National and International Trends in Tuberculosis. Edward Desmond Microbial Diseases Laboratory California Dept. of Public Health

Transcription

1 National and International Trends in Tuberculosis Edward Desmond Microbial Diseases Laboratory California Dept. of Public Health

2 Trend 1: The number of TB cases is decreasing In the USA (significantly), and Internationally (slightly)

3 Trend 2: Drug-resistant TB is on its way up Internationally, and Expected in the USA as a consequence where most TB is in the foreign-born

4 Trend 3: As higher percentages of U.S. TB cases are in the foreign-born, it becomes more urgent to support TB control in countries which are the source of immigration to the U.S. This includes international TB laboratory consultation New tools are available

5 Trend 4: Molecular methods enable rapid detection of drug-resistant TB GeneXpert is being used internationally GeneXpert and DNA sequencing are becoming a new standard of practice in the USA

6 Trend 5: DNA sequencing is revealing complexities of drug susceptibility and resistance which were not previously appreciated Studies linking DNA sequences with drug susceptibility/resistance are under way

7 Trend 1: TB Global Epidemiology WHO Report

8 Trends TB incidence in CA Year Case number Case rate , , Anticipated impact of Affordable Care Act Fewer uninsured Fewer patients for county TB clinics Decreased TB workload for county public health labs which serve those clinics

9 Trend 2: Higher percentage of U.S. TB cases are in the foreign-born

10 Trend 2, cont d Increasing proportion in TB is in the foreign-born increase in drug resistance is expected

11 Trend 3: increasingly, TB is in the foreign born. % MDR cases in U.S. 1.1% % MDR: Mexico 1.8% Philippines 5.6% India 4.3% Vietnam 3.7% China 6.4%

12 Trend 3, cont d Supporting TB control in countries which are the source of immigration to the U.S.: new guidance

13 No Stars (0 142 pts) < 55% 1 Star ( pts) 55 64% 2 Stars ( pts) 65 74% 3 Stars ( pts) 75 84% 4 Stars ( pts) 85 94% 5 Stars ( pts) 95% 95 % 5 Star % 4 Star % 3 Star % 2 Star % 1 Star <55 % 0 Star Stepwise Process

14 Audit Score Sheet Audit Score Sheet Section Total Points Section 1: Document and Records 25 Section 2: Management Reviews 17 Section 3: Organization and Personnel 20 Section 4: Client Management and Customer Service 8 Section 5: Equipment 30 Section 6: Internal audit 10 Section 7: Purchasing and Inventory 30 Section 8: Process Control and Internal and External Quality Assessment 33 Section 9: Information Management 18 Section 10: Corrective Action 12 Section 11: Occurrence/Incident Management and Process Improvement 12 Section 12: Facilities and Safety 43 TOTAL SCORE 258

15

16

17

18

19

20 Last slide for Trend 3, supporting TB control in countries which are the source of immigration to the U.S.

21 Trend 4: molecular methods enable rapid detection of drug-resistant TB Cepheid GeneXpert Combines sample preparation (using microfluidics) with real-time PCR Detects M. tb and predicts drug resistance (to rifampin as now configured) TB application now cleared by US FDA!

22 GeneXpert Cartridge Cover PCR Reaction Tube Liquid reservoirs Syringe Rotary valve Ultrasonic interface Base

23 Cepheid Gene Xpert, cont d Steingart, K., et al Cochrane Collaboration Report (metanalysis) For detecting M. tb, 88% sensitivity compared with culture (98% for smear + and 68% for smear neg) For detecting rifampin resistance, sensitivity of 94% and specificity of 98%

24 WHO endorsement for Cepheid GeneXpert for TB: Dec Use of GeneXpert could lead to a three-fold increase in the diagnosis of patients with drug-resistant TB and double the diagnosis of TB in people with HIV In high-burden countries, Cepheid will sell the instrument for about $17,000 and their reagent cost will be about $10 (USA price $60 to $70)

25 CDC guidelines for use of Cepheid GeneXpert MTB/RIF: MMWR 62(41): October 18, 2013 GeneXpert. instrument generated result MTB detected, RIF resistance detected MTB detected, RIF resistance not detected MTB detected, RIF resistance indeterminate MTB not detected Interpretation of Xpert MTB/RIF result MTB detected within sample, mutation in rpob detected MTB detected, but no mutation in rpob detected MTB detected, unable to determine if there is an rpob mutation MTB target is not detected within the sample Recommended minimum reporting language MTBC detected. A mutation in rpob has been detected, indicating possible rif resistance. Confirmatory testing should follow MTBC detected. No rpob mutation suggests probably RIF susceptible MTBC detected, presence of rpob gene mutations cannot be accurately determined MTBC not detected

26 Why do APHL and CDC recommend DNA sequencing each time GeneXpert detects an rpob mutation? In DNA sequencing performed at the MDL & CDC labs, 18-20% of the mutations found by GeneXpert are silent/ synonymous mutations which don t confer resistance This differs from studies performed in some high-burden countries where true resistance is much more prevalent Globally, the incidence of MDR TB is about 5 X higher than it is in the USA

27 GeneXpert MTBC Detection Performance DSHS-Austin 11/16/12-1/13/14 (1,178 sputum specimens) THANKS TO KEN JOST FROM TEXAS STATE LAB AFB Smear Positive Mtbc Reference Result Positive Negative Total 99% Accuracy Xpert Positive % Sensitivity Xpert Negative % Specificity Total % Prevalence 99% PPV 98% NPV AFB Smear Negative Mtbc Reference Result Positive Negative Total 98% Accuracy Xpert Positive % Sensitivity Xpert Negative % Specificity Total % Prevalence 89% PPV 98% NPV 27

28 GeneXpert Rifampin Resistance Performance DSHS-Austin Nov 2012 July 2014 (434 specimens) THANKS TO KEN JOST FROM TEXAS STATE LAB Rifampin Phenotype Resistant Susceptible Total 98% Accuracy Xpert Rifampin-R 9* 6** 15 90% Sensitivity Xpert Rifampin-S % Specificity Total % Prevalence 60% PPV 100% NPV 28

29 Specimen Probe rpob Mutation Texas RMP CDC RMP 1 A* No Amplification S - 2 B Phe514Phe S - 3 B Phe514Phe S S 4 B Phe514Phe S S 5 B Phe514Phe S S 6 B Asp516Tyr & Asp549Asn 7 C Ser522Leu R/S S** 8 D His526Tyr R R 9 D His526Asp R R 10 E Ser531Leu R R 11 E Ser531Leu R - 12 E Ser531Leu R - 13 E Ser531Leu R R S S THANKS TO KEN JOST FROM TEXAS STATE LAB Note that GXP probe B mutation was not associated with rifampin resistance. 14 E not tested R - 15 E Leu533Pro R/S S** 16 none Ile572Phe R S** 29

30 Why do APHL and CDC recommend DNA sequencing each time GeneXpert detects an rpob mutation? (cont d) Some rpob mutations are clinically significant, but TB strains with these mutations may test susceptible in MGIT DST More about this under trend 5

31 Rapid detection of second line drug resistance at CDC laboratory 31 Uses DNA sequencing of genes associated with resistance to 1 st and 2 nd line drugs Turnaround time of 3-4 days Service available beginning in Sept. 2009

32 MDDR Service: 32 Drugs and Genes for Panel Drug RIF INH KAN AMK CAP FQ PZA EMB Gene(s) rpob inha, katg rrs, eis rrs rrs, tlya gyra pnca embb

33 33 MDDR Service: Testing Algorithm Entire molecular panel Routine agar proportion DST panel (INH, RIF, EMB, STR, FQ, AMK, KAN, CAP, ETH, PAS) and MGIT PZA

34 How does Pyrosequencing work? G Lin PSQ

35 Below are steps occur in pyrosequencer: 1. Incorporation of dntp generates ppi. 2. APS + ppi ATP, catalyzed by ATP sulfurylase. 3. Luciferin oxyluciferin, driven by ATP & catalyzed by luciferase. 4. Light released, proportional to dntp incorporated, recorded by CCD. 5. Apyrase degrades unincorporated dntp & ATP. When degradation is complete, another dntp is added. 6. Pyrogram shows sequential event of dntp incorporated. The peak level is proportional to dntps incorporated. G Lin PSQ

36 Hit 1: gyra resistant codon 94ggc Score: 100 Identities: 31/31 (100%) Query 1 CCACCCGCACGGCGACGCGTCGATCTACGGC 31 Library 1 CCACCCGCACGGCGACGCGTCGATCTACGGC 31 Hit 2: gyra susceptible Score: 94.3 Identities: 30/31 (97%) Query 1 CCACCCGCACGGCGACGCGTCGATCTACGGC 31 Library 1 CCACCCGCACGGCGACGCGTCGATCTACGAC 31 G Lin PSQ

37 Detection of Drug Resistance Mutations Drugs of interest: For XDR screening INH, RIF, KAN, AMK, CAP, fqs Targeted Genes katg, inha promoter for INH rpob for RIF rrs for KAN, AMK & CAP gyra for Quinolones G Lin PSQ

38 Note: PSQ is suitable for sequencing short DNA segments, up to 50 base pairs G Lin PSQ

39 G Lin PSQ

40 Line Probe Assays: not cleared by U.S. FDA, but endorsed by WHO: Hain GenoType MTBDRplus 1) DNA Extraction 3) Hybridization 2) Amplification by PCR 4) Evaluation

41 Examples of GenoType MTBDRplus Results

42 Hain Line Probe MTBDR plus: comparison with culture in LJ and drug suscept. testing Multi-site study published by Raizada et al, Feb in PLOS One 9(2):e88626 Compared Hain MTBDRplus results to the results of culture in LJ and drug susceptibility testing 248 acid-fast smear positive patients had both Hain line-probe assay and culture in LJ with drug susceptibility testing

43 Raizada 2014 study, continued For line probe assay, 6% did not yield a valid result because of not enough DNA or some technical problem For culture and drug susceptibility testing, 20% did not yield a positive result because of contamination of the culture or failure of the drug susceptibility testing LPA yielded more results (94%) than culture and drug susceptibility testing (80%)

44 Trend 5: DNA sequencing is revealing complexities of drug susceptibility and resistance which were not previously appreciated

45 Low level rifampin resistance Working definition for the purpose of this talk: Presence of a mutation in rpob, which causes a change in amino acid sequence, leading to an increase in MIC above that of the wild type, but <1 ug/ml in MGIT so that the culture will test as susceptible in MGIT

46 Reports of treatment failure associated with low level resistance continue Williamson IJTLD :216 3 New Zealand cases in which Cepheid GeneXpert detected rpob mutation, but culture tested susceptible to rif in MGIT Treatment failed in these 3 cases (all were INH-resistant) Mutations 516 Tyr and 526 Leu were assoc. w/ rifampin MICs of 0.25 and 0.5 respectively

47 Rifampin issues, cont d Greater use of GeneXpert MTB/RIF will increase discovery of low-level resistance -- (GeneXpert says resistant, MGIT says susceptible DNA sequencing) Expanded use of GeneXpert is recommended (see poster/talk by Lisa Pascopella) When there is low level resistance, e.g. MGIT/Xpert discrepancy or sequencing, treatment regimen may need to be modified Anecdotal evidence: rif may still make an important contribution to the treatment regimen

48 Low level rifampin resistance recap Category Rifampin resistant Low level resistance Presence of rpob mutation Expected GeneXpert result Resistant by agar proportion Resistant by MGIT Clinical expectation Yes Rif resistant Resistant Resistant Rifampin not useful Yes Rif resistant +/- Susceptible Rifampin activity reduced, but still may be useful. More research needed. Treatment may fail. Susceptible No Rifampin susceptible Susceptible Susceptible Reliable contribution of Rif to treatment regimen

49 Rifampin: does MGIT miss resistance? Early validation studies show good correlation of MGIT rifampin results with those obtained by agar proportion method or BACTEC 12B Horne Metanalysis: JCM 51:393. Pooled sensitivity of MGIT 960 in detecting rif resistance, compared with other reference methods: 98.2% (but in some studies the reference method was another broth culture technique, namely BACTEC 12B/460)

50 What to do about rifampin Strains with certain specific rpob mutations may test susceptible to rifampin in MGIT In Africa and Bangladesh, these mutations are associated with treatment failure In USA, clinical impact may be less, but often significant Encourage use of GeneXpert When rpob mutation is detected, recommend sequencing Report presence of suspected low level resistance with carefully chosen wording and referral to RTMCC or TBCB MDR service

51 Taking it to a new level Predicting quantitative drug susceptibility and response to different drugs with a class of drugs within a day by DNA sequencing

52 All Resistance SNPs are not Equal Number of Isolates WHO critical concentrati on (0.25mg/L) Cmax (~3.5 mg/l) gyra SNP Isolate MOX MIC (mg/l) 90 GTG 94 AAC

53 All Resistance SNPs are not Equal Number of Isolates WHO critical concentrati on (0.25mg/L) Isolate MOX MIC (mg/l) gyra SNP 90 GTG 94 AAC

54 All Resistance SNPs are not Equal Number of Isolates WHO critical concentra tion (1.0 mg/l) Cmax (~7 mg/l) rpob SNP 516 GTC 516 TAC 526 AAC 526 TAC 531 TTG Isolate RIF MIC (mg/l)

55 All Resistance SNPs are not Equal Number of Isolates WHO critical concentra tion (1.0 mg/l) rpob SNP 516 GTC 516 TAC 526 AAC 526 TAC 531 TTG Isolate RIF MIC (mg/l)

56 Rifabutin MICs associated with various rpob mutations Note rifampin MICs in red in column headings. RBU MIC (µg/ml) None 531 tcg ttg Rif >8 516 gac gtc Rif>8 rpob Mutation 526 cac ctc Rif cac ggc Rif =2 526 cac agc Rif = cac tgc Rif (RIF S) Total Samples

57 MOX MIC & Mutations in gyra MOX MIC (ug/ml) Mutations ( # of strains) 90gtg 94gcc 95acc 94ggc 91ccg 94cac 94tac % % % % % % % % Total # strains % 15% 15% 32.5% 5% 10% 2.5% Total # strains G Lin 57

58 Summary, taking it to a new level DNA sequencing results can be available within a day or two after a specimen arrives in the laboratory Sequencing can provide information beyond the susceptible or resistant results yielded by culture-based drug sus. Testing E.g. for moxifloxacin, sequencing can reveal that mox should be used despite resistance at the critical concentration and suggest MIC testing E.g. for rifamycins, sequencing can suggest some instances in which rifabutin could be used despite rifampin resistance, and for some mutations rifampin could still be a useful component of the Rx regimen

59 Thank you