CHE-3H84: Protein Engineering Past Exam Papers

Transcription

1 CHE-3H84: Protein Engineering Past Exam Papers Sorted by Topic then Year Knowledge-Based Engineering of Proteins, Large Scale Production of Recombinant Proteins, and Protein Purification Dr. Hemmings 2006/7 Answer ALL parts (a), (b) and (c). You wish to design a protocol for the production of at least 500 mg of a purified recombinant, nickel-binding protein. The protein has a molecular weight of around 10 kda, is of bacterial origin, has no disulfide bridges and contains no cofactors. A recombinant vector containing the structural gene for the protein is available. (a) Discuss the considerations appropriate for choice of methodology for the largescale production of this protein in a recombinant form from a readily-cultured Gramnegative bacterial host. (b) Affinity chromatography is a commonly-employed strategy in protein purification. Compare and contrast TWO affinity purification methods, providing details of the molecular interaction on which they are based. Explain briefly why affinity purification methods are often superior to conventional chromatographic methods. (c) Design a purification strategy for this protein. Ensure that you explain the considerations you have taken into account in developing your design. Answer BOTH parts (a) and (b). (a) Describe the contributions to protein stability of the following: (i) the hydrophobic effect; (ii) hydrogen bonding; (iii) disulfide bonds.

2 2007/8 Answer ALL parts (a), (b) and (c). (a) List and briefly describe the six classes of enzyme. (b) Enzymes are commonly found in an aqueous environment. What effects might be anticipated on moving a water soluble enzyme to an organic solvent environment? (c) Using examples to illustrate your answers, discuss each of the following: (i) The use of proteinases in industrial processes (ii) Proteins as pharmaceutics. [10%] (a) Discuss the factors important for the stabilisation of the folded state of a protein relative to the unfolded state. Describe one example of the use of mutagenesis to investigate protein stability.

3 2008/9 Answer ALL parts (a), (b), (c) and (d). A single-chain enzyme of molecular weight 25 kda has been chosen for use in an industrial process which will take place at a temperature slightly above the melting temperature of the enzyme, Tm. To increase the operational half-life of the enzyme at the process temperature, it has been decided to attempt to increase its stability by introducing a disulfide bridge. The enzyme has been cloned but its three-dimensional structure is not available. However, both the primary and high resolution crystal structures are available for a highly homologous enzyme from the same family. (a) Explain how the primary and tertiary structural information available can be used to generate a model for the structure of the target enzyme. (b) Describe how you might use this model to help decide which residue(s) to mutate so as to maximize the chance of introducing a disulfide bridge into the enzyme. [20%] (c) An expression vector has been prepared incorporating the gene for the putative disulfide-containing mutant enzyme. The mutant enzyme will be expressed in frame as a fusion with a cleavable C-terminal glutathione-stransferase (GST) affinity tag. You now wish to produce milligram-scale quantities of the mutant enzyme. Following its overexpression in E.coli, a cellfree extract containing the mutant has been prepared. The fusion protein has a pi of 8.0 and has a molecular weight of 50 kda. Design a purification strategy for the enzyme explaining the considerations you have taken into account in doing so. (d) Describe briefly how you might determine the change in melting temperature for the purified mutant relative to that of the wild type enzyme. [10%] Using examples, discuss the balance between the needs of a protein to be both functional and stable.

4 2009/10 A small molecule binding protein bearing a cysteine-linked fluorophore is to form the basis of a specific biosensor of the rare hexose sugar, fucose. No naturally-occurring fucose binding protein is available. A bacterial periplasmic galactose binding protein (GBP) will be modified by site directed mutagenesis to create a mutant protein that binds fucose with high specificity in a process that can be detected by a change in fluorescence. Note that GBP has no cysteine residues and is non-fluorescent. High resolution crystal structures of both the free and galactose-bound forms of GBP are available. (a) What is a biosensor and what features of bacterial periplasmic binding proteins make them particularly suitable as starting points for engineering to produce biosensors? [15 %] (b) Explain the experimental strategy needed to: (i) Engineer fucose-specific binding. Include in your answer a brief critical explanation of how molecular mechanics calculations might help guide the redesign of the protein. Note that the objective is to mutate residues so as to abolish galactose binding activity and enhance fucose binding activity in the engineered protein. (ii) Engineer fluorescence detection of fucose binding. [20 %] [15 %] (c) An expression vector has been prepared incorporating the gene for engineered binding protein. This protein will be expressed in frame as a fusion with a noncleavable C-terminal histidine (His6) affinity tag. Following its overexpression in Escherichia coli, a cell-free extract containing the engineered protein has been prepared. The fusion protein has a pi of 6, a molecular weight of 20 kda and is monomeric. Design a purification strategy for the protein which would be suitable for purification of 10 mg of the protein at a purity of at least 95 % (w/w). Explain the considerations you have taken into account in generating your design. (b) Describe the contributions to protein stability of the following: (i) Hydrogen bonding (ii) The hydrophobic effect (iii) Conformational entropy.

5 2010/11 Increasing the thermal stability or modifying the catalytic properties of a protein/enzyme is often a goal for protein engineers. With examples, describe three strategies that are commonly employed to achieve these aims. Answer ALL parts (a), (b) and (c). You have been contracted to provide 100 mg of a highly purified glutathione-binding protein by a large pharmaceutical company. The molecular structure of glutathione is shown below. The protein is of bacterial origin, it is monomeric and has a molecular weight of 10 kda. The protein has a pi of 5.0 and has no cofactors nor disulfide bridges. An inducible recombinant vector for overexpression of the target protein in the cytoplasm of Escherichia coli is available. The target purity of the purified protein is at least 99.9 % (w/w). (a) Discuss the methodologies available for the fermenter-based, large-scale production of a cell-free lysate containing this protein using Escherichia coli as a heterologous expression host. (b) Affinity chromatography is a commonly-employed strategy in protein purification. Compare and contrast TWO affinity purification methods, providing details of the molecular interactions on which they are based. Explain briefly why affinity purification methods are often superior to conventional chromatographic methods. (c) Describe a possible purification strategy for the recombinant protein, explaining the considerations you have taken into account in developing your design.

6 2011/12 (c) Describe, in general terms, a method that could be used to make a sitedirected variant of an enzyme of interest. [25%] (d) Using high resolution structural data on your enzyme of interest, you select a buried aspartate residue for substitution with alanine. You have reason to believe that the aspartate residue is important for substrate binding. What effect would you predict this substitution to have on the stability and activity of the enzyme? Explain your answer. Answer ALL parts. You wish to design a protocol for the production of at least 100 mg of a purified recombinant, nickel-binding protein. The protein has a molecular weight of 20 kda, is of bacterial origin, has no disulfide bridges, contains no cofactors and has a pi of 6.0. An expression vector is available which allows the inducible production of the soluble recombinant protein in the cytoplasm of Escherichia coli. (a) Discuss the considerations appropriate for choice of methodology for the largescale production of this protein in a recombinant form using Escherichia coli. (b) Affinity chromatography is a strategy commonly employed in protein purification. Compare and contrast TWO affinity purification methods, providing details of the molecular interactions on which they are based. Explain briefly why affinity purification methods are often superior to conventional chromatographic methods. (c) Design a purification strategy for this protein. Ensure that you explain the considerations you have taken into account in developing your design.

7 2012/13 Many serine proteases have natural inhibitors that are proteins. Describe the key features of the catalytic mechanism of a serine protease and explain why their protein inhibitors are not substrates. [35%] Provide examples of protein engineering experiments with serine proteases AND their inhibitors that support your description of the mechanism and inhibition. (a) Describe the contributions to protein stability of the following: (i) Hydrogen bonding (ii) The hydrophobic effect (iii) Conformational entropy of the polypeptide backbone. [65%] A single-chain enzyme of relative molecular mass 15,000 has been chosen for use in an industrial process which will take place at a temperature slightly above its melting temperature, Tm. To increase the operational half-life of the enzyme at the process temperature, it has been decided to attempt to increase its stability by introducing a disulfide bridge. The enzyme has been cloned but its three-dimensional structure is not available. However, both the primary and high resolution crystal structures are available for a highly homologous enzyme from the same family. (a) Explain how the primary and tertiary structural information which is available can be used to generate a homology model of the target enzyme. [20%] (b) How you might use the homology model to help decide which residue(s) to mutate in order to introduce a disulfide bridge? [20%] (c) Introducing a disulfide bridge is one means by which protein stability may be enhanced. Provide rationalizations for TWO other approaches which may be employed. [10%]

8 2013/14 (b) Describe the contributions to protein stability of the following: (i) the hydrophobic effect (ii) hydrogen bonding (iii) disulfide bonds Answer ALL parts (a) to (d). You wish to design a protocol for the production of 10 mg of a purified recombinant, nickel-binding protein. The purity of the final protein sample should be no less than 99 % (w/w). The protein has a molecular weight of 20 kda, is highly soluble in aqueous buffers and has no disulfide bridges. A glycerol stock of Escherichia coli is available which has been transformed with a plasmid containing the structural gene for the protein. This plasmid can be used to direct constitutive expression of the recombinant protein. (a) Explain how you would produce a starter culture for a fermenter run, starting from the glycerol stock of Escherichia coli bacteria. [20%] (b) Discuss the considerations relevant to choice of methodology for the largescale fermenter-based production of cells containing the recombinant protein. (c) Design a purification strategy for this protein, starting with a cell paste from a fermenter run, explaining the considerations you have taken into account in developing your design.

9 DNA Techniques Dr. Blumenschein 2006/7 Answer ALL parts (a), (b) and (c). (a) Template-assisted biosynthesis of nucleic acids are critical for the cell s ability to replicate its DNA and to decode the information stored in DNA for protein synthesis. Briefly describe the properties of nucleic acid strands that facilitate high fidelity copying of the information stored within them. [20%] (b) With the aid of diagrams, describe the essential features of the polymerase chain reaction (PCR). (c) The DNA sequence of a gene that encodes a bacterial protein of interest is given below. You have been supplied with a small quantity of chromosomal DNA from the organism from which the protein is derived and you decide to use PCR to clone the gene. Design suitable primers for the amplification, incorporating into them NdeI and BamHI restriction sites, so that these are located upstream and downstream of the gene, respectively. Write both primers in the 5-3 direction. Note the following: only the 5-3 strand of the gene is shown; the recognition sequences for NdeI and BamHI are CATATG and GGATCC, respectively; and the translational start and stop codons are underlined. CATGCAGGATTTTTTTTGCTCAGTATCGAATACAAACATGGGACAGTAAGGACG GTTTTAGAAAGCGTTTTTATGCTGGCTGGAAAGGATGGATGTC ATG AAG GTT ATC AAG GGG TTA ACG GCT GGG CTG ATT TTT CTG TTT TTG TGT GCA TGC GGA GGA CAG CAG ATT AAA GAT CCG CTC AAT TAC GAG GTG GAG CCT TTT ACA TTT CAA AAC CAA GAC GGC AAG AAC GTT TCT TTA GAG AGT TTA AAA GGA GAA GTA TGG CTG GCG GAT TTT ATT TTT ACC AAT TGT GAA ACT ATA TGT CCG CCA ATG ACC GCT CAT ATG ACC GAT CTG CAA AAA AAA CTG AAA GCC GGA AAT ATA GAT GTC CGC ATC ATA TCA TTT AGT GTT GAT CCA GAA AAC GAT AAG CCG AAA CAG CTG AAG AAA TTT GCC GCA AAT TAT CCA TTA TCT TTT GAT AAC TGG GAT TTT CTC ACG GGA TAC AGC CAG AGT GAG ATT GAG AAG TAAGCTAAGAGACTAGGCTTCGCAAATCTTCTAAAACATGATACACTTTCCACTA GTAGAATGGGAAGGAGCAACAAGATTGAAGCTGCGCATTTTT

10 2007/8 Answer ALL parts (a), (b), (c) and (d). (a) Using examples, briefly describe the essential features of a cloning vector. [20%] (b) The selection of host cells containing the vector with the desired gene as an insert is an important part of the gene cloning process. Describe how this can be achieved. (c) The success of a cloning experiment is normally confirmed by obtaining the sequence of the cloned DNA. Explain the principles of DNA sequencing. (d) How has DNA sequencing technology changed in recent years in response to demands for higher throughput from large scale genome sequencing projects? 2008/9 Answer ALL parts (a), (b) and (c). [20%] (a) The polymerase chain reaction (PCR) enables the amplification of DNA from minute quantities of template DNA. With the aid of diagrams, describe how this is achieved. (b) Describe a PCR-based method for generating site-directed mutants of a gene. What are the advantages and disadvantages of the method you have chosen? (c) What is directed evolution and how can it be used to improve the properties of natural enzymes?

11 2009/10 Answer ALL parts (a), (b) and (c). (a) The DNA sequence of a gene that encodes a bacterial protein of interest is given below. With a full description of the design process, write the sequences (in the 5-3 direction) of suitable forward and reverse primers for the PCR amplification of the gene. Note the following: only the 5-3 strand of the gene is shown and the translational start and stop codons are underlined. CATGCAGGATTTTTTTTGCTCAGTATCGAATACAAACATGGGACAGTAA ATG AAG GTT ATC AAG GGG TTA ACG GCT GGG CTG ATT TTT CTG TTT TTG TGT GCA TGC GGA GGA CAG CAG ATT AAA GAT CCG CTC AAT TAC GAG GTG GAG CCT TTT ACA TTT CAA AAC CAA GAC GGC AAG AAC GTT TCT TTA GAG AGT TTA AAA GGA GAA GTA TGG CTG GCG GAT TTT ATT TTT ACC AAT TGT GAA ACT ATA TGT CCG CCA ATG ACC GCT CAT ATG ACC GAT CTG CAA AAA AAA CTG AAA GCC GGA AAT ATA GAT GTC CGC ATC ATA TCA TTT AGT GTT GAT CCA GAA AAC GAT AAG CCG AAA CAG CTG AAG AAA TTT GCC GCA AAT TAT CCA TTA TCT TTT GAT AAC TGG GAT TTT CTC ACG GGA TAC AGC CAG AGT GAG ATT GAG AAG TAAACACTTTCCACTAGTAGAATGGGAAGGAGCAACAAGATTGAAGCT (b) Upon successful amplification of the gene in part (a), you want to clone it. Using examples, describe the essential features of a cloning vector. [25%] (c) Following cloning of the gene in part (b), you wish to verify the sequence of the gene. (i) With the aid of diagrams, describe the essential features of the Sanger-Coulson method of DNA sequencing. (ii) A sequencing experiment was run on an unknown fragment of DNA. A schematic representation of part of the resulting four-lane sequencing gel is shown below. From this, deduce the sequence of the first twelve bases in the DNA fragment. Briefly explain how you arrived at your answer. [45%]

12 2010/11 Answer BOTH parts (a) and (b). (a) With the aid of diagrams, describe the essential features of the polymerase chain reaction (PCR). (b) The DNA sequence of a gene that encodes a bacterial protein of interest is given below. CATGCAGGATCCTTTGGGCTCAGTATCGAATACATTCATGGGACAGTAAGGACG GTTTTAGAAAGCGTTTTTATGCTGGCTGGAAAGGATAAATGTC ATG CCA CCA GGA CTC GGA GGC CGC CAT CAA CCG CCA GAT CAA CCT GGA GCT CTA CGC CTC CTA TGT CTA CCT GTC CAT GTC GTA CTA TTT TCA CCG TCA TCA TGT GGC TTT GAA GAA CTT TGC CAA ATA CTT TCT TCA CCA ATC TCA TCA GGA GAG GGA ACA TGC TTA GAG ACT GAT GAA GCT GCA GAA CCA GCG AGG CGG CCG AAT CTT CCT TCA GGA TAT CAA GAA ACC AGA CCG TTA ATA CTG GGA GAA TCG GCT GAC TGC AAT GGA ATG TGC GCT GTG CTT GGA GAG AAG TGT GAA TCA GTC ACT ACT GGA ACT GCA CAA ACT GGC CAC TTT AAA AAA TTT TCC CCA TCT GTG TTT TTT CAT TTT GAC TCA TTA CCT GAA TTT GCA GGT GGA AGC TAAAAAGAATTGGGTGACCACATAACCAACCTGCGCAAGATGGGGGCTCCTGG ATCTGGCAT GGCAGAGTACCTCTTTGACAAGCACACCCTGGGACACA (i) Design suitable primers for the PCR amplification of the gene. Incorporate into them EcoRI and HindIII restriction sites, so that these are located upstream and downstream of the gene, respectively. Write both primers in the 5-3 direction. Note the following: only the 5-3 strand of the gene is shown; the recognition sequences for EcoRI and HindIII are CTTAAG and AAGTTC, respectively; and, the translational start and stop codons are underlined. (ii) What is the purpose of incorporating restriction sites that flank the gene of interest? [10%] (c) Sequencing methods are commonly used to determine the precise nucleotide sequence of DNA, including whole genomes. Briefly outline the principles of ONE of the latest generation, ultra-high throughput sequencing methodologies. [20%]

13 2011/12 Answer ALL parts. Protein engineering is largely dependent on the ability to manipulate DNA molecules and their sequences, and on determining the effects of any changes that are made. (a) (i) A fragment of double stranded DNA was isolated and sequenced, and 23% of the bases were found to be adenines (A). What are the contents (as percentages) of the other three bases? Explain your answer. [10%] (ii) Would the DNA molecule in (i) have a higher or lower melting temperature (Tm) than a similarly sized molecule of 50% GC base content? Explain your answer. (b) (i) Briefly explain the important features of type II restriction enzymes. [10%] [15%] (ii) Assuming a random distribution of bases and a GC content of 50%, what are the frequencies of recognition sites for six and eight base-pair cutter restriction enzymes? [10%]

14 2012/13 (d) An expression vector has been prepared incorporating the gene for a disulfidecontaining mutant enzyme. The mutant enzyme will be expressed as a fusion with a cleavable N-terminal hexahistidine affinity tag. You now wish to produce milligramscale quantities of the mutant enzyme. Following its overexpression in E. coli, a cellfree extract containing the soluble mutant has been prepared. The fusion protein has a pi of 5.0. Design a purification strategy for the enzyme explaining the considerations you have taken into account in doing so. (e) Describe briefly how you might determine the change in melting temperature for the purified mutant relative to that of the wild-type enzyme. 2013/14 Answer ALL parts (a) to (c). [10%] (a) The polymerase chain reaction (PCR) is used to amplify DNA from minute quantities of starting template DNA. With the aid of diagrams, describe how this is achieved. (b) Describe a PCR-based method for generating site-directed mutants of a gene. What are the advantages and disadvantages of the method you have chosen? (c) What is directed evolution and how can it be used to improve the properties of natural enzymes?

15 Synthetic Proteins Prof. Pickett 2006/7 Answer BOTH parts (a) and (b). (a) The total synthesis of novel proteins by chemical means suffers three major drawbacks. Briefly describe these drawbacks. (b) Full length Interleukin 8 containing 72 amino acids has been produced using the native chemical ligation procedure. Discuss the advantage of this approach and the basic chemistry on which it is based. [60%] (b) Kaiser et al have shown that replacing Zn(II) at the active site of carboxypeptidase A (CPA) by Cu(II) results in a dramatic change in activity. Discuss this result. 2007/8 (b) Describe the use of t-butyloxycarbonyl (BOC) and tertiary butyl esters as protecting groups in solid phase peptide synthesis, and the mechanism of deprotection. Discuss the advantages and disadvantages of solid-phase peptide synthesis compared to conventional solution methods. [100%]

16 2008/9 Answer ALL parts (a), (b), (c) and (d). (a) Briefly list the advantages of solid-phase peptide synthesis over conventional solution synthesis. [25%] (b) What is a 'linker' in solid-phase peptide chemistry? Illustrate your answer with reference to three linkers commonly used in solid-phase peptide synthesis. Describe cleavage mechanisms for the linkers you have illustrated. (c) By what mechanisms are t-bu ester and Fmoc protecting groups removed? (d) Dicyclohexyl carbodiimide (DCC) and closely related molecules are used as coupling reagents in peptide synthesis. Draw the structure of DCC and describe how it works, outlining the mechanism of the coupling pathway. Describe the transition state analogue approach to ester hydrolysis by catalytic polymers. 2009/10 Answer BOTH parts (a) and (b). (a) Discuss strategies to redesign enzyme activity by chemical modification. (b) Trypsin is intrinsically unstable. Discuss this statement and explain how chemical modification can increase the stability of trypsin in solution. Answer BOTH parts (a) and (b). [25%] [25%] [25%] (a) The Zn(II) ion at the active site in carboxypeptidase A ( CPA) can be replaced by Cu(II) to give an enzyme of dramatically altered activity. (i) Of what type of modification is this an example? (ii) What effect does the replacement have on the natural activity of the enzyme and its behaviour towards inhibitors? (iii) What is the new type of activity of the modified enzyme?

17 2010/11 Answer BOTH parts (a) and (b). (a) Describe the transition state analogue approach in the design of artificial enzymes for ester hydrolysis. (b) Discuss the advantages and disadvantages of solid-phase peptide synthesis compared to conventional solution synthesis. (a) BOC and tertiary butyl esters are commonly used as protecting groups in solid phase peptide synthesis. Define the type of functions they are used to protect and the mechanism of their removal in the deprotection steps.

18 2011/12 Answer BOTH parts. (a) Protein engineering using directed evolution is a common strategy for improving the catalytic properties of enzymes. With examples, describe how directed evolution may be applied and comment on its advantages and limitations. (b) (i) What is a 'linker' in solid-phase peptide chemistry? Provide TWO examples of linkers that are commonly used in solid -phase peptide synthesis including details of their structures and how they are cleaved. (ii) Describe TWO examples of protecting groups for the amine group of an amino acid that are commonly used in peptide synthesis. Answer BOTH parts. [20%] The active centre of [FeFe]-hydrogenase consists of a [4Fe-4S] cubane unit linked to a di-iron subsite. (a) Illustrate the key structural features of the active site. (b) Discuss how this active site is understood to operate in catalysis of hydrogen evolution or its reverse, hydrogen oxidation. (c) Describe artificial systems that model structural and functional aspects of the enzyme. [25%] [25%]

19 2012/13 (b) BOC and tertiary butyl esters are commonly used as protecting groups in solidphase peptide synthesis. Define the type of function they are used to protect and the mechanism of their removal in the deprotection steps. How does the use of these protecting groups complement the use of FMOC groups in solid-phase peptide synthesis? Suggest how the tetrapeptide shown below could be made by a solidphase synthesis strategy. Answer ALL parts (a) to (c). (a) The molecular imprinting of polymers provides an approach to producing sites which recognise and bind substrate molecules with high affinity. Describe how such sites can be created. (b) Artificial enzymes can also be produced by imprinting polymers. Describe the key underlying concept used in constructing sites for catalysis of ester hydrolysis and provide an example of how such an artificial enzyme can be assembled. (c) Carboxypeptidase A contains a Zn(II) centre and guanidinium centre at its active site. What roles do these groups play in hydrolysis of the peptide bond at the C- terminus of proteins? Suggest how such structures can be imprinted. [20%]

20 2013/14 Answer ALL parts (a) to (c). The [FeFe] hydrogenase catalyses the reversible reduction of protons to dihydrogen. (a) Discuss the principal features of the active site of the enzyme, the H-centre. (b) Discuss how the re-constitution of an apo-protein (HydA) with artificial subsites has provided an understanding of the structure and function of the natural system. (c) Briefly describe possible methods by which re-constitution of the apo-hyda with synthetic organometallic subsites might be further explored. [45%] [45%] [10%] (a) Outline a general approach by which a catalytic moiety can be anchored noncovalently to a protein framework so as to provide a means of chiral catalysis. Illustrate an example of enantiomeric hydrogenation using such an artificial enzyme construct.