The Biotechnology Industry in Taiwan
|
|
- Malcolm Wells
- 6 years ago
- Views:
Transcription
1 The Biotechnology Industry in Taiwan Dr. Julie C. L. SUN Taiwan Institute of Economic Research
2 Development of Taiwan Biotech Industry 1982 Eight Key Technologies.... Biotechnology Hepatitis prevention 1995 Action Plan for Biotechnology Industry Development Advisory Committee for Promoting Biotechnology Industry, Executive Yuan 1996 Biotechnology And Pharmaceutical Industries Program Office (BPIPO), MOEA 2003 Action Plan for Biotechnology Industry Development (amended) 2005 Bio Taiwan Commisson (BTC) BioMedical Island Plan Government Measures 1984 Development Center for Biotechnology (DCB) Pharmaceutical Industry Technology And Development Center (PITDC) 1996 National Health Research Institutes (NHRI) 1998 Center for Drug Evaluation (CDE) 1999 Biomedical Engineering Research Center, Industrial Technology Research Institute (ITRI) 2003 Genomics Research Center, Academia Sinica (GRCAS) Food Industry Research and Development Institute (FIRDI), Bio-resources Collection and Research Center
3 Current Status of Taiwan s s Biotech Related Industries (2005 f ) Industry sector New Biotechnology Pharmaceuticals Medical Devices Total Revenue 1,212 1,940 1,850 5,002 No. of Companies ,152 Workforce (persons) 8,090 14,995 15,000 38,085 Export Value ,675 Import Value 501 1,791 1,073 3,365 Domestic Sales vs. Export (Unit: million US$) 60:40 87:13 55:45 67:33 Domestic Market 1,225 3,383 2,084 6,692 Source: rearranged by BPIPO,2006 1USD:1NTD=1: Taiwan Institute of Economic Research 2
4 Investments in Taiwan Biotech Industry Investment Amount (Unit: million US$) year Source: Biotechnology & Pharmaceutical Industries Program Office, MOEA Taiwan Institute of Economic Research 3
5 Bio Clusters in Taiwan Hsinchu Biomedical Science Park Hsinchu Science-Based Industrial Park Taichung Science-Based Industrial Park Nangang Software Park Biotech Plaza Yilan Marine Biotechnology Park Medicinal Herb Biotech Park Changhua National Flower Park Taiwan Orchid Biotech Park Taitung Deep Ocean Water Technology Park Tainan Science-Based Industrial Park Kaohsiung Biotech Park Ping Tong Agricultural Biotechnology Park Completed In construction Planned Being assessed Source: IDB, MOEA Taiwan Institute of Economic Research 4
6 Taiwan s s Life Science Research >150 Universities 35,000 graduates/year (~7,000 graduates/ year in life sciences) 17 Large Medical Centers 7 Certified Clinical Trial Hospitals More then 20 Research Institutes: -ITRI, NHRI, DCB, Academia Sinica, FIRDI, PITDC, CDE, etc. Taiwan Institute of Economic Research 5
7 Highly Educated and Innovative Workforce Life Science talents supply Life Science graduates Source: 2004 Development Center for Biotechnology ITIS Project B.S. M.S. Ph.D. Total 2005f 4,258 2, , f 4,684 2, , f 5,105 2, , domestic life science-related departments in 2005(of which 57 were graduate institutes). 18th on the number of major scientific theses and dissertations presented (2003) -12,392 (Total) -5,110 (Biotech) 4th in patents issued in US(2004) Taiwan Institute of Economic Research 6
8 Investment Incentives 1 (1) Tax Benefits Tax deduction up to 30% of the R&D and HRD expenses Tax deduction of 5%-7% for the investments in automation, pollution control, energy-saving, etc. (2) R&D Grants Programs: Grants for Development of Innovative Products Grants for Industrial Technology Development Program Grants for Conventional Industry Technology Development Grants for Small Business Innovation Research (SBIR) Grants for Industrial Technology Innovation Centers Taiwan Institute of Economic Research 7
9 Investment Incentives 2 (3) Joint Investment from the Government Fund The Executive Yuan s Development Fund can join investments in biotech companies and venture capitals. (4) Low Interest Loan Loan for promoting industrial research and development Loan for medium-long term investment (Council For Economic Planning and Development) Taiwan Institute of Economic Research 8
10 Investment Incentives 3 (5) Industrial Park Rent Discount Program Zero rent for the first two years; 40% discount for the 3 rd and the 4 th years; 20% discount for the 5 th and the 6 th year. The rent paid may be used to offset the purchase price (6) Listing / OTC Trading Technological enterprises that have successfully developed marketable products / technologies 27 biotechnology companies are currently listed or OTC traded Taiwan Institute of Economic Research 9
11 Why Taiwan? Superior geographic gateway to the Asia-Pacific region Ideal springboard into mainland China markets Well-integrated industrial clusters Abundant high-quality human resources Excellent R&D and commercialization capabilities High quality medical centers for clinical trials Strong government support Taiwan Institute of Economic Research 10
12 Biotechnology Industry Study Centre, Taiwan Institute of Economic Research
13 National Science And Technology Program For Agricultural Biotechnology (NSTAB) Taiwan Institute of Economic Research 12
14 Taiwan Institute of Economic Research 13
15 The Development Framework for Modified Breed Modified breed development Application in different industries Genomics /proteomics Gene/Trait identification Trait optimization Model system Target material Advanced development Field trial Modibreed (Mkt) Growing/ Processing Commercialization Agricultural products Industrial products Medical products Genome sequence analysis cdna analysis EST analysis Genetic marker Phenotype screening Expression analysis Gene tagging Mutagenic manipulation Crossing tech Vector system Transformation tech Promoter Asexual reproduction tech Sexual reproduction tech Safety evaluation Environment evaluation Product Information Instruments Reagents Software Tool Microarray Lab-on-a-chip Nucleic acid amplification ELISA Material Library Taiwan Institute of Economic Research 14
16 The Development Framework for Functional Food Genomics / Proteomics/ Metabolomics Target Identification Sources Finding & Research Bio-activity Validation Raw material Component Product Type & Manufacture Safety & Efficacy / Regulation Marketing Clinical Trial / Regulation Pharmaceutical Marketing Screening In vitro platform Productivity Expand Products Source Identification Sources Purification Culture and Incubation Information Biological Kits Bio Chip Computer Simulation Data Bank In Vivo/ Animal Platform Safety Evaluation Tools Extraction Formulation Compaction In Vivo/Human Platform Analysis Data Analysis Instrument Taiwan Institute of Economic Research 15
17 The Development Framework for Vaccine Antigen identification Immunogen development Formulation / Scale-up Laboratory trial Field trial / Regulation Marketing Koch s ostulates Inactivation Delivery systems Product Genomic analysis Attenuation Adjuvants Proteomic analysis Peptide synthesis Fermentation Information Computer simulation Recombinant DNA Therapeutic antibody Safety validation Protectivity validation Tools Expression analysis Stability validation Immunogenicity analysis Instruments Reagents Software In vivo platform Microbe bank Nucleic acid amplification, detection Western blot analysis ELISA Cell sorting systems Taiwan Institute of Economic Research 16
18 All in all, a bright future for cooperation between US and Taiwan! Taiwan Institute of Economic Research 17
19 Thank you for your attention! Taiwan Institute of Economic Research Biotechnology Industry Study Centre TEL: FAX:
Pharmaceutical Industries
Taiwan Biotech and the Pharmaceutical Industries Chei-Hsiang Chen, Ph.D. Director, Biotechnology and Pharmaceutical Industries Program Office, Ministry of Economic Affairs, Taiwan The government has a
More informationWELCOME TO TAIWAN. Contents. Letter from the CEO of BIIP...2. Taiwan: The Heart of Asia...3. Macro Environment: Global Competitiveness Rankings...
Contents Letter from the CEO of BIIP...2 Taiwan: The Heart of Asia...3 Macro Environment: Global Competitiveness Rankings...4 Overview of Taiwan s Biomedical Industry...6 BIIP: Biomedical Industry Innovation
More informationIntroduction of Development Center for Biotechnology TAIWAN
Introduction of Development Center for Biotechnology TAIWAN DCB Nonprofit Organization Founded in 1984 Funded Mainly by Ministry of Economic Affairs (MOEA), National Science Council and the Industry 394
More informationINTERNATIONAL COLLABORATION. S. Sinha Adviser Department of Biotechnology Ministry of Science & Technology Government of India
INTERNATIONAL COLLABORATION S. Sinha Adviser Department of Biotechnology Ministry of Science & Technology Government of India INDIA S ASSETS Strong pool of scientists and engineers >300,000 institutions
More informationRecombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016
Recombinant Antibody Production in Therapeutic Antibody Projects Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Presentation Outline 1 2 3 4 5 Introduction Recombinant Ab Production
More informationBIOTECH IN FRANCE. key info in. points
BIOTECH IN FRANCE 10 key info in points 1 2 3 INSERM: EUROPE S #1 ACADEMIC BIOTECH RESEARCH INSTITUTE INSERM spearheads healthcare and medical research in France, filing more biotech patents with the European
More informationCOMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE
The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES
More informationJob Title: Cell Culture Technician (open June 1 through Oct 31, 2016)
Rockland Immunochemicals Inc. is recognized as one of the world's leading manufacturers and suppliers of immunochemical reagents for basic research and discovery. Rockland Immunochemicals provides reagents
More informationRegulation of Biologics in The United States: From a Rich Tradition To A Challenging Future
Regulation of Biologics in The United States: From a Rich Tradition To A Challenging Future Chris Joneckis,, Ph.D. Senior Advisor For CMC Issues Center For Biologics Evaluation And Research Food and Drug
More informationCALIFORNIA S BIOTECHNOLOGY WORKFORCE TRAINING NEEDS FOR THE 21 st CENTURY
CALIFORNIA S BIOTECHNOLOGY WORKFORCE TRAINING NEEDS FOR THE 21 st CENTURY Executive Summary Prepared for Applied Biological Technologies Initiative Economic and Workforce Development Program California
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationPHARMACEUTICAL INDUSTRIES IN TOYAMA
PHARMACEUTICAL INDUSTRIES IN TOYAMA Profile(outline of Toyama Prefecture) Toyama prefecture is located near the center of Japan and is approximately the same distance from the three largest cities in Japan-Tokyo,Nagoya,and
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationThe overview of Estonian biotechnology sector (2012)
The overview of Estonian biotechnology sector (2012) Olavi Otepalu 15.06.2012, Tallinn Bioeconomy in the Baltics. Inspiration conference. Defining the biotechnology sector Always necessary prior to specify
More informationDeveloping New GM Products and Detection Methods
Developing New GM Products and Detection Methods Dave Grothaus Monsanto Company Slides Thanks to: International Life Sciences Institute Crop Life International Indus try Colleagues Hope Hart - Syngenta
More informationMedigen Biotech Company Spotlight. ~ Innovations for a Better Life ~
Medigen Biotech Company Spotlight ~ Innovations for a Better Life ~ About Medigen Biotech (MBC) (2000) Established to develop novel cancer therapeutics (2013) Completed PI-88 phase III subjects recruitment
More informationProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation
ProteoGenix Life Sciences Services and Products From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Philippe FUNFROCK, founder and CEO French company located in Strasbourg,
More informationUCF, College of Medicine BS Biotechnology MS Biotechnology/MBA Professional Science Masters Program in Biotechnology/MBA
UCF, College of Medicine BS Biotechnology MS Biotechnology/MBA Professional Science Masters Program in Biotechnology/MBA Dr. Henry Daniell Pegasus Professor & University Board of Trustee Chair Dept. Mol.
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR HUMAN USE (CHMP)
European Medicines Agency Pre-authorisation Evaluation of Medicines for Human Use London, 22 February 2006 EMEA/CHMP/BMWP/42832/2005 COMMITTEE FOR MEDICINAL PRODUCTS FOR HUMAN USE (CHMP) GUIDELINE ON SIMILAR
More informationMolecular Diagnostics
Molecular Diagnostics Part II: Regulations, Markets & Companies By Prof. K. K. Jain MD, FRACS, FFPM Jain PharmaBiotech Basel, Switzerland May 2018 A Jain PharmaBiotech Report A U T H O R ' S B I O G R
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationDRUG REGISTRATION REGULATION
DRUG REGISTRATION REGULATION Registration Categories and Application Information Items Requirements of Biological Products Part I I Therapeutic Biological Products Registration Categories 1) Biological
More informationBlue Marble University Biology Course Handbook
Blue Marble University Biology Course Handbook A Summary of Course Descriptions Courses and Content Subject to Change Without Notice BlueMarbleUniversity.com Info@bluemarbleuniversity.com Stem Cell Biology
More informationThe World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.
The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration
More informationMASTER S DEGREE IN BIOTECHNOLOGY AND MEDICAL BIOLOGY. Faculty of Medicine and Surgery
MASTER S DEGREE IN BIOTECHNOLOGY AND MEDICAL BIOLOGY Faculty of Medicine and Surgery PRESENTATION This 2-Year Master s Degree in Biotechnology and Medical Biology bridges theoretical knowledge to hands-on
More informationGEROPHARM NEW PARTNERING OPPORTUNITIES IN SAINT-PETERSBURG PHARMACEUTICAL CLUSTER
GEROPHARM NEW PARTNERING OPPORTUNITIES IN SAINT-PETERSBURG PHARMACEUTICAL CLUSTER USD, billions Russian pharmaceutical market one of the most rapid growing markets in the world 30 25 22 25.5 20 19 16.9
More informationTrans-omics for a better life
Trans-omics for a better life History From 1% to World Leading The largest genomic organization in the world Focus on research and applications in the healthcare, agriculture, conservation, and environmental
More informationSingle Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( )
Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends (2013-2021) May, 2017 3 rd Edition Information contained in this market report is believed to be reliable at the time
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationChapter 9. Biotechnology and DNA Technology
Chapter 9 Biotechnology and DNA Technology SLOs Compare and contrast biotechnology, recombinant DNA technology, and genetic engineering. Identify the roles of a clone and a vector in making recombined
More informationLandscape of the European Chemical Industry 2018
Ireland BioPharmaChem Ireland National contact Capital spending Direct employees 10 billion > 30,000 R&D investment 600 million Matt Moran Director General matt.moran@ibec.ie CHEMICAL INDUSTRY SNAPSHOT
More informationBiotechnology Cluster Progress Report. of The Santa Fe Plan The Cluster Approach to Economic Gardening
Biotechnology Cluster Progress Report of The Santa Fe Plan The Cluster Approach to Economic Gardening Prepared by Santa Fe Economic Development, Inc. March, 2000 Executive Summary Santa Fe Economic Development,
More informationTaxonomy. Classification of microorganisms 3/12/2017. Is the study of classification. Chapter 10 BIO 220
Taxonomy Is the study of classification Organisms are classified based on relatedness to each other Chapter 10 BIO 220 Fig. 10.1 1 Species Binomial nomenclature for species identification A eukaryotic
More informationREIMAGINING DRUG DEVELOPMENT:
Biology Reconstructed REIMAGINING DRUG DEVELOPMENT: Accurate Disease Modeling To Drive Successful Therapies Julia Kirshner, CEO julia@zpredicta.com 1 SUCCESS RATES OF DRUG DEVELOPMENT ARE LOW, " PARTICULARLY
More informationDevelopment Stage of Therapeutic Vaccines: The Regulator s View
Development Stage of Therapeutic Vaccines: The Regulator s View Thomas Hinz Head, Section Therapeutic Vaccines Paul Ehrlich Institute, Germany thomas.hinz@pei.de 1 DISCLAIMER This is the personal views
More informationPRAXIS. A publication by Bioengineering AG
PRAXIS A publication by Bioengineering AG Portrait of Rentschler Biotechnologie GmbH, a globally active service company that supports its clients in the development, production, and registration of biopharmaceuticals.
More informationHow to Build a Molecular Testing Laboratory: Key Strategic & Operational Considerations. The complete guide to developing or expanding your lab
How to Build a Molecular Testing Laboratory: Key Strategic & Operational Considerations The complete guide to developing or expanding your lab Includes step-by-step plans for basic and full-service MDx
More informationMARKETS & CUSTOMERS. Progressing globalization. Evolving markets
Peptides are used worldwide in medical research. They contribute immensely to the understanding of diseases and have proven to be effective in medicinal products. Today, peptides can be produced at low
More informationKinase Activity: a total solution
Kinase Activity: a total solution Protein arrays for multiplex kinetic measurements Robust Instrumentation User friendly software Kinetic data at your fingertips! PamGene s novel platform for profiling
More informationContent Areas of the Pharmacy Curriculum Outcomes Assessment (PCOA )
Content Areas of the Pharmacy Curriculum Outcomes Assessment (PCOA ) Area 1.0 Basic Biomedical Sciences (10%) Area 2.0 Pharmaceutical Sciences (33%) Area 3.0 Social/Behavioral/Administrative Sciences (22%)
More informationTaiwan Pharmaceuticals & Biotechnology
Taiwan Pharmaceuticals & Biotechnology 2015 Regulatory Framework Manufacturing Biotechnology Niche Drugs Botanicals Contract Manufacturing Distribution Logistics Are you looking to grow your business in
More informationAffinity Reagents: The Landscape and Affimer Technology Competitive Advantages
Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages Introduction It is well accepted that the limitations of antibodies present valuable commercial opportunities for alternative
More informationEuropean Regulatory Experiences and Expectations of HCP Analysis and Control
HCP Strategy Forum, Washington DC, January 26, 2015 www.pei.de European Regulatory Experiences and Expectations of HCP Analysis and Control Blood Products: Dr. Erika Friedl, PEI (DE) Discalimer: The views
More informationMICROBIAL LIMIT TESTS FOR RAW MATERIALS AND NON-STERILE PRODUCTS REVIEW-DISCUSSIONS-INTERPRETATIONS
Microrite, Inc. brings you this unique learning experience in microbial limit tests for raw materials and non-sterile products-review-discussions-interpretations Part of Microrite s step-by-step webinar
More informationOverview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations. Audrey Chang, PhD, Senior Director Development Services
Overview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations Audrey Chang, PhD, Senior Director Development Services Definition of Biologics: PHS Act, section 351 Virus, therapeutic
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationChapter 8 Recombinant DNA Technology. 10/1/ MDufilho
Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying
More informationBiosafety and the NIH Guidelines
Biosafety and the NIH Guidelines This section will explore: Why the NIH Guidelines are important The definition of recombinant or synthetic nucleic acid research Content of the NIH Guidelines Section III
More informationGuideline for the Quality, Safety, and Efficacy Assurance of Follow-on Biologics
Provisional Translation (as of April 19, 2013) PFSB/ELD Notification No. 0304007 March 4, 2009 To: Prefectural Health Department (Bureau) From: Evaluation and Licensing Division, Pharmaceutical and Food
More informationBasic Concepts and History of Genetic Engineering. Mitesh Shrestha
Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique
More information1 R01 AI VMD HALFORD, W
1 R01 AI104935-01 2 VMD 1R01AI104935-01 ILLIAM CRITIQUE 1: Significance: 5 Investigator(s): 2 Innovation: 5 Approach: 8 Environment: 2 Overall Impact: This application proposes to develop a recombinant
More informationOur Purpose Our Purpos o e DuP u o P n o t n is i a a scie i n e c n e e co c m o pa p n a y n. y.
1 Our Purpose Our Purpose DuPont is a science company. We work collaboratively to find sustainable, innovative, market-driven solutions to solve some of the world s biggest challenges, making lives better,
More informationHannover, your first foothold for business expansion into Europe
Hannover, your first foothold for business expansion into Europe Hannover Clinical Trial Center & hannoverimpuls Support for entering the health care market 1 The Hannover Region features all important
More informationMolecular Diagnostics: Market Segmentation and Opportunities
Molecular Diagnostics: Market Segmentation and Opportunities October 2010 This market report is published by DeciBio, LLC. All rights reserved. Reproduction or redistribution of this report in any form
More informationGlobal Leader in Viral Vector Technologies
Global Leader in Viral Vector Technologies Gene Therapy Vaccines - Discovery 1 SIRION BIOTECH ANY GENE TO ANY CELL Expert for viral vectors Competitive proprietary viral vector platforms High-end enabling
More informationAgricultural Technology Commercialization from Government Research Institutions to Agribusiness in Taiwan
Agricultural Technology Commercialization from Government Research Institutions to Agribusiness in Taiwan Liang-Jeng Hung Chief, Division of International Affairs, Industrial Development Center, Agricultural
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationTable of Contents. Abbreviations and Acronyms Preface Executive Summary... 15
TABLE OF CONTENTS 5 Table of Contents Abbreviations and Acronyms... 11 Preface... 14 Executive Summary... 15 Chapter 1. Defining the Bioeconomy... 19 What is a bioeconomy?... 22 Foreseeing the emerging
More informationPharmaceutical Biotechnology
Pharmaceutical Biotechnology Debbie S. Retnoningrum; Catur Riani; Tri Suciati; Heni Rachmawati; Ana Indrayati School of Pharmacy, ITB Introduction 1 REFERENCES Glick, BR and JJ Pasternak, 2003, Molecular
More informationAntibody Services from GenScript
Services from GenScript www.genscript.com GenScript USA Inc. 860 Centennial Ave., Piscataway, NJ 08854 USA Toll-Free: 1-877-436-7274 Fax: 1-732-210-0262 1-732-855-5878 Academic Services Pharmaceutical
More informationGala s Gene Product Expression (GPEx ) Platform
Gala Biotech A Company with Gene Insertion and Manufacturing Technologies for the Next Generation of Gene Expression and Biologics Production Gala s Gene Product Expression (GPEx ) Platform Rapid creation
More informationExiProgen Protein Synthesis RNA/DNA Prep System
Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! - Automated Protein Synthesis/Purification System Bioneer's is the world's
More informationRecombinant DNA and Research with Animals
Recombinant DNA and Research with Animals Recombinant DNA and Research with Animals Jan V. Parker-Thornburg, Ph.D. Director, Transgenic Animal Core Facility MD Anderson Cancer Center Stephen H. Hughes,
More informationAnnex 4. Guidelines on the quality, safety and efficacy of biotherapeutic protein products prepared by recombinant DNA technology
Guidelines on the quality, safety and efficacy of biotherapeutic protein products prepared by recombinant DNA technology Replacement of Annex 3 of WHO Technical Report Series, No. 814 Introduction 177
More informationBIOLOGICS & PROCESS TECHNOLOGY MASTER CLASS
BIOLOGICS & PROCESS TECHNOLOGY MASTER CLASS Supported By: Organised By: PROGRAMME OVERVIEW BIOLOGICS MAKE UP MORE THAN 1,000 MEDICINES AND VACCINES THAT TARGET MORE THAN 100 DISEASES. Unlike medicines
More informationBiosimilar Monoclonal Antibodies: Registration Requirements. Henry M. J. Leng
Biosimilar Monoclonal Antibodies: Registration Requirements Henry M. J. Leng Disclaimer This presentation is given in my personal capacity and represents only the author s personal views and does not represent
More information21 st Century Herpes Solutions. William Halford, PhD RVx, Chief Science Officer
21 st Century Herpes Solutions William Halford, PhD RVx, Chief Science Officer Scope of Herpes Problem A major public health concern HSV-1 and/or HSV-2 HSV-2 infections ~100 million recurrent herpes severe
More informationBuilding Biotech Technology Transfer Opportunities
HEALTHCARE Building Biotech Technology Transfer Opportunities Sponsor and developer strategies for success By Alison Sahoo Alison Sahoo Alison Sahoo is a pharmaceutical industry analyst with more than
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationPolicies that encourage innovation in middle-income countries
December 2012 Policies that encourage innovation in middle-income countries The International Federation of Pharmaceutical Manufacturers and Associations (IFPMA) asked Charles River Associates (CRA) to
More informationNovel Diagnostic Methods of Tuberculosis
Novel Diagnostic Methods of Tuberculosis Qimin YOU USTAR Biotechnologies I. The TB Diagnosis Challenge My presentation will focus on the new diagnostic methods of tuberculosis, developed by USTAR Biotechnologies.
More informationInnovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing
Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Overview Serving biotech and pharma community since 1998 Proven track record of advancing small molecules from
More informationYour Antibody Source. prosci-inc.com. Extensive Antibody Services Broad Antibody Catalog
Your Source prosci-inc.com Extensive Services Broad Catalog Company Overview Established in 1998, ProSci Incorporated is a leading provider of high performance antibodies and custom antibody services.
More informationCopyright. Jeremiah J. Kelly (2015). All rights reserved. Further dissemination without express written consent strictly prohibited.
Statutory Framework for Biologics Drugs Investigational Use Application IND Pre-Market Approval Applications 505(b)(1) NDA 505(b)(2) NDA 505(j) ANDA Over-the-Counter (OTC) Non- Rx Drugs Monograph Biologics
More informationICH Topic E16 Genomic Biomarkers Related to Drug Response: Context, Structure and Format of Qualification Submissions. Step 3
European Medicines Agency June 2009 EMEA/CHMP/ICH/380636/2009 ICH Topic E16 Genomic Biomarkers Related to Drug Response: Context, Structure and Format of Qualification Submissions Step 3 NOTE FOR GUIDANCE
More informationa n d B i o s a fety C o n s i d e ra t i o n s
National University of Singapore Academy of GxP Excellence (NUSAGE) & PharmEng Technology Presents Good Laboratory Practices a n d B i o s a fety C o n s i d e ra t i o n s Part of the Pharmaceutical and
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationPeptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST
Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations
More informationCytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationGrowing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend
Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Dr. dr. Francisca Srioetami Tanoerahardjo, SpPK., MSi Essential Practical Molecular Diagnostics Seminar Hotel
More informationReflection paper on co-development of pharmacogenomic biomarkers and Assays in the context of drug development
1 2 3 24 June 2010 EMA/CHMP/641298/2008 Committee for Medicinal Products for Human Use (CHMP) 4 5 6 7 Reflection paper on co-development of pharmacogenomic biomarkers and Assays in the context of drug
More informationEstablishment of Clinical Trial Infrastructure
Taiwan s Strategy in the Establishment of Clinical Trial Infrastructure Chei-Hsiang Chen, Ph. D. Director, Biotechnology and Pharmaceutical Industries Program Office, Ministry of Economic Affairs, Taiwan
More informationRECs system in Latvia
RECs system in Latvia Vents Silis (Riga Stradins University) Rinalds Mucins (Central Medical Ethics Committee) EURECNET conference Bratislava, 12-13 April, 2012 REC system in Latvia 4 Clinical Drug Trial
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationBIOTECHNOLOGY SYSTEMS CAREER PATHWAY
Plant Systems Te Power, r Structural and T chnical Systems Natural Resource Car Systems eer Pathway A F N R A F N R Agribusiness Systems C A R E E R C O N T E N T C L U S T E R Career Ready Practices Content
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationFood and Drug Administration (FDA) 101
Food and Drug Administration (FDA) 101 What is the Food and Drug Administration (FDA)? The FDA is an agency within the U.S. Department of Health and Human Services that is responsible for protecting the
More informationBIOCRATES Life Sciences AG Short Company Presentation
BIOCRATES Life Sciences AG Short Company Presentation Dr. Alexandra C. Gruber MBA MMFin Director Business Development / Marketing Austria Showcase Life Science Japan, Tokyo, December 2010 BIOCRATES Life
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationValuation of Biosimilar and Key Value Drivers Dr. Patrik Frei October 2015 Biosimilars Asia
Valuation of Biosimilar and Key Value Drivers Dr. Patrik Frei October 0 Biosimilars Asia Agenda Introduction Valuation of Biosimilar Key Value Driver / Conclusion Venture Valuation Independent assessment
More informationRegulatory Consideration for Biotechnology Products: Clonality of the Production Cell Bank
Regulatory Consideration for Biotechnology Products: Clonality of the Production Cell Bank Rashmi Rawat, Ph.D. Office of Biotechnology Products OPQ/CDER/FDA Informa Life Sciences Annual Cell Line Development
More informationPROTEOMICS: TECHNOLOGIES AND GLOBAL MARKETS. BIO034C May John Bergin Project Analyst ISBN:
PROTEOMICS: TECHNOLOGIES AND GLOBAL MARKETS BIO034C May 2013 John Bergin Project Analyst ISBN: 1-56965-403-4 BCC Research 49 Walnut Park, Building 2 Wellesley, MA 02481 866-285-7215, 781-489-7301 www.bccresearch.com
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationconsent. With the exception, such as impossible to obtain informed consent objectively or there is no risk of the clinical trial for subjects, the res
The Technical Guidelines for In Vitro Diagnostic Reagents Clinical Trial Article 1 In vitro diagnostic reagents clinical trial (include comparison experiment with marketed products) refers to the systematically
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationOverview of biological product evaluation in CDE, CFDA
Overview of biological product evaluation in CDE, CFDA WCBP, Washington, DC. Date: Jan. 24, 2017 Jianhui LUO Office of Pharmaceutical Science of Biological Products luojh@cde.org.cn 1 Outline Introduction
More informationThe Challenges of [high-throughput] Phenotyping
The Challenges of [high-throughput] Phenotyping Mount Hood - sept 2008 Topics Introducing BASF Plant Science Phenotyping, for what purposes? What are the challenges? High-throughput phenotyping The TraitMill
More informationGenomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research
Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research " Increasing usage of novel genomics techniques and tools, evaluation of their benefit to patient outcome and focusing
More information