Stable Isotope Labeling with Amino Acids in Cell Culture. Thermo Scientific Pierce SILAC Protein Quantitation Kits

Size: px
Start display at page:

Download "Stable Isotope Labeling with Amino Acids in Cell Culture. Thermo Scientific Pierce SILAC Protein Quantitation Kits"

Transcription

1 Stable Isotope Labeling with Amino Acids in Cell Culture Thermo Scientific Pierce SILAC Protein Quantitation Kits

2 Quantitative Analysis of Differential Protein Expression Stable isotope labeling using amino acids in cell culture (SILAC) is a powerful method to identify and quantify relative differential changes in complex protein samples. SILAC uses in vivo metabolic incorporation of heavy C- or 15 N-labeled amino acids into proteins followed by mass spectrometry (MS)-based analysis, which accelerates the comprehensive identification, characterization and quantification of proteins. SILAC Technology Applications: Quantitative analysis of relative changes in protein abundance from different cell treatments Quantitative analysis of proteins for which there are no antibodies available Protein expression profiling of normal vs. disease cells Identifying and quantifying hundreds to thousands of proteins in a single experiment The method requires growing mammalian cells in specialized media deficient in lysine and arginine amino acids. This deficiency is compensated by adding light or heavy forms of the missing amino acids; i.e., 12 C 6 and C 6 L-lysine, respectively. A typical experiment involves growing one cell population in medium containing light amino acids (control), while the other population is grown in the presence of heavy amino acids (experimental). The heavy and light amino acids are incorporated into proteins through natural cellular protein synthesis. If a chemical treatment or a genetic manipulation is introduced to the cell population containing heavy amino acids, biological effects of the treatment or manipulation can be detected. The detection is made possible because the heavy and light amino acids are chemically identical to each other, yet isotopically distinct. This, in turn, makes the detection of the differentially expressed proteins possible based on relative peak intensity of the isotopic peptide pairs affected (Figure 1).

3 Highlights: Efficient 100% label incorporation into proteins of living cells Reproducible eliminates intra-experimental variability caused by differential sample preparation Flexible media deficient in both L-Lysine and L-Arginine, allowing for more complete proteome coverage through dual amino acid isotope labeling Compatible label proteins expressed in a wide variety mammalian cell lines adapted to grow in DMEM or RPMI-1640, including HeLa, 293T, COS7, U2OS, A549, A431, HepG2, NIH 3T3, Jurkat and others Cells Grown in Light Isotope-containing Media Cells Grown in Heavy Isotope-containing Media + Treatment Harvest Cells Mix Cell Lysates Excise Bands The Thermo Scientific LTQ Orbitrap Hybrid Mass Spectrometer enables faster and more reliable detection and identification of proteins in complex mixtures. Routine high-resolution and mass measurement accuracy of 2-3 ppm provide excellent data for SILAC studies and general proteomics, metabolomics and small molecule research applications. For more information, visit SDS-PAGE Trypsin Digestion LC-MS/MS Ratio Determination m/z Heavy Figure 1. Schematic of SILAC workflow. A549 cells adapted to DMEM were grown for six passages (10 days) using SILAC DMEM (Thermo Fisher Scientific, Rockford, IL, Product # 89983) containing 0.1 mg/ml heavy C 6 L-lysine-2HCl or light L-lysine-HCl supplemented with 10% dialyzed FBS. After 100% label incorporation, C 6 L-lysine-labeled cells were treated with 5 μm camptothecin (Sigma, St. Louis, Product # C9911) for 24 hours. Cells from each sample (light and heavy) were lysed using Thermo Scientific M-PER Mammalian Protein Extraction Reagent (Thermo Fisher Scientific, Rockford, IL, Product # 78501). Samples were normalized for protein concentration using the Thermo Scientific Pierce BCA Protein Assay (Thermo Scientific, Rockford, IL, Product # 23225), and 50 μg of each sample were equally mixed before 4-20% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) analysis. Gels were stained with Thermo Scientific GelCode Blue Stain Reagent (Thermo Fisher Scientific, Rockford, IL, Product # 24592) and proteins were digested and alkylated using the Thermo Scientific Pierce In-Gel Tryptic Digestion Kit (Thermo Fisher Scientific, Rockford, IL, Product # 89871) before analysis using an LTQ Orbitrap Hybrid Mass Spectrometer. Relative Intensity Light

4 The Thermo Scientific Pierce SILAC Protein Quantitation Kits are compatible with mammalian cell lines adapted to grow in either DMEM or RPMI-1640 media. Each kit includes all necessary reagents to isotopically label cells, including media, heavy and light amino acids, and dialyzed serum. The heavy C 6 15 N 4 L-Arginine is available separately (Product # 89990) and can be combined with SILAC Protein Quantitation Kits to enhance peptide isotope label coverage. When combined with Thermo Scientific Protein/Peptide Sample Enrichment Products, Pierce SILAC Protein Quantitation Kits also enable MS analysis of lowabundance proteins; cell-surface, organelle- specific proteins; and post-translational modifications such as phosphorylation or glycosylation. Protein levels from A549 lung carcinoma cells treated with the anti-cancer drug camptothecin (Figure 1) were analyzed by MS. Most of the proteins identified had no change in abundance level after camptothecin treatment; however, % of proteins quantified in heavy-labeled cells had protein levels (SILAC ratios) 1.5-fold higher than control cells (Figure 2). More than 6% of proteins had their relative abundance reduced by the same amount after drug treatment. Fifteen proteins were identified by MS as the most significantly upregulated after drug treatment (Table 1). One protein that was identified as being upregulated in response to camptothecin treatment was proliferating cell nuclear antigen (PCNA), a protein known to be involved in DNA repair (Figure 3). 10 H:L α - PCNA 1.9 SILAC Ratio α - p α - β-actin 1.2 Relative Abundance 0.1 Protein Number Figure 2: SILAC ratio distribution. Comparison of A549 protein levels by SILAC ratio after camptothecin treatment. MS/MS analysis of peptides generated (Figure 1) identified 450 proteins of which 361 contained C 6 L-lysine. SILAC ratios were calculated using Thermo Scientific BioWorks Software with PepQuan SILAC quantitation with the following settings: target ions = residue = K, mass = 6.0, mass tolerance = 0.1, minimum threshold = 10, no smoothing, and perform calculation base on area. SILAC ratios for all 361 proteins are plotted on a logarithmic graph SILAC Ratio H:L = Light (L) m/z Heavy (H) Figure 3: Representative MS spectra generated using SILAC. Light and heavy ( C 6 ) L-lysine-containing peptide (AEDNADT- LALVFEAPNQEK) from PCNA were analyzed by MS. Mass spectra of heavy peptides containing C 6 L-lysine, which have an increase mass of 6 Da, seen here as a shift of 3 m/z, given that this is a +2 charge state peptide. The SILAC ratio was determined by comparing relative abundance of heavy (H) and light (L) peptides (Figure 2). Light (L) Heavy (H) - + α - GAPDH 5 μm camptothecin Figure 4: Comparison of A549 protein levels detected by Western blotting after camptothecin treatment. Ten micrograms of each light (L) and heavy (H) sample (Figure 1) was analyzed by 4-20% SDS-PAGE and Western blotting using specific Thermo Scientific Lab Vision Antibodies against PCNA (Thermo Fisher Scientific, Fremont, CA, Product # MS-106-PO) diluted to 1:1,000 or Thermo Scientific Lab Vision p53 (Thermo Fisher Scientific, Fremont, CA, Product # MS-186-PI), b-actin (US Biological, Swampscott, MA, Product # AO760-40) and GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA, Product # SC-25778) diluted 1:10,000. Anti-Mouse (H+L)-HRP (Thermo Fisher Scientific, Rockford, IL, Product # 31430) or Anti-Rabbit (H+L)-HRP (Thermo Fisher Scientific, Rockford, IL, Product # 31460) diluted 1:25,000 were used as the secondary antibody with SuperSignal West Dura Chemiluminescent Substrate (Thermo Fisher Scientific, Rockford, IL, Product # 34076) for detection. Protein levels (H:L) were quantitated after Western blotting using a Kodak Image Station 2000MM. 1.1

5 To validate SILAC data, protein levels were separately quantitated by Western blot (Figure 4). The proteins levels increased 1.9- and 5.9-fold for PCNA and p53, respectively. However, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin did not significantly change. The abundance ratios determined by Western blot of PCNA and GAPDH were comparable to those determined by SILAC (Table 1). The p53 protein was not identified by MS due to its relative low abundance in cell extracts. Table 1: The 15 most up-regulated proteins identified in heavylabeled A549 whole cell lysates after camptothecin treatment. SILAC Ratio H:L Protein* (# Peptides) Isoform Short of NADPH:adrenodoxin 4.50 (3) oxidoreductase, mitochondrial precursor Plastin (2) TUBB6 protein 2.35 (2) Superoxide dismutase [Mn], mitochondrial 2.24 (2) precursor Isoform M1 of Pyruvate kinase isozymes M1/M (2) Actin, cytoplasmic (12) Transgelin (2) UDP-glucose ceramide glucosyltransferase-like 2.11 (3) 1 isoform 1 Proliferating cell nuclear antigen (PCNA) 2.09 (3) Isoform 1 of Spectrin alpha chain, brain 1.96 (2) Isoform 2 of Nucleophosmin 1.93 (3) Vimentin 1.92 (12) Isoform 1 of Clathrin heavy chain (7) Actin, alpha skeletal muscle 1.86 (2) Keratin, type II cytoskeletal (8) Glyceraldehyde-3-phosphate dehydrogenase 1.09 (3) (GAPDH) * Proteins were identified by the SEQEUST program using the International Protein Index database (IPI:Human, V3.18). Ordering Information: Product # Description Pkg. Size Pierce SILAC Protein Kit Quantitation Kit RPMI 1640 Includes: SILAC RPMI Media 2 x 500 ml Dialyzed FBS 2 x 50 ml C 6 L-Lysine-2HCl 50 mg L-Lysine-2HCl 50 mg L-Arginine-HCl 2 x 50 mg Pierce SILAC Protein Kit Quantitation Kit DMEM Includes: SILAC DMEM media 2 x 500 ml Dialyzed FBS 2 x 50 ml C 6 L-Lysine-2HCl 50 mg L-Lysine-2HCl 50 mg L-Arginine-HCl 2 x 50 mg SILAC RPMI Media 500 ml (RPMI-1640 Medium minus L-Lysine and L-Arginine) SILAC DMEM Media 500 ml (DMEM Medium minus L-Lysine and L-Arginine) Dialyzed FBS 50 ml L-Lysine-2HCl 50 mg C6 L-Lysine-2HCl 50 mg L-Arginine-HCl 50 mg C6 15N4 L-Arginine-HCl 50 mg Complementary Products: Product # Description Pkg. Size Halt Protease Inhibitor Cocktail Kit Halt Phosphatase Inhibitor Cocktail 1 ml M-PER Mammalian Protein 250 ml Extraction Reagent Mem-PER Membrane Protein Kit Extraction Reagent NE-PER Nuclear and Cytoplasmic Kit Extraction Reagents Mitochondria Isolation Kit Kit Lysosome Enrichment Kit Kit for Tissue and Cultured Cells Peroxisome Enrichment Kit Kit for Tissue Nuclei Enrichment Kit for Tissue Kit For information on Pierce Protein Research Products, visit For information on LTQ Orbitrap Hybrid Mass Spectrometers, visit For information on Cell Culture and Bioprocessing Systems, visit

6 /07 Pierce Protein Research Products Tel: or Fax: Customer Assistance Outside the United States, visit our website or call to locate your local branch office or distributor Thermo Fisher Scientific Inc. All rights reserved. These products are supplied for laboratory or manufacturing applications only. Prices listed herein were accurate at the time of printing. Visit our website for up-to-date prices. SuperSignal Technology is protected by U.S. Patent # 6,432,662. Pierce BCA Technology is protected by U.S. Patent # 4,839,295. Kodak is a trademark of Eastman Kodak Corporation. All other trademarks are property of Thermo Fisher Scientific Inc. and its subsidiaries.

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology

More information

Liver Mitochondria Proteomics Employing High-Resolution MS Technology

Liver Mitochondria Proteomics Employing High-Resolution MS Technology Liver Mitochondria Proteomics Employing High-Resolution MS Technology Jenny Ho, 1 Loïc Dayon, 2 John Corthésy, 2 Umberto De Marchi, 2 Antonio Núñez, 2 Andreas Wiederkehr, 2 Rosa Viner, 3 Michael Blank,

More information

Investigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents

Investigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents pplication Note 1D PGE and Cleavable ICT Reagents Investigation of a Mammalian Cellular Model for Differential Protein Expression nalysis Using 1D PGE and Cleavable ICT Reagents Overview The use of two-dimensional

More information

Mitochondria/Cytosol Fractionation Kit

Mitochondria/Cytosol Fractionation Kit Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)

More information

Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS

Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS Michal Godula Ph.D. Thermo Fisher Scientific The world leader in serving science

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

Quantitative mass spec based proteomics

Quantitative mass spec based proteomics Quantitative mass spec based proteomics Tuula Nyman Institute of Biotechnology tuula.nyman@helsinki.fi THE PROTEOME The complete protein complement expressed by a genome or by a cell or a tissue type (M.

More information

Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP

Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Page 1 of 7 INSTRUCTIONS: Z-310 Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Rockland Immunochemicals and Bio-Rad Laboratories have jointly developed an easy to use multiplex

More information

A highly sensitive and robust 150 µm column to enable high-throughput proteomics

A highly sensitive and robust 150 µm column to enable high-throughput proteomics APPLICATION NOTE 21744 Robust LC Separation Optimized MS Acquisition Comprehensive Data Informatics A highly sensitive and robust 15 µm column to enable high-throughput proteomics Authors Xin Zhang, 1

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

Strep-tag detection in Western blots

Strep-tag detection in Western blots Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important

More information

Thermo Scientific GTPase Research Tools

Thermo Scientific GTPase Research Tools Thermo Scientific Research Tools Active Pull-Down Assays We offer two different tools to study biology, one for active monitoring and one for global profiling. The Thermo Scientific Pierce Active Pull-Down

More information

Detecting Challenging Post Translational Modifications (PTMs) using CESI-MS

Detecting Challenging Post Translational Modifications (PTMs) using CESI-MS Detecting Challenging Post Translational Modifications (PTMs) using CESI-MS Sensitive workflow for the detection of PTMs in biological samples from small sample volumes Klaus Faserl, 1 Bettina Sarg, 1

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Enrichment of EGFR/PI3K/AKT/PTEN Proteins for Research using Immunoprecipitation and with Mass Spectrometry-based Analysis

Enrichment of EGFR/PI3K/AKT/PTEN Proteins for Research using Immunoprecipitation and with Mass Spectrometry-based Analysis Enrichment of /PI3K/AKT/ Proteins for Research using Immunoprecipitation and with Mass Spectrometry-based Analysis Bhavin Patel, Scott Meier, Kay Opperman, Paul Haney, Barbara Kaboord, John Rogers Thermo

More information

Amersham * ECL * Gel horizontal electrophoresis system

Amersham * ECL * Gel horizontal electrophoresis system GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel

More information

Thermo Scientific Peptide Mapping Workflows. Upgrade Your Maps. Fast, confident and more reliable peptide mapping.

Thermo Scientific Peptide Mapping Workflows. Upgrade Your Maps. Fast, confident and more reliable peptide mapping. Thermo Scientific Peptide Mapping Workflows Upgrade Your Maps Fast, confident and more reliable peptide mapping. Smarter Navigation... Peptide mapping is a core analytic in biotherapeutic development.

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog

More information

ab Complex I Enzyme Activity Microplate Assay Kit

ab Complex I Enzyme Activity Microplate Assay Kit ab109721 Complex I Enzyme Activity Microplate Assay Kit Instructions for Use For the analysis of Complex I enzyme activity from Human, Rat, Mouse and Bovine samples This product is for research use only

More information

MitoBiogenesis In-Cell ELISA Kit (Colorimetric)

MitoBiogenesis In-Cell ELISA Kit (Colorimetric) PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis

More information

Part Number Item MSFX X Detector Antibody 0.2 ml X HRP Label 0.2 ml Microplate strips (4-pack) 1

Part Number Item MSFX X Detector Antibody 0.2 ml X HRP Label 0.2 ml Microplate strips (4-pack) 1 Order: 800-910-6486 sales@mitosciences.com Web: www.mitosciences.com Support: support@mitosciences.com TECHNICAL DATA SHEET Complex I FlexPlex Module Catalog # MSFX-1 Rev.0 LOT #: APPLICATIONS: SPECIES

More information

ab Histone Extraction Kit Rapid / Ultra-pure

ab Histone Extraction Kit Rapid / Ultra-pure Version 3 Last updated 7 July 2017 ab221031 Histone Extraction Kit Rapid / Ultra-pure For the extraction of histones from mammalian cells and tissue. This product is for research use only and is not intended

More information

User Manual. SILAC/ Stem Cells Protein Identification (ID) and Quantitation Media Kit

User Manual. SILAC/ Stem Cells Protein Identification (ID) and Quantitation Media Kit SILAC/ Stem Cells Protein Identification (ID) and Quantitation Media Kit For identifying and quantifying proteins from embryonic stem cells Catalog no. MS10036 Version A 17 November 2006 25-0982 User Manual

More information

Proteomics and Vaccine Potency Testing

Proteomics and Vaccine Potency Testing Proteomics and Vaccine Potency Testing Louisa B. Tabatabai, PhD Respiratory Diseases of Livestock Research Unit National Animal Disease Center, ARS, USDA, Ames, Iowa What is proteomics Methodologies of

More information

ab Mitochondrial Viability Assay

ab Mitochondrial Viability Assay ab129732 Mitochondrial Viability Assay Instructions for Use For measuring mitochondrial/cellular viability in high throughput This product is for research use only and is not intended for diagnostic use.

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358 CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.

More information

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * INSERM U1009, Gustave Roussy, Villejuif, France *For correspondence: isabelle.plo@gustaveroussy.fr [Abstract]

More information

Investigating Biological Variation of Liver Enzymes in Human Hepatocytes

Investigating Biological Variation of Liver Enzymes in Human Hepatocytes Investigating Biological Variation of Liver Enzymes in Human Hepatocytes SWATH Acquisition on the TripleTOF Systems Xu Wang 1, Hui Zhang 2, Christie Hunter 1 1 SCIEX, USA, 2 Pfizer, USA MS/MS ALL with

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

SUMOylated protein capture kit

SUMOylated protein capture kit SUMOylated protein capture kit Cat no. A010-100 Capture and detect SUMOylated proteins High capacity, high specificity SUMO binding matrix Fast, convenient protein isolation using purification system provided

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

Identification of Microprotein-Protein Interactions via APEX Tagging

Identification of Microprotein-Protein Interactions via APEX Tagging Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian

More information

Technical Note. Housekeeping Protein Validation Protocol

Technical Note. Housekeeping Protein Validation Protocol Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive

More information

Proteomic analysis of biological fluids

Proteomic analysis of biological fluids Proteomic analysis of biological fluids Anne Gonzalez, CNRS-IPBS, Toulouse Équipe «Analyse Protéomique et Spectrométrie de Masse des Biomolécules» Odile Schiltz-Bernard Monsarrat Workshop «Protéomique

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis)

KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) SignaLOCK HRP ChemiWestern Kit (Film) Catalog No. 54-53-00 SignaLOCK HRP ChemiWestern Kit (Imager) Catalog No. 54-54-00 SignaLOCK AP ChemiWestern

More information

PROTOCOL. Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) MS747 Rev.0 DESCRIPTION ADDITIONAL MATERIALS REQUIRED

PROTOCOL. Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) MS747 Rev.0 DESCRIPTION ADDITIONAL MATERIALS REQUIRED PROTOCOL Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS747 Rev.0 DESCRIPTION MAOB Enzyme Specific Activity Assay Kit Sufficient materials

More information

New Approaches to Quantitative Proteomics Analysis

New Approaches to Quantitative Proteomics Analysis New Approaches to Quantitative Proteomics Analysis Chris Hodgkins, Market Development Manager, SCIEX ANZ 2 nd November, 2017 Who is SCIEX? Founded by Dr. Barry French & others: University of Toronto Introduced

More information

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon PROTOCOL Pyruvate Dehydrogenase (PDH) Enzyme Activity Dipstick Assay Kit 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MSP30 Rev.4 DESCRIPTION Pyruvate Dehydrogenase (PDH) Enzyme Activity Dipstick

More information

One-Step Western TM Kit using TMB

One-Step Western TM Kit using TMB Technical Manual No. 0203 Version 03272008 I Description.. 1 II Kit Contents.. 2 III Applications 3 IV Key Features.. 3 V Storage.. 3 VI One-Step Western TM Protocol. 3 VII Examples. 3 VIII Troubleshooting..

More information

Optiblot. Western Blot Reagents and Troubleshooting Tips. Discover more at abcam.com/optiblot

Optiblot. Western Blot Reagents and Troubleshooting Tips. Discover more at abcam.com/optiblot 432_12_GM Optiblot booklet02_layout 1 28/08/2012 15:14 Page 1 Optiblot Western Blot Reagents and Troubleshooting Tips High quality protein electrophoresis and western blot reagents Our Optiblot range of

More information

Proteomics. Proteomics is the study of all proteins within organism. Challenges

Proteomics. Proteomics is the study of all proteins within organism. Challenges Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we

More information

PROTEIN RESEARCH PRODUCTS

PROTEIN RESEARCH PRODUCTS PIERCE PROTEIN RESEARCH PRODUCTS volume 11, issue 3 ENRICH YOUR PHOSPHOPROTEINS! FAST SPIN FORMAT GIVES HIGH YIELD FROM YOUR CELLS IN MUCH LESS TIME, PAGES 1-3 Background image: 3D rendering of the node

More information

Immunoprecipitation Protocol

Immunoprecipitation Protocol Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify

More information

ab MetaPath Mito Disease 4-Plex Dipstick Array

ab MetaPath Mito Disease 4-Plex Dipstick Array ab109879 MetaPath Mito Disease 4-Plex Dipstick Array Instructions for Use For the measurement of mitochondrial biogenesis regulation in human samples This product is for research use only and is not intended

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Protein electrophoresis: Introduction to SDS-PAGE

Protein electrophoresis: Introduction to SDS-PAGE Protein electrophoresis: Introduction to SDS-PAGE Aim: -Separation of proteins in an electric field by electrophoresis. Purposes: -Estimation of molecular masses -Relative abundances of major proteins

More information

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion

More information

Removal of Multiple High-Abundant Proteins from Mouse Plasma Using the Agilent Multiple Affinity Removal System for Mouse Application

Removal of Multiple High-Abundant Proteins from Mouse Plasma Using the Agilent Multiple Affinity Removal System for Mouse Application Removal of Multiple High-Abundant Proteins from Mouse Plasma Using the Agilent Multiple Affinity Removal System for Mouse Application Proteomics Authors William Barrett, Nina Zolotarjova, Haiying Chen,

More information

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use

More information

ichemistry SOLUTIONS Integrated chemistries to boost mass spectrometry workflows

ichemistry SOLUTIONS Integrated chemistries to boost mass spectrometry workflows ichemistry SOLUTIONS Integrated chemistries to boost mass spectrometry workflows ichemistry SOLUTIONS ichemistry solutions ichemistry solutions are the world s only reagents and consumables that are customdesigned

More information

ab Ubiquitylation Assay Kit (HeLa lysate-based)

ab Ubiquitylation Assay Kit (HeLa lysate-based) ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic

More information

A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS

A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS Zhiqi Hao, 1 Yi Zhang, 1 David Horn, 1 Seema Sharma, 1 Shiaw-Lin

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

Increasing MS Sensitivity for Proteomics

Increasing MS Sensitivity for Proteomics Increasing MS Sensitivity for Proteomics Discovery to Pathways Analysis: Using Agilent 6550 ifunnel Q-TOF Vadi Bhat, Ph.D. Senior Applications Scientist Agilent Technologies Wilmington, DE, USA 1 April

More information

Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System

Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Protocol Bulletin 6570 Stefanie L. Ritter and Donald G. Rainie, Deparment of Behavioral Neuroscience and Psychiatric

More information

Understanding life WITH NEXT GENERATION PROTEOMICS SOLUTIONS

Understanding life WITH NEXT GENERATION PROTEOMICS SOLUTIONS Innovative services and products for highly multiplexed protein discovery and quantification to help you understand the biological processes that shape life. Understanding life WITH NEXT GENERATION PROTEOMICS

More information

Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins

Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins BioPharma Compass TM is a fully automated solution for the rapid characterization

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

Electrophoresis and transfer

Electrophoresis and transfer Electrophoresis and transfer Electrophoresis Cation = positively charged ion, it moves toward the cathode (-) Anion = negatively charged ion, it moves toward the anode (+) Amphoteric substance = can have

More information

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product

More information

Application Note TOF/MS

Application Note TOF/MS Application Note TOF/MS New Level of Confidence for Protein Identification: Results Dependent Analysis and Peptide Mass Fingerprinting Using the 4700 Proteomics Discovery System Purpose The Applied Biosystems

More information

rapiflex Innovation with Integrity Designed for Molecules that Matter. MALDI TOF/TOF

rapiflex Innovation with Integrity Designed for Molecules that Matter. MALDI TOF/TOF rapiflex Designed for Molecules that Matter. Innovation with Integrity MALDI TOF/TOF rapiflex TM The first MALDI-TOF/TOF that adapts to your needs. The rapiflex is the most advanced MALDI TOF/TOF system

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

ab Vimentin Human Profiling ELISA Kit

ab Vimentin Human Profiling ELISA Kit ab173190 Vimentin Human Profiling ELISA Kit Instructions for Use For the measurement of total Vimentin protein in Human samples. This product is for research use only and is not intended for diagnostic

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

LTQ Orbitrap XL Hybrid FT Mass Spectrometer Unrivaled Performance and Flexibility

LTQ Orbitrap XL Hybrid FT Mass Spectrometer Unrivaled Performance and Flexibility m a s s s p e c t r o m e t r y LTQ Orbitrap XL Hybrid FT Mass Spectrometer Unrivaled Performance and Flexibility Part of Thermo Fisher Scientific LTQ Orbitrap XL OFFERING OUTSTANDING MASS ACCURACY, RESOLVING

More information

ab G alpha i Activation Assay Kit

ab G alpha i Activation Assay Kit ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version

More information

Principles of Proteomic Methods

Principles of Proteomic Methods Principles of Proteomic Methods Marc Wilkins School of Biotechnology and Biomolecular Sciences What is Proteomics? - proteomics is the study of proteomes - proteomics aims to: separate, identify and characterise

More information

Monoclonal Antibody Characterization on Q Exactive and Oribtrap Elite. Yi Zhang, Ph.D Senior Proteomic Marketing Specialist Oct.

Monoclonal Antibody Characterization on Q Exactive and Oribtrap Elite. Yi Zhang, Ph.D Senior Proteomic Marketing Specialist Oct. Monoclonal Antibody Characterization on Q Exactive and Oribtrap Elite Yi Zhang, Ph.D Senior Proteomic Marketing Specialist Oct. 12, 211 Outline Orbitrap Mass Spectrometer in mab Characterization Intact

More information

In-Cell ELISA. Validated antibodies, dyes and kits for the analysis of fixed adherent and suspension cells. Discover more at abcam.

In-Cell ELISA. Validated antibodies, dyes and kits for the analysis of fixed adherent and suspension cells. Discover more at abcam. In-Cell ELISA Validated antibodies, dyes and kits for the analysis of fixed adherent and suspension cells. In-Cell ELISA Advantages of In-Cell ELISA Flexible Measure specific protein level or post-translation

More information

DuoSet IC. Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE

DuoSet IC. Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE DuoSet IC Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE For the development of sandwich ELISAs to measure Signal Transducer and Activator

More information

ADVANCING ATTRIBUTE CONTROL OF ANTIBODIES AND ITS DERIVATIVES USING HIGH RESOLUTION ANALYTICS

ADVANCING ATTRIBUTE CONTROL OF ANTIBODIES AND ITS DERIVATIVES USING HIGH RESOLUTION ANALYTICS ADVANCING ATTRIBUTE CONTROL OF ANTIBODIES AND ITS DERIVATIVES USING HIGH RESOLUTION ANALYTICS Henry Shion 1, Jing Fang 1, William Alley 1, Barbara Sullivan 2, Nick Tomczyk 3, Liuxi Chen 1, Ying-Qing Yu

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

In-Cell Western Assay

In-Cell Western Assay In-Cell Western Assay Complete Sample Protocol for Measuring IC 50 of Inhibitor U0126 in NIH3T3 Responding to Acidic Fibroblast Growth Factor (afgf-1) Developed for: Aerius, Odyssey Classic, Odyssey CLx,

More information

Quantitative Analysis of Two Cancer Signaling Pathways Using Multiplex-Immunoprecipitation and Targeted Mass Spectrometry

Quantitative Analysis of Two Cancer Signaling Pathways Using Multiplex-Immunoprecipitation and Targeted Mass Spectrometry Quantitative Analysis of Two Cancer Signaling Pathways Using Multiplex-Immunoprecipitation and Targeted Mass Spectrometry John C. Rogers, PhD Senior R&D Manager Thermo Fisher Scientific The world leader

More information

SuperSignal West Pico Chemiluminescent Substrate

SuperSignal West Pico Chemiluminescent Substrate INSTRUCTIONS SuperSignal West Pico Chemiluminescent Substrate 3747 N. Meridian Road P.O. Box 117 Rockford, IL 61105 34077 34078 34079 34080 0636.3 Number Description 34079 SuperSignal West Pico Chemiluminescent

More information

PathProfiler MCM2 ELISA. Cat. No E {Includes choice of two (2) Detection Antibody Modules}

PathProfiler MCM2 ELISA. Cat. No E {Includes choice of two (2) Detection Antibody Modules} PathProfiler MCM2 ELISA Cat. No E300-002 {Includes choice of two (2) Detection Antibody Modules} Detection Antibody Modules Available Total MCM2 Detection Antibody Module Phospho MCM2 (S27) Detection Antibody

More information

Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs

Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs Technical Overview Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs Authors Stephen Madden, Crystal Cody, and Jungkap Park Agilent Technologies, Inc. Santa Clara, California,

More information

Tony Mire-Sluis Vice President, Corporate, Product and Device Quality Amgen Inc

Tony Mire-Sluis Vice President, Corporate, Product and Device Quality Amgen Inc The Regulatory Implications of the ever increasing power of Mass Spectrometry and its role in the Analysis of Biotechnology Products Where do we draw the line? Tony Mire-Sluis Vice President, Corporate,

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

FACTORS THAT AFFECT PROTEIN IDENTIFICATION BY MASS SPECTROMETRY HAOFEI TIFFANY WANG. (Under the Direction of Ron Orlando) ABSTRACT

FACTORS THAT AFFECT PROTEIN IDENTIFICATION BY MASS SPECTROMETRY HAOFEI TIFFANY WANG. (Under the Direction of Ron Orlando) ABSTRACT FACTORS THAT AFFECT PROTEIN IDENTIFICATION BY MASS SPECTROMETRY by HAOFEI TIFFANY WANG (Under the Direction of Ron Orlando) ABSTRACT Mass spectrometry combined with database search utilities is a valuable

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Just launched. Operated by. Karel Harant

Just launched. Operated by. Karel Harant Just launched Operated by Karel Harant 1 Rapid development of instrumentation Decline of MALDI-based instruments 2D protein electrophoresis abandoned 80% of proteomic data acquired in last two years (Somebody,

More information

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM 2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Significance Method description

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis SWATH Acquisition on the TripleTOF 5600+ System Samuel L. Bader, Robert L. Moritz Institute of Systems Biology,

More information

Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins

Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins Esther Lewis, 1 Kevin Meyer, 2 Zhiqi Hao, 1 Nick Herold,

More information

KPL LumiGLO Reserve Chemiluminescent Substrate

KPL LumiGLO Reserve Chemiluminescent Substrate DESCRIPTION KPL LumiGLO Reserve contains a luminol-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Reserve offers improvements in the way

More information