure to follow the guidelines in Section IV.B when designing primers. Your RNA sample may be contaminated by another RNA or DNA sample. PCR parameters must be optimized for analyzing your target gene. CLONTECH Laboratories, Inc. Protocol # PT Version # PR12222

11 VII. References Aatsinki, J. T., Lakkakorpi, J. T., Pietila, E. M. & Rajaniemi, H. J. (1994) A coupled one-step reverse transcription PCR procedure for generation of full-length open reading frames. BioTechniques 16: Carninci, P., Nishiyama, Y., Westover, A., Itoh, M., Nagaoka, S., Sasaki, N., Okazaki, Y., Muramatsu, M., Hayashizaki, Y. (1998) Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of full length cdna. Proc. Natl. Acad. Sci. USA 95(2): Murakawa, G. J., Zaia, J. A., Spallone, P. A., Stephens, D. A., Kaplan, B. E.,Wallace, R. B. & Rossi, J. J. (1988) Direct detection of HIV-I RNA from AIDS and ARC patient samples. DNA 7: Powell, L. M., Wallis, S. C., Pease, R. J., Edwards, Y. H., Knott, T. J. & Scott, J. (1987) A novel form of tissue-specific RNA processing produces apolipoprotein-b48 in intestine. Cell 50: Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Sellner, L. N. & Turbett, G.R. (1998) Comparison of three RT-PCR methods. BioTechniques 25: Wilkinson, D.A. (1998) Getting the message with RT-PCR. The Scientist 12(15): VIII. Related Products For the latest and most complete listing of all CLONTECH products, please visit Advantage RT-for-PCR Kit K1402-1, -2 TITANIUM TM Taq DNA Polymerase TITANIUM TM Taq PCR Kit K TaqStart TM Antibody , -2 RT-PCR Amplimers many Premium Total RNAs many NucleoBond RNA/DNA Kit K K K NucleoSpin RNA II Kit K3064-1, -2, -3 Protocol # PT CLONTECH Laboratories, Inc. Version # PR

Titanium One-Step RT-PCR Kit. User Manual. User Manual

Titanium One-Step RT-PCR Kit. User Manual. User Manual User Manual Titanium One-Step RT-PCR Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc. A Takara