Chapter 4. Fixed Fill1l Colul1ln Bioreactor Study

Transcription

1 Chapter 4 Fixed Fill1l Colul1ln Bioreactor Study

2 4.1 Introduction Bioextraction of metals from sulphidic minerals mainly comprise of two stages, the chemical attack of metal sulphide by ferric iron and biological oxidation of ferrous iron produced. The separation of the two reactions allows the individual enhancement of both the stages (1,2). The biological iron oxidation has been studied in several experimental systems with batch and continuous flow mode of operations. Because of the interest in the kinetic aspects of the oxidation, attempts have been made to improve the ferrous iron oxidation rate by the use of various reactor designs (3). Most of the biooxidation processes are carried out in a stirred tank reactor (STR) but now an interesting alternative is the fixed film column bioreactor (4). Several advantage of this kind of reactor over STR includes; No mechanical stirring is necessary No addition of inoculum after maturation of biofilm More sux:face area of biofilm can achieve higher. iron oxidation rate A unit operation is simple, stable and cost effective compare to Stirred Tank Reactor Minimum loss of inoculum Variety of support matrix such as glass beads, activated carbon, acrylic pieces, ion-exchange resin, sand, polystyrene, polyurethane, polyvinyl chloride, porcelain rings, peat, glass wool, ceramic, rubber and calcium alginate have been used for development of the biofilm, and several types of reactors have been studied for ferrous biooxidation (5-10). The biofilm reactors have been used for several processes and gained acceptance for its efficiency compared to conventional fixed film reactor. Compact biofilm reactor was used for aerobic waste 117

3 treatment. It was reported that a complex microbial biofilm was utilized for the oxidation of sulphide containing effluents; this biofilm was developed in a packed column, which showed stable oxidation performance for several weeks ( 11). The biological iron oxidation was also performed in packed bed bioreactor to eliminate hydrogen sulphide from biogas. In packed bed bioreactor the fixed film of At. ferrooxidans oxidised ferrous to ferric, which react with the H2S of the biogas and produce ferrous sulphate and elemental sulphur. Sulphur was separated out and ferrous sulphate was reoxidised by biological oxidation using fixed biofilm of At. ferrooxidans (12). Various types of biofllm reactors have been reported for the biological generation of ferric for sulphidic mineral bioprocessing, such as packed bed, fluidised bed, trickle bed, rotating biological contactor, circulating bed, fixed bed and fixed film bioreactors (3,4). Recently, the high rate ferric sulphate generation by a Leptospirillum ferriphilum-dominated biofllm and the role of jarosite in biomass retainment in a fluidized bed reactor was. studied for chalcopyrite leaching in Finland (13). Various physico-chemical factors have been studied for the formation and maintenance of the bacterial film such as type of support matrix, bioreactor, aeration, ph (jarosite precipitation), concentration of ferrous and ferric iron, and number of iron oxidizers as inoculum used have been optimised to achieve high rate ferric sulphate generation in fixed fllm bioreactors. Selection of the carrier matrix is the key factor that depends on the EPS productivity of iron oxidizers and the capacity (porosity) of matrix to maintain attachment with the iron oxidizers (9). 118

4 Chapter: 4 :Fixed Film Colum11 Bioreactor Study Identification of pure culture of iron oxidizer from fixed film bioreactors. The chemolithotrophic mesoacidophilic microorganisms involve for the Iron biooxidation are mainly At. ferroox:idans and L. ferrooxidans. At. ferroox:idans was used in numerous early investigations in bioleaching of sulphidic minerals and it was the only known acidophilic iron-oxidizing bacterium until the description of L. ferroox:idans (14). The important role of iron-oxidizing L. ferroox:idans in metal sulphide biooxidation was slow to be recognized. It is not as easily enriched as At. ferroox:idans from sample containing both organism, growing more slowly than At. ferroox:idans in typical ferrous iron rich media. It is not easy to compare relative numbers of these two organisms in liquid and solid sample using conventional culturing techniques. The rum of this research work was to develop a fixed film bioreactor for high rate ferric sulphate production, to characterize biomass retention, to determine the phylogeny of the iron oxidizer and its identification. 4.2 Materials and Methods Iron oxidizers, medium and growth The extremophilic iron-oxidizing consortium developed at shake flask study was used as an inoculum to develop fixed biofilm of iron oxidizers in PVC and air-lift glass column reactors. Detailed configurations of two different type of fixed film column bioreactor are illustrated in Table Silverman and Lundgren (9K) medium (15) with 5, 10 and 20% ferrous sulphate as an energy source was prepared (Appendix A) and 119

5 used for the growth of iron oxidizers. Iron oxidation was studied at ph 1.5 and 1.0. System ph was adjusted with 10% v fv sulphuric acid. Table Detail configuration of two different type of f"lxed f'llm column bioreactors Conf"lgurations PVC Column reactor Air lift percolating column reactor Vessel material Polyvinyl chloride Glass Capacity (1) Working volume (1) Medium 9K 9K Medium volume (1) Inoculum (%) 20 to 0* 20 to 0* H:D ratio Inner diameter (em) Outer diameter (em) Aeration (lpm) ph Temperature ( C) 30±2 30±2 Inert support material Hollow glass tube (i) Glass beads (ii)acrylic seat pieces Size (mm) (i) 2-3 (ii) 4-5 Inner diameter (em) 0.5 Outer diameter (em) 0.7 Height (em) 25 Quantity 54 (pieces) 400 g (Weight) * In first five batches, 20% inoculum was reduced stepwise to 0%, after 6th cycle without external addition of inoculum iron was oxidized in the reactor. 120

6 4.2.3 Biofilm formation Two types of fixed film bioreactor were developed with the different support materials. 1 (A) Fixed fllm PVC column bioreactor (B) Fixed fllm air lift percolating column bioreactor The fixed fllm column reactor with the hollow glass tubes was filled with 9K medium containing of 50 gj-1 ferrous sulphate. Initially 20% v f v inoculum was added for ferrous oxidation for formation of biofilm. Once the biofilm formation was started, the inoculum addition was gradually reduced and after 5th cycle inoculum was not added Identification of bacterial culture from flxed fllm bioreactor The bacterial cells were harvested by centrifugation at 15,000 rpm for 35 minutes and washed with the ph 12 sterile water to reduce ferric iron precipitate (16). Monochrome and Gram's staining techniques were performed to characterize the morphology of iron oxidizers found 1n fixed biofilm reactor. The morphological characteristic of bacterial pure culture was also studied by Scanning Electron Microscopy (SEM). The pure culture was identified by 168 rdna sequencing technique at Banglore GENIE, (GeNie ) Banglore Analysis In fixed fllm iron oxidation study the samples were collected at regular interval. Analysis of ph, redox potential (mv) and soluble ferrous iron was done as shown in section

7 4.3 Results and Discussion Iron biooxidation rate in f"'tx:ed f"'tlm bioreactors The fixed film PVC column bioreactor and hollow glass tubes a support matrix used for the growth of the organisms and the developed biofilm on the matrix are shown in Photographs and Visual and microscopic investigations have indicated that wall growth is initiated by the attachment of the bacteria to the surface. The bacterial cells were multiplied until the surface was covered completely and the cell layer then build up simultaneously with the precipitation of iron. Karamanev et al have also proposed that the iron oxidizing bacterial cells are attached to the framework of the biofilm made up of jarosite (7). The bacteria themselves are not the only part of the structure of the biofilm. The attachment of the bacteria to the jarosite is probably due to the adsorption force (4). The brownish yellow colour micro colonies on the surface of the hollow tubes are due to the jarosite that adhere to the support material and iron oxidizing bacterial cells adsorbed to the surface of jarosite. The importance of jarosite precipitation on biofilm formation on glass beads as a support material was also reported (10). 122

8 Figure Fixed fllm PVC column bioreactor 123

9 J Chapter: 4 :Fixed Film Column Bioreactor Study Figure Fixed illm of iron oxidizing bacteria on hollow glass Tubes support matrix in PVC column bioreactor (a) Before biofilm formation (b) After biofilm formation 124

10 Enhancement in iron oxidation rate by flxed fllm PVC column bioreactor at 5% ferrous sulphate is shown in Graph Decrease in iron oxidation rate during flrst flve cycles was due to the gradual reduction of inoculum size. Once the biofllm was matured the iron oxidation rate increased from to gj-1.h-1 at 13th cycle of the iron oxidation. This developed flxed fllm bioreactor was further used to achieve higher iron oxidation rate. Ferrous biooxidation was studied for 85 cycles with 5% ferrous sulphate without external addition of inoculum. The iron oxidation rate increased with the increasing number of cycles. The highest iron oxidation rate of gj-1.h-1 was achieved at 85th cycle with 5% ferrous sulphate at ph 1.0. Oxygen availability IS a significant parameter for Iron biooxidation that could be due to highly aerobic nature of the microorganisms immobilized on hollow glass tubes. Airflow rate increased from 0.5 to 1.0 l.m-i showed a steep rise in iron oxidation rate that is shown in Graph The iron oxidation rate achieved was gj-i.h-i with 0.5 l.m-1 airflow rate at 80th cycle, whereas the iron oxidation rate increased to g.l-l.h-1 with 1.0 l.m-1 flow rate at 85th cycle in the bioreactor. Influence of addition of 10 and 20% ferrous sulphate on lor are depicted in Graph and respectively. The iron oxidation rate was and g.p.h-1 at 85th cycle with 5% ferrous sulphate and at 1st cycle with 10% ferrous sulphate respectively. The considerable decrease in iron oxidation rate could be due to the sudden exposer of biofllm to high concentration of ferrous sulphate. The maximum iron oxidation rate gj-i.h-i was achieved at 32nd cycle with 10% ferrous sulphate without external addition of the inoculum in the reactor. 125

11 Graph Enhancement of iron oxidation rate with 5% ferrous sulphate in flxed fllm bioreactor ;c: ' -bi 0.60 _; ~ e 0.40 ~.., ~ No. of cycles

12 Graph Enhancement of iron oxidation rate with 10% ferrous sulphate in ilxed illm bioreactor ~ ~... bi) ~ 0 ~ 1.40-; 1.20 ~ ~ J No of cycles

13 The ferrous biooxidation in fixed film bioreactor was further subjected to enhance at 20% ferrous sulphate. The iron oxidation rate of g.l-l.h-1 was obtained at initial stage (1st cycle) and was enhanced to as high as g.l-l.h-1 at 13th cycle with 20% ferrous sulphate in fixed film column bioreactor. The reaction time was also reduced from 38 to 24 h to oxidize >99% ferrous sulphate in the bioreactor. The developed fixed film bioreactor was achieved highest iron oxidation rate of 1.426, and g.l-l.h-1 at 5, 10 and 20% ferrous sulphate respectively without external addition of inoculum in the bioreactor. The developed fixed film oxidized 5, 10 and 20% ferrous sulphate even during 80th, 32nd and 13th cycle respectively without external addition of inoculum in the column bioreactor, which showed an efficient, stable and eco-friendly fixed biofilm formation for rapid ferrous biooxidation in the reactor. The developed fixed film was actively maintained for more than 250 cycles. The fixed film PVC column bioreactor was operated at ph 1.2. In the ph range of 1.2 to 1.5, the amount of ferric iron precipitation was less compared to high ph. The fixed film column bioreactor oxidised ferrous for more than 200 cycles with the efficient iron oxidation rate, whereas after 250 cycles, the capacity of working volume as well as iron oxidation rate were reduced from 500 to 250 ml and to g.l- 1.h- 1 respectively. This drastic reduction of iron oxidation rate and working volume could be due to jarosite formation on inner and outer surface of hollow glass tubes in the PVC column bioreactor. The mineralogically, the high amount of jarosite precipitation created the problem of clogging of interstitial space in the bioreactor after 250 cycles that suggested termination of further experiments in the fixed film PVC column bioreactor. 128

14 Chapter: 4 : Fixed Film Column Bioreactor Study Graph Enhancement of iron oxidation rate with 20% ferrous sulphate in f"lxed f"llm bioreactor ; _: ;;' ~ ,;... bd I ~ 1.20! _; ,---, No. of cycles 129

15 Figure illustrates the photograph of fixed fllm air-lift column bioreactor (a) Before and (b) After biofllm formation. In fixed film air-lift column bioreactor study, 10% ferrous sulphate was oxidized at ph 1.0 during all the experimental study to minimize the jarosite precipitation. Influence of different support material on iron oxidation rate was studied (Table 4.3.1) by using glass beads and acrylic pieces. The attachment of the iron oxidizers and jarosite precipitation was slower on glass beads as compare to acrylic pieces. The iron oxidation rates were increased with the increasing cycles in all three bioreactors. The iron oxidation rates were enhanced from as low as 0.450, and g.l-l.h-1 to as high as 1.731, and gj-l.h-1 in bioreactor A, B and C respectively without external addition of inoculum in the bioreactors. The highest iron oxidation rate of g.l-l.h-1 was achieved in bioreactor B which, was having glass beads as inert support material. The initial redox potential showed a significant variation during the study that could be due to increase in the ferric to ferrous ratio with the increasing number of cycles of iron biooxidation. The reaction time also reduced from 45 to 10 h for >99% ferrous sulphate oxidation. 130

16 Chapter: 4 :Fixed Film Colw1m Bioreactor Study Figure Fixed film air lift column bioreactor. (a) Before biofilm formation tj' ~I ~. ~ - ~ ~'* f\ ' -,. ~ -..,...-- i -~ - (b) After biofilm formation -.I

17 Cltapter: 4 :Fixed Film Column Bioreactor Study Table Enhancement of iron oxidation rate by air lift percolating nxed nlm bioreactors Bioreactor A Bioreactor B Bioreactor C lor Time mv lor Time mv lor Time mv g.l-1h-1 (h) g.j-lh-1 (h) g.l-1h-1 (h)

18 4.3.2 Identification of pure culture of iron oxidizer from f"lxed fllm bioreactors In ferrous biooxidation by fixed film column bioreactor study, iron oxidizer was collected from the developed fixed film column and identified. The Scanning Electron Micrograph illustrates the typical spiral shape of strain of a Leptospirillum ferrooxidans from fixed film PVC column bioreactor (Fig 4.3.5) Leptospirillum ferrooxidans was identified by 168 rdna sequencing technique as a pure culture of iron oxidizers from fixed film column bioreactor, while Acidithiobacillus ferrooxi.dans was not detected. Cells of Leptospirillum ferrooxi.dans were gram negative, long, curved rod or spirilla, motile by means of single polar flagellum and size was measured as 0.3 to 0.6 J.lffi wide and 0.9 to 4.0 J.lm long. Young cells of L. ferrooxi.dans were vibrio shape, but the culture older than 2 days, cells were mostly spiral shape with two to five turns (Fig 4.3.4).. Growth was aerobic and chemolithotrophic with ferrous iron or pyrite as the energy source but growth was not found with sulphur. Isolate of L. ferrooxi.dans grew at ph 1.0 to 1.5 and temperature 30 to 37 oc. On the basis of 16 S rdna sequences (Fig 4.3.6) the alignment results of similarity matrix showed 96% similarity of Leptospirillum ferrooxi.dans sequence with the sequence of RDP database (Fig ). Phylogenetic relationship based on 168 rdna sequence data, Leptospirillum ferrooxi.dans has been placed with the division Nitrospira, and Nitrospira marina has been used as the outgroup (Fig ). Distance matrix of L. ferrooxi.dans with other cloned strains also illustrated in Fig

19 Chapter: 4 : Fixed Film Column Bioreactor Study Figure Monochrome staining of Leptospirillum ferrooxidans.,~_ :. ' ' \ -l ' ' "'-' - 134

20 Chapter: 4 :Fixed Film Colum11 Bioreactor Study Figure Scanning Electron Microscope illustrating the typical spiral shape of Leptospirillumferrooxidans from the developed ilxed il.lm column bioreactor for ferrous biooxidation. --- ~~--~---,:_. :..,.~.,..~... -.,!';... ~~ <>..:.t. +tt 135

21 Chapter: 4 : Fixed Film Colum11 Bioreactor Study Figure rdna sequencing data of Leptospirillum ferrooxidans >Extracted 16 rdna Data CCGGAGGTGAAGGGGAGCATCCCCCGGTAGGGTGGCAAACGGGTGAGTAAG ACATGGGTGATCTGCCCTGGAGATGGGGATATCCCTCCGAAAGGGGGGGCAA TACCGAATAGTATCCGGTTCCGTGAAGGGGGCCGGGGAAAGGGAGGCCTCTG GTACAAGCTTCCGCTCCTGGATGAGCCCATGGCCCATCAGCTAGTTGGTAGG GTAAAGGCCTACCAAGGCGACGACGGGTAGCTGGTCTGAGAGGACAACCAG CCACACTGGCACTGAGACACGGGCCAGACTCCTACGGGAGGCAGCAGTGAG GAATATTGCGCAATGGGGGCAACCCTGACGCAGCAACGCCGCGTGTGGGAA GAAGGCTTTCGGGTTGTAAACCACTTTTGCCCGGGACGAAAGGGGGGACCTG AATAAGGTTGCCCGATGACGGTACCGGGAGAATAAGCCACGGCTAACTCTGT GCCAGCAGCCGCGGTAAGACAGAGGTGGCAAGCGTTGTTCGGAGTTACTGGG CGTAAAGAGTCTGTAGGTGGTCTGTCAAGTCTTTGGTGAAAGGCCGTGGCTT AACCATGGGAATGCCAAAGAGACTGGCAGACTGGAGGCTGGGAGAGGGAAG CGGAATTTCTGGTGTAGCGGTGAAATGCGTAGATATCAGAAGGAAGGCGGGT GGCGAAGGCGGCTTCCTGGAACAGACCTGACACTGAGAGACGAAAGCGTGG GGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGGGTAC TAAGTGTGGGAGGGTTAAACCTCCCGTGCCGCAGCCAACGCAGTAAGTACCC CGCCTGGGGAGTACGGCCGCAAGGTTGAAACTCAAAGGAATTGACGGGGGC CCGCACAAGCGGTGGTGCATGTGGTTTAATTCGACGCAACGCGAAGAACCTT ACCTGGGCTTGACATGCCGCGAGTAGGAAACCGAAAGGGGACCGACCGGTT CAGTCCGGAAGCGGAACAGGTGCTGCATGGCTGTCGTCAGCTCGTGCCGTGA GGTGTTGGGTTCAGTCCCGCAACGAGCGCAACCCTCGCCCTCTGTTGCCACCG GGTCATGCCGGGCACTCTGAGGGGACTGCCAGCGACAAGTTGGAGGAAGGA GAGGATGACGTCAAGTCATCATGGCCCTTATGCCCAGGGCCCACACGTGCA 136

22 Chapter: 4 : Fixed Film Column Bioreactor Study Figure Distance matrix of Leptospirillumferrooxidans with related cloned strains on the basis of 16 S rdna sequence Distance Matrix s AF Lpp.ferro env.cos env.cos Nsp.marin env.cos env.cos Nsp.marina Lpp.ferro Lpp.sp

23 Chapter : 4 : Fixed Film Column Bioreactor Study Figure Similarity matrix of Leptospirillumferrooxidans and related cloned strains of RDP sequence database Alignment YleW 10 Alignment results!l. ;. : J 16sAiigned with a similarity value of 0.96 in the RDP database. Neighbors: env.cos7 Lpp.ferro2 Lpp.sp env.cos4 env.c0s17 AF Lpp.ferro3 env.cos62 Nsp.marin2 Nsp.marina. RDP Sequences elect RDP Sequences I Alignment YHM P" (b h"'cmj I P" It II P" 1:: I I P" It II P" It I I P" ''= I I P" II I I P" 1(: ::::: 1 I P" II: I I P" IC I I RDPID Key: env.cos7 donecos7 L~~.ferro2.--lt====ti==i::::;-- mostly bases ( ~data le) I t t t I + missing data mostly gaps Sequence description Leptospirillum ferrooxidans ~ Leptospirillum sp. DSM 2391 env.c0s4 donecos4 env.cos17 done cos17 AF done TRA1-10 L~l2.ferro3 Leptospirillum ferrooxidans env.cos62 done c0s62 Ns~.marin2 Nitrospira marina Ns~.marinaNitrospira marina str. Nb

24 Chapter: 4 :Fixed Film Colum11 Bioreactor Study Figure Phylogenetic relationship of Leptospirillum ferrooxidans and relevant species of cloned database - env.cos62 AF lpp.ferro3 r{~v.cos17 Lpp.sp Lpp.ferro2 env.c0s4,.env.cos7 ~-16s,Nsp.marin2 1 Nsp.marina Scale: ~ Q1 139

25 The importance of L. ferrooxidans in bioleaching is that in a mixed culture of L. ferrooxidans and At. thiooxidans, L ferrooxidans could oxidized pyrite faster than At. ferrooxidans (17). The property of L. ferrooxidans to attach sulphide mineral, its high affinity for ferrous iron (Km 0.25 mm compare to 1.34 mm in At. ferrooxidans) and its low sensitivity to inhibition by ferric iron (Ki 42.8 mm compare to 3.10 mm in At. ferrooxidans) (18), is an additional evidence for the significance of L. ferrooxidans in bioleaching. Evaluations of field samples and laboratory ore percolation studied led to the conclusion that L. ferrooxidans could be as significant as At. ferrooxidans in bioleaching ( 19). Molecular biology techniques showed that Leptospirillum was the most dominating iron-oxidizing bacterium in continuous stirred tank reactors (CSTRs}, where gold bearing arsenopyrite (FeAsS) and copper containing concentrate were biooxidized at 40 oc and ph 1.6 (20, 21). Similarly, immunofluorescence analysis of the primary stage tanks. of commercial biooxidation plant at Sao Bento, Brazil and Fairview, South Africa indicated the numerical dominance of Leptospirillum over At. ferrooxidans (22). The dominance of Leptospirillum species over At. ferrooxidans also occurs in column bioleaching of copper sulphide (23, 24). In the absence of added 1ron L. ferrooxidans was dominant and At. ferrooxidans was not detected. However, when ferrous iron was added At. ferrooxidans was dominant, addition of ferrous iron to leach solutions resulted in growth of predominantly At. ferrooxidans. At. ferrooxidans is capable of growth on ferrous iron at redox potentials upto +800 mv, whereas L. ferrooxidans is capable of oxidation at redox potentials of closer to +950 mv. The ability of At. ferrooxidans to oxidized ferrous iron is severely inhibited by the presence of ferric iron, whereas the iron oxidizing ability of 140

26 Leptospirillum is relatively unaffected (25). Other reasons for the dominance of Leptospiri.llum is that these bacteria are some what more tolerant of temperature as high as 40 oc and ph values of than At. ferrooxidans. In a microbial community genome-sequencing project, the assembly of an almost complete genome of Leptospirillum group II, thought to be the same as L. ferriphilum. This genome contain a red cytochrome presumably the same as the red cytochrome previously identified in L. ferrooxidans ( 19, 25). Leptospiri.llum ferrooxidans has been exploited for various applications other than metal bioextraction. L. ferrooxidans is strict iron oxidizing acidophiles that considered as one of the mru.n responsible agent for maintaining the ph balance and hence the physicochemical properties of the ecosystem. L ferrooxidans is also very important because of its capacity to extract heavy metals from minerals and contaminated soils and because it is directly involved in acid mine drainage. In addition, L. ferrooxidans is of great interest of astrobiology, because its metabolism could help to understand some relevant aspects of origin and evolution of life on earth (26). Its nutrient requirements are very simple as C02 (carbon source), 02 (respiration), NH+4 (nitrogen source), mineral like pyrite to obtained energy and some additional salts. 141

27 Chapter: 4 :Fixed Film Column Bioreactor Shtdy 4.4 References 1. Carranza, F., Palencia, I., Romero, R. (1997). Silver catalyzed IBES process: application to a Spanish copper-zinc sulphide concentrate, Hydrometallurgy, 44: Olem, H., Unz, R. F. (1977). Acid mine drainage treatment with rotating biological contactor. Biotechnol. Bioeng., 19: Grishin, S. I., Tuovinen, 0. H. (1988). Fast kinetics of Fe+ 2 oxidation in Packed-Bed Reactors, Appl. Environ. Microbial., 54: Jensen, A. B., Webb, C. (1.995). Ferrous sulphate oxidation using Thiobacillus ferrooxidans: a Review. Proc. Biochem., 30: Porro, S., Pogliani, C., Donati, E., Tedesco, P. (1993). Use of packed bed bioreactors: Application to ores bioleaching. Biotechnol. Lett., 15: Nakamura, T., Noike, K., Metsumoto, J. (1986). Effect of operational conditions on biological Fe+2 oxidation with rotating biological contactor. Water Res., 20: Karamanev, D. G., Nikolov, L. N. (1988). Influence of some physicochemical parameters on bacterial activity of biofilm: ferrous iron oxidation by Thiobacillus ferrooxidans, Biotechnol. Bioeng., 31: Armentia, H., Webb, C. (1992). Ferrous sulphate oxidation us1ng Thiobacillus ferrooxidans cells immobilised 1n polyurethane foam support particles. Appl. Microbial. Biotechnol., 36: Wichlacz, P. L., Unz, R. F. (1981). Fixed film bioreactor of ferrous iron oxidation. Biotechnol. Bioeng. Symp., 11: Pogliani, C., Donati, E. (2000). Immobilisation of Thiobacillus ferrooxidans: importance of jarosite precipitation. Proc. Biochem., 35:

28 Chapter: 4 : Fixed Film Column Bioreador Study 11. Ferraera, I., Massana, R., Casamayor, E., Balague, V., Sanchez, 0., Pedros- Alio, C., Mas, J. (2004). High- diversity biofilm for the oxidation of sulphide - containing effluents. Appl. Microbial. Biotechnol., 64: Mesa, M. M., Macias, M. and Cantero, D. (2002). Biological iron oxidation by Acidithiobacillus ferrooxidans in a packed-bed bioreactor, Chem Biochem. Eng., 16: Kinnunen, P. H., Puhakka. J. (2004). High-rate ferric sulphate generation by a Leptospirillum ferriphilum-dominated biofilm and the role of jarosite in biomass retainment In a fluidised-bed reactor. Biotechnol. Bioeng., 85: Markosyan, G. E. (1972). A new iron oxidizing bacterium Leptospirillumferrooxidans nov. ben. Nov. sp. (in Russian) Biol. J. Armenia., 25: Silverman, M. P., Lundgren, D. G. (1959). Studies on the chemoautotrophic iron bacterium Ferrobacillus ferrooxidans I - An improved medium and harvesting procedure for securing high cell yields, J. Bacterial., 77: Dave, S. R. (1980). Microbiology and bioleaching studies on metallurgical bacteria cultured from Indian sulphidic mine water, Ph.D. Thesis. The University of Mysore, Mysore, India. 17. Norris, P. R., Kelley, D. P. (1978). Dissolution of pyrite (FeS 2 ) by pure and mixed culture of some acidophilic bacteria. FEMS Microbial. Lett., 4: Norris, P. R., Barr, D. W., Hinson, D. (1988). Iron and mineral oxidation by acidophilic bacteria: affinities for iron and attachment to pyrite, In: Norris P.R., Kelley, D.P (Eds), Biohydrometallurgy proceedings of the International symposium Science and Technology Letters, Kew, Survey, UK Sand, W. Rohde, K., Sobotke, B., Zennec, C. (1992). Evaluation of Leptospirillum ferrooxidans for leaching. Appl. Environ. Microbial., 58:

29 20. Coram, N. J., Rawlings, D. E. (2002). Molecular relationship between two groups of the genus Leptospirillum and finding that Leptospirillum ferriphililum sp. nov. dominates South African commercial biooxidation tanks that operate at 40 C. Appl. Environ. MicrobiaL, 68: Rawlings, D. E., Tributsch, H., Hansford, G. S. (1999). Reason why Leptospirillum like species rather than Thiobacillus ferrooxidans are the dominant iron oxidizing bacteria in many commercial processes for the biooxidation of pyrite and related ores. Microbiology., 145: Dew, D. W., Lawson, E. N., Broadhurst, J. L. (1997). The BIOX process for biooxidation of gold bearing ores or concentrate, In: Rawling, D.E (ed) Biomining: theory, microbes and industrial processes, Springer, Berlin, DeWulf-Durand, P., Brylant, L. J., Sly, L. I. (1997). PCRmediated detection of acidophilic, bioleaching-associated bacteria. Appl. Environ. Microbial., 63: Pizarro, J.,. Jedlicki, E., Orelanna, 0., Romero, J., Espejo, R. T. (1996). Bacterial population in samples of bioleached copper ore as revealed by analysis of DNA obtained before and after cultivation. Appl. Environ. Microbial., 62: Rawlings, D. E. (2005). Characteristics and adaptability of iron and sulphur oxidizing microorganisms used for the recovery of metals from minerals and their concentrates. Microbial Cell Factories, 4: Cairns-Smith, A., Hall, A., Russell, M. (1992). In Origin of Life and Evolution of the Biosphere. Kluwer, Dordrecht, The Netherlands,