Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;
|
|
- Aron Ryan
- 5 years ago
- Views:
Transcription
1 Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq Green Master Mix (Promega). Quantitative RT-PCR experiments were conducted using Taqman gene expression assays (Life Technologies) with the following probes: HOXD1 (Hs _s1), HOXD3 (Hs _m1), HOXD4 (Hs _g1), HOXD13 (Hs _m1). Primer sequences for non-quantitative RT-PCR are listed below. RT-PCR Primer Sequences Gene Forward primer sequence, 5 to 3 Reverse primer sequence, 5 to 3 HOXA1 TCCTGGAATACCCCATACTTAGC GCACGACTGGAAAGTTGTAATCC HOXA2 GCACGACTGGAAAGTTGTAATCC ACCCCGAAGGGTGGAGATT HOXB5 ACCCCGAAGGGTGGAGATT CGGAGTCCTCAAGGCTTTTACAT HOXB6 CGGAGTCCTCAAGGCTTTTACAT AAC TCC TCG GGG CGT TAT HOXB9 AACTCCTCGGGGCGTTAT CATCCCATTGTAATTGTAGCCGT HOXB13 CATCCCATTGTAATTGTAGCCGT TCCTATTTCGTGAACTCCACCT HOXC9 TCCTATTTCGTGAACTCCACCT GCGGGGTAATGTCTCAGCG HOXC10 GCGGGGTAATGTCTCAGCG CCATTTCTGGGACGCTTAGCA HOXC11 CCATTTCTGGGACGCTTAGCA TGTAAGGGTGGTAGACGGACG HOXC13 TGTAAGGGTGGTAGACGGACG CCAGTTACCTGGACGTGTCTG HOXD9 CCAGTTACCTGGACGTGTCTG GGACCTGGTGGGTTCTGTTC HOXD10 GGACCTGGTGGGTTCTGTTC ACTCGCTCATCTCTCACGACA HOXD11 ACTCGCTCATCTCTCACGACA GACGGAAAATCGCTACAGTCC HOXD13 GACGGAAAATCGCTACAGTCC CGCCGAACATCTGGAATCG 1
2 GAPDH TGCACCACCAACTCGTTAGC GGCATGGACTGTGGTCATGAG 18S GCAATTATTCCCCATGAACGA GGCCTCACTAAACCATCCAAT ChIP-PCR Histone Modifications Cells were fixed on the dish at room temperature for 10 min in growth medium containing 1% formaldehyde. To quench the fixation, 2M glycine was added to a final concentration of 0.18M and allowed 5 min incubation at room temperature. Plates were rinsed 3x with cold PBS and then scraped on ice into PBS containing protease and phosphatase inhibitors (Roche). Fixed cells were pelleted via centrifugation at 4 C, 4000 x g, for 10 min. Pellets were then resuspended in 150 µl SDS lysis buffer (50mM tris-hcl ph 8.1, 10mM EDTA ph 8, and 10% SDS) containing protease and phosphatase inhibitors and incubated on ice min with frequent vortexing. Lysates were sonicated on wet ice using a Qsonica cup horn sonicator, 100% amplitude, second pulses with 1 min rest in between. DNA fragments were in the bp range. Insoluble components were pelleted via centrifugation, 14,200 x g, 4 C for 10 min. Supernatant was transferred to fresh microcentrifuge tubes and diluted 10-fold in dilution buffer (16.7 mm tris-hcl ph 8.1, 167 mm NaCL, 1.2 mm EDTA ph 8, 1.1% triton). Samples were then pre-cleared for 2 hrs, rotating at 4 C using 30µL of protein G dynabead slurry (Invitrogen). Prior to the pre-clearing step, beads were blocked in dilution buffer containing 5 mg/ml BSA + 10µg/mL glycogen for 2 hrs at 4 C, washed and resuspended in fresh dilution buffer. Pre-cleared samples were then transferred to fresh tubes and 1% of each sample (15µL) was frozen at -20 C for later analysis of input. The remaining sample was incubated overnight, rotating at 4 C with 2 µg antibody or control IgG. The next day, antibody-dna complexes were captured using 50 µl of protein G dynabead slurry, rotating at 4 C for 2 hrs. Beads were then washed once with each of the 2
3 following buffers in order for 5 4 C: Low Salt wash (150 mm NaCl, 0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris (ph 8.0)), High Salt wash (500 mm NaCl, 0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris (ph 8.0)), LiCl wash (250 mm LiCl, 1% Deoxycholate, 1% NP-40, 1 mm EDTA, 10 mm Tris (ph 8.0)), TE wash (10 mm Tris (ph 8.0), 1 mm EDTA). Antibody/DNA complexes were eluted by adding freshly made 100µL elution buffer (1%SDS, 0.1M NaHCO 3 ) to the washed beads, followed by vortexing at a medium setting at room temp, 15 min. Supernatant was then transferred to a new 1.5 ml tube and the process repeated (200µL final volume). Elution buffer (185µL) was added to the15µl 1% Input samples. 8µL 5M NaCl and 4µL RNaseA (10mg/mL) were then added to all samples, followed by crosslink reversal 5-6 hrs at 65 C. To digest protein, 4µL 0.5M EDTA, 8µL 1M Tris-HCl (ph 6.5), 4µL Proteinase K (10mg/mL) were added to each sample and incubated 45 C. DNA was recovered using the QIAquick PCR Purification Kit (Qiagen), with a final elution volume of 50µL. Target sequences were amplified via qpcr using itaq SYBR green (Bio-Rad) with 2µL DNA per reaction. Assays were performed in triplicate using the LightCycler 480 System (Roche). Data were analyzed using the percent input method according to the following equation: Percent input = 100*2^(Average Ct Input Average Ct IP). ChIP-PCR FLI1 ChIP was performed using the MAGnify TM Chromatin Immunoprecipitation System (Invitrogen, Groningen, The Netherlands) according to the manufacturer s instructions with minor modifications. Cells were crosslinked with 1% formaldehyde at room temperature for 13 minutes; the reaction was stopped with 125mM Glycine for 7min. The cells were then sheared with a Bioruptor UCD200 5 times 7 minutes of alternating 30sec sonication and 30 sec break to achieve an average shearing size of 600bp. Incubation times for antibody coupling and binding chromatin to the beads was doubled and washing steps after chromatin 3
4 incubation with the Ab coupled beads were extended to 20min each. An additional washing step between IP Buffer1 and 2 was applied using the following Buffer: 0.1% SDS, 1% Triton X- 100, 2mM EDTA, 20mMTris HCl, 500mM NaCl, ph8,1. Antibodies and primers used for ChIP-PCR studies are detailed below. Primer sequences for HOXD11.12PRE (1) and for ATAD2 (2), were taken from the published literature. ChIP-qPCR antibodies Antibody Supplier/catalog number Quantity for ChIP Anti-Trimethyl Histone Millipore µg H3(Lys27) H3K4me3 Rabbit anti- Human Anti-RNA Polymerase II clone CTD4H8 Invitrogen µg Millipore µg FLI1 MyBioSource MBS µl ChIP PCR primers Gene Forward primer sequence (5 to 3 ) Reverse primer sequence, (5 to 3 ) HOXD11 TTGGCGAGCGTTGATATAGA CTTGGGCCAGGATCAACTAA HOXD13 CAAGGGGCAGGAGAGGGG GAAGTTCAGGTTGGGAGGGG Supplemental Methods References 4
5 1. Woo CJ, Kharchenko PV, Daheron L, Park PJ, Kingston RE. A region of the human HOXD cluster that confers polycomb- group responsiveness. Cell Jan 8;140(1): PubMed PMID: Pubmed Central PMCID: Epub 2010/01/21. eng. 2. Bilke S, Schwentner R, Yang F, Kauer M, Jug G, Walker RL, et al. Oncogenic ETS fusions deregulate E2F3 target genes in Ewing sarcoma and prostate cancer. Genome Res Nov;23(11): PubMed PMID: Pubmed Central PMCID: Epub 2013/08/14. eng. 5
1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationHiChIP Protocol Mumbach et al. (CHANG), p. 1 Chang Lab, Stanford University. HiChIP Protocol
HiChIP Protocol Mumbach et al. (CHANG), p. 1 HiChIP Protocol Citation: Mumbach et. al., HiChIP: Efficient and sensitive analysis of protein-directed genome architecture. Nature Methods (2016). Cell Crosslinking
More informationChIP-seq Protocol for RNA-Binding Proteins
ChIP-seq: Cells were grown according to the approved ENCODE cell culture protocols. Cells were fixed in 1% formaldehyde and resuspended in lysis buffer. Chromatin was sheared to 100-500 bp using a Branson
More informationChIPmentation CeMM v1.14 (September 2016)
ChIPmentation CeMM v1.14 (September 2016) This protocol works well for efficient histone modification and transcription factor antibodies. For less efficient antibodies sonication different sonication-,
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationProduct Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg
Product Datasheet Histone H4 [Dimethyl Lys20] Antibody NB21-2089SS Unit Size: 0.025 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationChIP protocol Chromatin fragmentation using the Covaris S2 sonicator by Ethan Ford (version 12/1/11) X- link Cells
ChIP protocol Chromatin fragmentation using the Covaris S2 sonicator by Ethan Ford (version 12/1/11) X- link Cells 1. Grow six 15 cm plates of HeLa cells to 90% confluency. 2. Remove media and add wash
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes
Cell, Volume 135 Supplemental Data Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Andrzej T. Wierzbicki, Jeremy R. Haag, and
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationChromatin Immunoprecipitation (ChIP)
de Lange Lab Chromatin Immunoprecipitation (ChIP) Required Solutions IP Wash A 0.1% SDS 1% Triton X-100 2 mm EDTA ph 8.0 20 mm Tris-HCl ph 8.0 150 mm NaCl 1 mm PMSF 1 µg/ml Leupeptin 1 µg/ml Aprotinin
More informationLuban Lab ChIP-seq protocol
Luban Lab ChIP-seq protocol (updated by Anetta Nowosielska, December 2016) University of Massachusetts Medical School Program in Molecular Medicine 373 Plantation Street, Biotech 2 suite 319 Worcester,
More informationChromatin Immunoprecipitation (ChIP) Assay*
Chromatin Immunoprecipitation (ChIP) Assay* Chromatin Immunoprecipitation (ChIP) assays are used to evaluate the association of proteins with specific DNA regions. The technique involves crosslinking of
More informationChromatin Immunoprecipitation Approaches to Determine Co-transcriptional Nature of Splicing
Chapter 23 Chromatin Immunoprecipitation Approaches to Determine Co-transcriptional Nature of Splicing Nicole I. Bieberstein, Korinna Straube, and Karla M. Neugebauer Abstract Chromatin immunoprecipitation
More informationSUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans
SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton
More informationLike use other ChIP kits, before handle ChIP assay please choose a good antibody suitable for precipitation the crosslinked protein / DNA complexes.
ChIP Assay Kit Cat:RK20100 Like use other ChIP kits, before handle ChIP assay please choose a good antibody suitable for precipitation the crosslinked protein / DNA complexes. Manufactured by Global Headquarters
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationrev. 05/31/12 Box 2 contains the following buffers/reagents:
Store at RT, 4 C, and 20 C #9002 SimpleChIP Enzymatic Chromatin IP Kit (Agarose Beads) 3 n 1 Kit (30 Immunoprecipitations) For Research Use Only. Not For Use In Diagnostic Procedures. rev. 05/31/12 Orders
More informationKit Components. 1M NaHCO 3, Catalog # Lot # One vial containing 500µl of 1M NaHCO 3.
Certificate of Analysis 48 Barn Road Lake Placid, NY 12946 Technical Support: T: 800 548-7853 F: 518 523-4513 email: techserv@upstate.com Sales Department: T: 800 233-3991 F: 781 890-7738 Licensing Dept.:
More informationMeDIP-seq library construction protocol v2 Costello Lab June Notes:
MeDIP-seq library construction protocol v2 Costello Lab June 2010 Notes: A. For all Qiagen gel extraction steps (Qiaquick and MinElute), melt gel slice at 37º C instead of 50º (see Quail et al 2008 Nature
More informationZebrafish ChIP-array protocol: version 1 August 5 th 2005
Zebrafish ChIP-array protocol: version 1 August 5 th 2005 PROCEDURE I. Fixation of embryos 1. Dechorionate embryos (Pronase treatment) 2. Fix embryos, 15 mins in 1.85% formaldehyde in Embryo medium, RT,
More informationProduct Datasheet. Histone H3 [Trimethyl Lys4] Antibody NB SS. Unit Size: mg
Product Datasheet Histone H3 [Trimethyl Lys4] Antibody NB21-1023SS Unit Size: 0.025 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 1 Publications: 3
More informationProduct Datasheet. Histone H3 [ac Lys4] Antibody NB SS. Unit Size: mg
Product Datasheet Histone H3 [ac Lys4] Antibody NB21-1024SS Unit Size: 0.025 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 1 Publications: 2 Protocols,
More informationEPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity
More informationProduct Datasheet. Histone H3 [Trimethyl Lys9] Antibody NB Unit Size: 0.05 mg
Product Datasheet Histone H3 [Trimethyl Lys9] Antibody NB21-1073 Unit Size: 0.05 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 2 Protocols, Publications,
More informationChIP-chip protocol adapted for the mod-encode project
ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human
More informationChIP-Adembeads (cat #04242/04342)
ChIP-Adem-Kit (cat # 04243/04343) ChIP-Adembeads (cat #04242/04342) Instruction manual for magnetic Chromatin Immunoprecipitation Ademtech SA Bioparc BioGalien 27, allée Charles Darwin 33600 PESSAC France
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationSupplementary Figure 1. HiChIP provides confident 1D factor binding information.
Supplementary Figure 1 HiChIP provides confident 1D factor binding information. a, Reads supporting contacts called using the Mango pipeline 19 for GM12878 Smc1a HiChIP and GM12878 CTCF Advanced ChIA-PET
More informationrev. 06/18/18 RPL30 MyoD1
Store at RT, 4 C, and 20 C #9002 SimpleChIP Enzymatic Chromatin IP Kit (Agarose Beads) 3 n 1 Kit (30 Immunoprecipitations) For Research Use Only. Not For Use In Diagnostic Procedures. rev. 06/18/18 Orders
More informationTissue Acetyl-Histone H4 ChIP Kit
Tissue Acetyl-Histone H4 ChIP Kit Catalog Number KA0672 48 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationRNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu *
RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * School of Biomedical Sciences, Thomas Jefferson University, Philadelphia, USA *For correspondence:
More informationChromatin Immunoprecipitation (ChIPs) Protocol for Tissues(Farnham Lab)
Chromatin Immunoprecipitation (ChIPs) Protocol for Tissues(Farnham Lab) This protocol is based upon protocols from Mark Biggin, Dave Allis and Richard Treisman plus a fair amount of trial and error. We
More informationEZ-Zyme Chromatin Prep Kit
Instruction Manual for EZ-Zyme Chromatin Prep Kit Catalog # 17 375 Sufficient reagents for 22 enzymatic chromatin preparations per kit. Contents Page I. INTRODUCTION 2 II. EZ-Zyme KIT COMPONENTS 3 A. Provided
More informationChIP-chip Using Affymetrix GeneChip S. cerevisiae Tiling 1.0R Arrays Rebekka Sprouse
ChIP-chip Using Affymetrix GeneChip S. cerevisiae Tiling 1.0R Arrays Rebekka Sprouse Making the WCE: 1. Grow 100 ml culture in YPD overnight at 30 o C to an OD600 ~1.0. (If working with ts alleles, add
More informationChromatin Immunoprecipitation (ChIP) Assay (PROT11)
Chromatin Immunoprecipitation (ChIP) Assay (PROT11) Antigone Kouskouti & Irene Kyrmizi Institute of Molecular Biology and Biotechnology FORTH 1527 Vassilika Vouton 711 10, Heraklion, Crete, Greece Email
More information1. Collect worms in a 50ml tube. Spin and wait until worms are collected at the bottom. Transfer sample to a 15ml tube and wash with M9 until clean.
Worm Collection 1. Collect worms in a 50ml tube. Spin and wait until worms are collected at the bottom. Transfer sample to a 15ml tube and wash with M9 until clean. 2. Transfer sample to a 50ml conical.
More informationCan be prepared in advance and stored at -80º
Chromatin Immunoprecipitation (ChIP) Assay Protocol Can be prepared in advance and stored at -80º Wash Staph A Cells: 1. Resuspend 1 gram of lyophilized Staph A cells (Pansorbin, Calbiochem Cat#507862)
More informationEpiQuik Methyl-CpG Binding Domain Protein 2 ChIP Kit
EpiQuik Methyl-CpG Binding Domain Protein 2 ChIP Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Methyl-CpG Binding Domain Protein 2 ChIP Kit is suitable for combining the
More informationSupplementary Information
Supplementary Information Table of contents: Pages: Supplementary Methods 2-3 Supplementary Figure 1 4 Supplementary Figure 2 5 Supplementary Figure 3 6 Supplementary Figure 4 7 Supplementary Figure 5
More informationRen Lab ENCODE in situ HiC Protocol for Tissue
Ren Lab ENCODE in situ HiC Protocol for Tissue Pulverization, Crosslinking of Tissue Note: Ensure the samples are kept frozen on dry ice throughout pulverization. 1. Pour liquid nitrogen into a mortar
More informationEpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit
EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit is suitable for
More informationrev. 10/19/12 Box 2 contains the following buffers/reagents:
Store at RT, 4 C, and 20 C #9004 SimpleChIP Plus Enzymatic Chromatin IP Kit (Agarose Beads) 3 n 1 Kit (30 Immunoprecipitations) rev. 10/19/12 Orders n 877-616-CELL (2355) orders@cellsignal.com Support
More informationDiagenode ideal ChIP-seq kit for Histones for 100 reactions (C )
Meyer 3310 Department of Animal Science, UC Davis Standard Protocol Title: chip-seq Protocol for animal tissues Doc. No HZ-SP-07 PI Dr. Zhou Date June 5 2018 Preparation: Diagenode ideal ChIP-seq kit for
More informationChIP DNA Clean & Concentrator Catalog Nos. D5201 & D5205
Page 0 INSTRUCTION MANUAL ChIP DNA Clean & Concentrator Catalog Nos. D5201 & D5205 Highlights Quick (2 minute) recovery of ultra-pure DNA from chromatin immunoprecipitation (ChIP) assays, cell lysates,
More informationChromaFlash One-Step Magnetic ChIP Kit
ChromaFlash One-Step Magnetic ChIP Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The ChromaFlash One-Step Magnetic ChIP Kit is suitable for selective enrichment of a chromatin
More information#9005. SimpleChIP Plus Enzymatic Chromatin IP Kit (Magnetic Beads) n 1 Kit. (30 Immunoprecipitations) Store at RT, 4 C, and 20 C
Store at RT, 4 C, and 20 C #9005 SimpleChIP Plus Enzymatic Chromatin IP Kit (Magnetic Beads) 3 n 1 Kit (30 Immunoprecipitations) rev. 09/05/17 Orders n 877-616-CELL (2355) orders@cellsignal.com Support
More information#9003. SimpleChIP Enzymatic Chromatin IP Kit (Magnetic Beads) n 1 Kit. (30 Immunoprecipitations) and 20 C. Store at 4 C, RT
Store at 4 C, RT and 20 C #9003 SimpleChIP Enzymatic Chromatin IP Kit (Magnetic Beads) 3 n 1 Kit (30 Immunoprecipitations) For Research Use Only. Not For Use In Diagnostic Procedures. rev. 06/15/18 Orders
More informationArf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
More informationEPIGENTEK. ChromaFlash Chromatin Extraction Kit. Base Catalog # P-2001 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE KIT CONTENTS
ChromaFlash Chromatin Extraction Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The ChromaFlash Chromatin Extraction Kit is suitable for isolating chromatin or DNA-protein complex
More informationCell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)
Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer. 1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose
More informationEpiSeeker ChIP Kit Histone H4 (acetyl) Tissue
ab117151 EpiSeeker ChIP Kit Histone H4 (acetyl) Tissue Instructions for Use For successful chromatin immunoprecipitation for acetyl-histone H4 from mammalian tissues This product is for research use only
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationRheB Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table
More informationDepartment of Biochemistry and Molecular Biophysics, Columbia University, New York, USA
RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans Germano Cecere * and Alla Grishok Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA * For correspondence:
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationMyers Lab ChIP-seq Protocol, v and v Modified April 22, 2011
Myers Lab ChIP-seq Protocol, v042211.1 and v042211.2 Modified April 22, 2011 Contact information: Dr. Florencia Pauli HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone:
More informationMammalian Chromatin Extraction Kit
Mammalian Chromatin Extraction Kit Catalog Number KA3925 100 extractions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3
More information# SimpleChIP Plus Sonication Chromatin IP Kit. 1 Kit (24 immunoprecipitations)
SimpleChIP Plus Sonication Chromatin IP Kit #56383 1 Kit (24 immunoprecipitations) rev. 05/14/18 Support: +1-978-867-2388 (U.S.) www.cellsignal.com/support Orders: 877-616-2355 (U.S.) orders@cellsignal.com
More informationChIP Capture Sequencing (ChIP-CapSeq): A Protocol for Targeted Sequencing of Immunoprecipitated DNA
Sequencing Technical Note 2016 ChIP Capture Sequencing (): A Protocol for Targeted Sequencing of Immunoprecipitated DNA Jim Blackburn, PhD Ira Deveson Tim Mercer, PhD Garvan Institute of Medical Research,
More informationChromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average
Chromatin immunoprecipitation (ChIP) ES and FACS-sorted cells were fixed in % formaldehyde and sonicated until fragments of an average size of 5 bp were obtained. Soluble, sheared chromatin was diluted
More informationChIP using plant samples - Arabidopsis
ChIP using plant samples - Arabidopsis Edited from a protocol provided by: Werner Aufsatz Gregor Mendel Institute of Molecular Plant Biology Introduction Eukaryotic chromatin is a complex of DNA and associated
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationab ChIP Kit Magnetic One-Step
ab156907 ChIP Kit Magnetic One-Step Instructions for Use For selective enrichment of a chromatin fraction containing specific DNA sequences in a high throughput format using chromatin isolated from various
More informationChromatrap Enzymatic Shearing Kit
V 1.1 Chromatrap Enzymatic Shearing Kit A solid phase chromatin immunoprecipitation assay (ChIP) Protocol v1.1 ADVANCEMENTS IN EPIGENETICS Contents Kit components and storage 3 Introduction 4 Assay Overview
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationChIP-Adem-Kit AutoMag Solution (Cat #04643) Instruction manual for automation protocol
ChIP-Adem-Kit AutoMag Solution (Cat #04643) Instruction manual for automation protocol ADEMTECH SA Bioparc BioGalien 27, allée Charles Darwin 33600 Pessac France Tel: +33557020201 Fax +3355702020 Visit
More informationRab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
More informationab High-Sensitivity ChIP Kit
ab185913 High-Sensitivity ChIP Kit Instructions for Use For the selective enrichment of chromatin fractions This product is for research use only and is not intended for diagnostic use. Version 4 Last
More informationab High-Sensitivity ChIP Kit
ab185913 High-Sensitivity ChIP Kit Instructions for Use For the selective enrichment of chromatin fractions This product is for research use only and is not intended for diagnostic use. Version 5 Last
More informationImmunoprecipitation (IP)
BlueGene Biotech Co.,Ltd. Tel: 0086-21-61471242 Fax: 0086-21-61471242 ext 806 E-mail: sales@bluegene.cc tech@bluegene.cc www.elisakit.cc www.bluegene.cc Immunoprecipitation (IP) Immunoprecipitation is
More informationYeast Transcription Factor Chromatin Immunoprecipitation Wei Zheng *
Yeast Transcription Factor Chromatin Immunoprecipitation Wei Zheng * Keck Biotech Services, Yale University, New Haven, USA *For correspondence: wei.zheng.madison@gmail.com [Abstract] This ChIP protocol
More informationEPIGENTEK. EpiQuik Methylated DNA Immunoprecipitation Kit. Base Catalog # P-2019 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Methylated DNA Immunoprecipitation Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik MeDIP Kit can be used for immunoprecipitating the methylated DNA from a broad range
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5090 SingleShot Probes Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot Probes Kit prepares genomic DNA (gdna) free RNA directly from cell culture
More informationab ChIP Kit Plants
ab117137 ChIP Kit Plants Instructions for Use For carrying out a successful chromatin immunoprecipitation from plant cells This product is for research use only and is not intended for diagnostic use.
More informationGENERATION OF HIC LIBRARY
GENERATION OF HIC LIBRARY Gel checking points during one HiC experiment ------ % gel Step Checking list 1 0.8 After cells are lysed Pellet degradation check 2 0.8 After template generation 1 template quality
More informationChapter 13. Allelic Imbalance Assays to Quantify Allele-Specific Gene Expression and Transcription Factor Binding. Francesca Luca and Anna Di Rienzo
Chapter 13 Allelic Imbalance Assays to Quantify Allele-Specific Gene Expression and Transcription Factor Binding Abstract A growing number of noncoding variants are found to influence the susceptibility
More informationProtocol Immunprecipitation
1 Protocol Immunprecipitation IP Juni 08, S.L. Before starting an IP on should be certain, that one can clearly detect the Protein to precipitate in a standard Western Blot with the lysis conditions used
More informationInternal Controls: Both negative and positive DNA controls are provided in this kit.
ChromaFlash One-Step ChIP Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The ChromaFlash One-Step ChIP Kit is suitable for selective enrichment of a chromatin fraction containing
More informationBacteria Genomic DNA Purification Kit
Bacteria Genomic DNA Purification Kit Cat #:DP025/ DP025-150 Size:50/150 reactions Store at RT For research use only 1 Description: The Bacteria Genomic DNA Purification Kit provides a rapid, simple, and
More informationProtein A Agarose Immunoprecipitation Kit
Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationChromatin immunoprecipitation: five steps to great results
Chromatin immunoprecipitation: five steps to great results Introduction The discovery and use of antibodies in life science research has been critical to many advancements across applications, including
More informationSupplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock
Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information
More informationCross Linking Immunoprecipitation
301PR 03 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Cross Linking Immunoprecipitation Utilizes Protein A/G Agarose& DSS for Antibody
More informationPresto Soil DNA Extraction Kit
Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500
More informationLow cost and non-toxic genomic DNA extraction for use in molecular marker studies.
Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and
More informationGα 13 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product
More informationA General Protocol for GST Pull-down Lili Jing *
A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down
More informationEasy Tissue & Cell Genomic DNA Purification Kit. Cat. #:DP021E/ DP021E-150 Size:50/150 reactions Store at RT For research use only
Easy Tissue & Cell Genomic DNA Purification Kit Cat. #:DP021E/ DP021E-150 Size:50/150 reactions Store at RT For research use only 1 Description: The Easy Tissue & Cell Genomic DNA Purification Kit is ideal
More informationGα i Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationIdentification of Proteins Interacting with Genomic Regions of Interest in vivo
Identification of Proteins Interacting with Genomic Regions of Interest in vivo Using Engineered DNA-binding Molecule-mediated Chromatin Immunoprecipitation (enchip) Toshitsugu Fujita and Hodaka Fujii
More informationTITLE: Chromatin shearing with SDS detergent buffers
TITLE: Chromatin shearing with SDS detergent buffers Summary of Operating Conditions Target Base Pair (Range) 300-700 Duty Cycle 20% Intensity 8 Cycles per Burst 200 Processing Time We suggest an initial
More informationGenomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065
INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),
More informationAnti-CLOCK (Mouse) mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-CLOCK (Mouse) mab CODE No. D349-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal CLSP4 Mouse IgG1
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationTissue & Cell Genomic DNA Purification Kit. Cat. #:DP021/ DP Size:50/150 reactions Store at RT For research use only
Tissue & Cell Genomic DNA Purification Kit Cat. #:DP021/ DP021-150 Size:50/150 reactions Store at RT For research use only 1 Description: The Tissue & Cell Genomic DNA Purification Kit provides a rapid,
More informationATAC-seq Protocol Kaestner Lab
ATAC-seq Protocol Kaestner Lab Reagents 1X PBS Nuclease-free H 2O NP-40 10% (Sigma/Roche, catalog # 11332473001), store at 4 o C Tween-20 10% (Sigma/Roche, catalog # 11332465001), store at 4 o C Digitonin
More information