Synthesis of 5 -NAD-capped RNA

Transcription

1 Supplementary information Synthesis of 5 -NAD-capped RNA Katharina Höfer, Florian Abele, Jasmin Schlotthauer & Andres Jäschke. Institute for Pharmacy and Molecular Biotechnology, Heidelberg University, Heidelberg, Germany. Correspondence should be addressed to AJ. (jaeschke@uni-hd.de). Materials and Methods General Synthesis of β-nicotinamide mononucleotide (NMN) S2 1 S2 Synthesis of β-nicotinamide ribose-5 -phosphorimidazolide (Im-NMN) 2 S2 Synthesis of NAD Solid-phase synthesis of 5 -P-RNA In vitro transcription Preparation of 5 -monophosphorylated RNA by polyphosphatase reaction Preparation of 5 -NAD capped RNA by Im-NMN reaction LC-MS analysis of 5 -NAD-RNA Preparation of site-specifically radiolabeled 5 -NAD-RNA for NudC digest NudC kinetic study S4 Supplementary Figures Figure S1 S5 Figure S2 S6 Figure S9 Figure S4 S10 Figure S5 S11 Figure S6 S12 Figure S7 S13 Figure S8 S14 Supplementary Tables Table S1 S15 S1

2 General Reagents were purchased from Sigma-Aldrich and used without further purification. Oligonucleotides were purchased from Integrated DNA Technologies, Inc. Reversed-phase HPLC purification was performed on an Agilent 1100 Series HPLC system equipped with a diode array detector using Phenomenex Luna 5 µm C A (250 x 4.60 mm) at a flow rate of 1 ml/min for analytical analysis and Phenomenex Luna 5 µm C A (250 x 15 mm) at a flow rate of 5 ml/min for preparative purification eluting with a gradient of 100 mm triethylammonium acetate ph 7.0 (buffer A) and 100 mm triethylammonium acetate in 80 % acetonitrile (buffer B). NMR spectra were recorded on a Varian Mercury Plus 500 MHz spectrometer. LC-MS analysis was performed on an Agilent 1200 Series HPLC system connected to a Bruker microtof-q II ESI mass spectrometer. For LC-MS analysis a Phenomenex Synergi Fusion-RP 2.5 µm (100 x 2 mm) was used at a flow rate of 0.25 ml/min to separate and detect single nucleotides and NAD eluting with a gradient of 5 mm ammonium acetate ph 5.5/acetonitrile. Oligonucleotide synthesis was performed on an ExpediteTM 8909 automated synthesizer using standard reagents from Sigma Aldrich Proligo. For desalting oligonucleotides, Zip tipc18 pipette tips (Merck-Millipore) were used. MS experiments were performed on a Bruker microflex MALDI mass spectrometer using 3-hydroxypicolinic acid (3-HPA) as matrix. 1 Synthesis of β-nicotinamide mononucleotide (NMN) A solution of NAD (3.5 g, 5.28 mmol) and ZrCl4 (6.15 g, 26.4 mmol) in 500 ml water was stirred at 50 C for 30 min. The hydrolysis was monitored by TLC (SiO2 EtOH/ 1 M NH4Ac [7 : 3]). The reaction was quenched with 245 ml of a 0.5 M solution of Na3PO4. After adjusting to ph 7 with a 2 M solution of HCl, a white precipitate was formed. The suspension was centrifuged 8 min, 1,000 rpm, the supernatant was collected and the pellet was washed two times with 200 ml water. The combined supernatants were concentrated to 1/3 of its volume on a rotary evaporator. The remaining solution was purified with a column filled with Dowex + 50WX8 ( mesh, H -Form, column-material: 2.5 x 30 cm). The column was loaded with 1.5 L 5 % HCl and equilibrated with 1.5 L millipore water until ph 5 was reached. 100 ml of the concentrated solution was loaded on the ion exchange column and eluted with Millipore water. The first cleavage product eluted was NMN (615 mg, 1.84 mmol, yield: 35 %) and yielded a colorless solid after evaporation of the solvent, followed by AMP. 1 H NMR (500 MHz, D2O) δ: 9.48 (s, 1 H), 9.31 (d, J = 6.2 Hz, 1 H), 9.00 (d, J = 8.2 Hz, 1 H), 8.32 (dd, J = 8.2, 6.2 Hz, 1 H), 6.24 (d, J = 5.4 Hz, 1 H), (m, 1 H), 4.58 (t, 1 H), (m, 1 H), (m, J = 12.0, 2 H). 13 C NMR (75 MHz, d2o) δ: , , , , , , 99.65, 87.18, 87.06, 77.42, 70.71, 63.89, P NMR (202 MHz, D2O) δ: Synthesis of β-nicotinamide ribose-5 -phosphorimidazolide (Im-NMN) NMN (100 mg, 299 µmol) was coevaporated with 5 ml DMF under argon. Afterwards, 500 mg carbonyldiimidazole (CDI) and ml DMF were added and the mixture was stirred at RT for 3 h. P-NMR analysis of 0.2 ml reaction solution mixed with 0.2 ml d6-dmso (-10.9 ppm), was indicating that the intermediate carbonate had been formed. After addition of 20 ml 0.2 M TEABbuffer, cooled to 4 C, the reaction solution was stirred for 5 h at RT, which led to the hydrolysis of the carbonate and formation of Im-NMN (-10.5 ppm). The solvent was removed under reduced pressure at RT and the remaining solid dissolved in 9 ml DMF. Within 10 min at room temperature a precipitate was formed and removed by filtration. Im-NMN was precipitated by addition of 1.4 g NaOCl4 dissolved in 80 ml acetone. After centrifugation (8 min, 3,000 rpm, RT) the pellet was washed with 45 ml acetone. The washing procedure was repeated 3 times. The solid was dried under reduced pressure and yielded 71 mg Im-NMN (185 µmol, yield: 62 %). 1 H NMR (500 MHz, DMSO-d6) δ: 9.86 (s, 1H), 9.43 (s, 1H), 9.25 (d, J = 6.2 Hz, 1H), 9.04 (d, J = 8.2 Hz, 1H), 8.30 (dd, J = 8.2, 6.2 Hz, 1H), 8.11 (s, 2H), (m, 1H), (m, 1H), (m, 1H), 6.15 (d, J = 5.7 Hz, 1H), 6.14 (br s, 1H), 5.67 (br s, 1H), (m, 1H), 4.27 (t, J = 5.2 Hz, 2H), (m, 1H), (m, 1H). 13 C NMR (126 MHz, DMSO-d6) δ: , , , (d, J = 3.9 Hz), , (d, J = 10.1 Hz), , (d, J = 5.3 Hz), 99.59, (d, J = 4.7 Hz), 77.79, 70.46, (d, J = 6.0 Hz). 31 P NMR (202 MHz, DMSO-d6) δ: HR-MS (ESI ): m/z (calculated for [C14H17N4O7P+Na] ). S2

3 Synthesis of NAD In an argon-purged 5 ml Schlenk flask, 10 mg Im-NMN (26.0 µmole), 6 mg AMP (17.3 µmole) and 24.7 mg MgCl2 (260 µmole) were dried under high vacuum overnight. After addition of 1 ml DMF the mixture was stirred at RT for 5 h. While stirring DMF was removed under high vacuum at RT. After the addition of 10 ml cold 0.1 M TEAA-buffer the reaction outcome was monitored by HPLC (see Figure B). Solid-phase synthesis of 5 -P-RNA Oligonucleotide synthesis was performed at 1 μmol scale using standard reagents and standard protocols for RNA. In the final step all oligonucleotides were 5 -phosphorylated with bis(2-cyanoethyl)-n,n-diisopropylphosphoramidite. All oligonucleotides were either purified by anion exchange chromatography or by preparative HPLC. The purity of the oligonucleotides was analyzed by reversed-phase HPLC or denaturing polyacrylamide gel electrophoresis. Mass was confirmed by MALDI-TOF mass spectrometry. In vitro transcription The templates for in vitro transcriptions using T7 RNA polymerase (own lab stock 1 mg/ml) were amplified by PCR (sequences see Table S1). Transcription was performed in the presence of 500 nm DNA template, 4 mm GTP, 4 mm CTP, 4 mm UTP, 4 mm ATP, 40 mm Tris-HCl ph 8.0, 1 mm spermidine, 22 mm MgCl2, 0.01 % Triton-x-100, 5 % DMSO, 10 mm DTT, 0.25 µg/µl T7 RNA and incubated for 3 h at 37 C. RNA was purified by denaturing polyacrylamide gel electrophoresis and ethanol-precipitated. Preparation of 5 -monophosphorylated RNA by polyphosphatase reaction 150 pmol in vitro transcribed RNA were digested to 5 -P-RNA using 1 x polyphosphatase buffer (Epicentre) and 20 U polyphosphatase (Epicentre). After 2 h at 37 C, RNA was purified by denaturing polyacrylamide gelelectrophoresis and ethanolprecipitated. Preparation of 5 -NAD capped RNA by Im-NMN reaction 5 -Monophosphorylated RNA ( pmol), either prepared by solid-phase synthesis or by in vitro transcription/polyphosphatase digest, was incubated in the presence of a 1000-fold excess of Im-NMN, 50 mm MgCl2 for 2h at 50 C. RNA was purified by ethanol precipitation. 5 -P-RNA was removed by Xrn-1 digest. 100 pmol RNA were incubated for 2 h, 37 C with 5 U Xrn-1 (NEB) in 1 x NEB buffer 3 (NEB). The exonuclease was removed by phenol/ether extraction, followed by ethanol precipitation. Imidazolide reaction as well as Xrn-1 digest of the RNA was analyzed by 20 % denaturing polyacrylamide gel electrophoresis. Polyacrylamide gels were stained with Sybr gold (Life technologies) for 10 min and analyzed by a Typhoon 9400 imager (GE Healthcare). LC-MS analysis of 5 -NAD-RNA 5 -P-8mer (IDT) was converted to 5 -NAD-8mer using imidazolide chemistry and purified from remaining Im-NMN using AmiconMillipore filters 3 kda (Merck Millipore). For LC-MS studies 2.5 nmol 5 -NAD-8mer or 5 -P-8mer were digested with nuclease P1 1 (0.1 U µll ; Sigma-Aldrich) in 300 µlof 50 mm ammonium acetate buffer (ph 4.5) at 37 C for 1 h. The digest was purified using Amicon-Millipore filters 10 kda (Merck Millipore). The flow-through was concentrated on a Speedvac system to 80 µl for LC-MS analysis. A 20 µl sample was subjected to LC-MS analysis as described above. Preparation of site-specifically radiolabeled 5 -NAD-RNA for NudC digest 5 -P-RNA, generated by in vitro transcription and polyphosphatase treatment, was subjected to T4 polynucleotide kinase (PNK) reaction to exchange the 5 -P- at the -position to a radiolabeled monophosphate. The following conditions were applied: pmol 5 -P-RNA, 200 µci P -ATP, 8000 Ci/mmol, Hartmann Analytic, 1x buffer B, 20 U T4 PNK (Thermo Scientific), adjusted with water to 50 µl. RNA was purified by denaturing polyacrylamide gel electrophoresis and radiolabeled reaction products were visualized using storage phosphor screens (GE Healthcare) and a Typhoon 9400 imager (GE Healthcare). 5 -P- RNA was incubated in the presence of a 1000-fold excess of Im-NMN, 50 mm MgCl2 for 2h at 50 C to synthesize 5 -NAD-RNA. Remaining 5 -P-RNA was removed by Xrn-1 digest. 100 pmol RNA were incubated for 2 h, 37 C in presence of 1 x NEB buffer 3 and 5 U Xrn1 (NEB). The exonuclease was removed by phenol/ether extraction followed by ethanol precipitation.

4 Preparation of radioactive 5 -NCD/NGD/NUD-RNA (NXD-RNA) 5 -NUD, 5 -NGD or 5 -NCD-RNA were prepared by reaction of nicotinamide riboside phosphorimidazolide with radiolabeled P-phosphorylated RNA. 5 - P-RNA I (Sequence shown in Table S1) was incubated in presence of 1000 fold excess of Im-NMN, 50 mm MgCl2 for 2 h at 50 C. RNA was purified by denaturing polyacrylamide gelelectrophoresis and RNA products visualized using storage phosphor screens (GE Healthcare) and a Typhoon 9400 imager (GE Healthcare). To quantify the yield of NXD-RNA after imidazolide reaction, PAGE purified radioactive RNA was treated with alkaline phosphatase (Thermo Scientific) to remove the free, non-reacted radiolabeled 5 -monophosphate group and ethanol precipitated. Radioactivity was measured before and after alkaline phosphatase treatment to calculate coupling efficiencies. Quantitative radioactivity measurements were performed on a Beckmann Coulter LS 6000 SC scintillation counter. NudC kinetic study In vitro NudC cleavage assays were performed in 25 mm Tris-HCl ph 7.5, 50 mm NaCl, 50 mm KCl, 10 mm MgCl2, 1 mm DTT, 3 using 15 pmol site-specifically radiolabeled 5 -NAD-RNAI and 1 nm NudC / NudC E178Q, purified as described. Cleavage reactions were performed in the presence of 0.1 U/µL FastAP thermosensitive alkaline phosphatase (Thermo Scientific) in order 32 to remove the P-phosphate that became accessible only after cleavage of the NAD pyrophosphate bond by NudC. S4

5 Figure S1. Synthesis of Im-NMN. Preparation of NMN (A, yield: 35 %) and Im-NMN (B, yield: 62 %). S5

6 S6

7 S7

8 Figure S2. NMR spectra of Im-NMN. S8

9 (A) (B) Figure. Synthesis of NAD by imidazolide reaction. (A) Reaction of Im-NMN and AMP to prepare NAD. (B) HPLC analysis. Blue trace: mixture of commercial NAD and AMP. S9

10 (A) (B) (C) (D) (E) Figure S4. MALDI spectra of synthesized 20mer RNA: (A) 5 -OH-RNA (cal / meas ) (B) 5 -P-RNA before and after (cal / meas ) (C) reaction with Im-NMN (meas and ). (D) After reaction with Im-NMN 5 -P-RNA was treated with Xrn-1 and analyzed by MALDI MS (cal / meas ). (E) Validation with HR-MS (ESI ): m/z (deconvoluted mass) (calculated for [5 -P-ACAGUAUUUGGUAUCUGCGC] ) showed that the synthesized oligo had the calculated mass. S10

11 Figure S5. Preparation of 5 -NAD-RNA > 20 nt by in vitro transcription and imidazolide reaction. 5 -PPP-RNA was prepared by in vitro transcription (1). 5 -P-38mer was generated by polyphosphatase digest of 5 -PPP-38mer (2). PAGE purified 5 -P-RNA was digested with 5 -P-dependent exonuclease Xrn-1 (3) to show complete conversion of the 5 -PPP-RNA to 5 -P-RNA by polyphosphatase reaction. Imidazolide reaction was performed with 5 -P-RNA from lane 2. ~45 % 5 -NAD 38mer were formed (4). The 5 -P-RNA/5 -NAD mixture (lane 4) was digested with Xrn-1 to remove 5 -P-RNA and to obtain pure 5 -NAD-RNA (5). 20 % denaturing polyacrylamide gel, SYBR gold staining. S11

12 Figure S6. Analysis of selective digest by 5 -P-dependent exonuclease Xrn-1. The mixture of 5 -NAD-RNA (20mer) and 5 -P-RNA (20mer) obtained from imidazolide reaction was incubated with Xrn-1. The reaction was stopped by direct addition of one volume gel loading buffer (10 % TBE in formamide containing xylene cyanol and bromophenol blue). The reaction was analyzed by 20 % denaturing polyacrylamide gel electrophoresis and staining with sybr gold. As negative control, Xrn-1 was omitted from the reaction mixture. S12

13 Figure S7. Analysis of 5 -NAD-RNA using LC-MS. (A) HPLC purification of synthesized NAD-8mer (B) Analytical HPLC chromatogram of purified 5 -P-8mer and 5 -NAD-8mer. (C) MALDI mass spectra of 5 -P-8mer (cal. 2574,34/ meas ) and 5 -NAD-8mer (cal / meas ) (D) UV chromatograms (A254) of nuclease-p1-digested 5 -P-8mer and 5 -NAD-8mer (produced by the established imidazolide chemistry) and (E) ESI mass spectra of the nucleotide peak fractions from panel D, right chromatogram. S13

14 Figure S8. (A) HR-ESI-MS analysis of NAD, NCD, NUD and NGD dinucleotides synthesized by imidazolide chemistry. Crude reaction mixtures were applied for LC-MS analysis. Note that separation of unreacted Im-NMN and dinucleotides was not completely achieved with that method, therefore both masses occurring in one spectra. (B) Measured masses by LC-MS of different dinucleotides (NXD). (C) Enzyme kinetics of NudC on NAD-capped RNA (RNAI, 106 nt). S14

15 Table S1: RNA sequences used in this study. 20mer (solid phase synthesis) ACAGUAUUUGGUAUCUGCGC 38mer (in vitro transcription) ACAGUAUUUGGUAUCUGCGCUCUGCUGAAGCCAGUUAC 8mer (solid phase synthesis, for Fig. S7) ACAGUAUU RNAI (106 nt) ACAGUAUUUGGUAUCUGCGCUCUGCUGAAGCCAGUUACCUUCGGAAAAAGAG UUGGUAGCUCUUGAUCCGGCAAACAAACCACCGCUGGUAGCGGUGGUUUUUU UU References (1) Liu, R. H., and Visscher, J. (1994) A Novel Preparation of Nicotinamide Mononucleotide. Nucleosides Nucleotides 13, (2) Chen, L., Rejman, D., Bonnac, L., Pankiewicz, K. W., and Patterson, S. E. (2006) Nucleoside-5'phosphoimidazolides: reagents for facile synthesis of dinucleoside pyrophosphates. Curr Protoc Nucleic Acid Chem Chapter 13, Unit (3) Cahová, H., Winz, M. L., Höfer, K., Nübel, G., and Jäschke, A. (2015) NAD captureseq indicates NAD as a bacterial cap for a subset of regulatory RNAs. Nature 519, S15