It s not a fundamental force like mutation, selection, and drift.
|
|
|
- Whitney Sims
- 6 years ago
- Views:
Transcription
1 What is Genetic Draft? It s not a fundamental force like mutation, selection, and drift. It s an effect of mutation at a selected locus, that reduces variation at nearby (linked) loci, thereby reducing the apparent N. Why should we care? Neutral theory predicts that at mutation-drift equilibrium, DNA polymorphism should be proportional to N: π θ 4Nμ (at a diploid locus) But it s not! (Not even approximately, especially for mitochondria.) If we can figure out why the neutral theory fails, we ll learn something important about genetics and ecology (i.e., mutation and selection). Anth/Biol 5221, 17 November 2017
2 Mitochondrial π s invertebrates Nuclear π s π s = π at synonymous sites Eric Bazin, Sylvain Glémin, Nicolas Galtier (2006) Science 312,
3 The most abundant animal on Earth? Euphausia superba Key link in Southern Ocean ecosystem post-larval individuals 1-4 x 10 8 metric tons Human biomass, for comparison? 7 x 10 9 x 0.04 m.t. = 2.8 x 10 8 m.t.
4 Very conservatively, mitochondrial q = 2N f μ = 2*10 12 *5*10-9 = But p s 0.03! Why is θ 333,333 times larger than p s?
5 The draft model: Locus A is selected, locus B is neutral Step 0: The population is fixed for A 2, polymorphic for B 1 and B 2. Frequency of B 1 = p B, frequency of B 2 = q B = (1-p B ). Step 1: A mutation to the selectively favored allele A 1 occurs. But on which genetic background? B 1? B 2?
6 Step 2: The lucky B-allele hitches a ride with A 1 2pq 0 p(b 1 ) (Gillespie gets confused by his notation here.) 2pq = 0.42 as long as it remains in linkage disequilibrium with A 1 and as a consequence, B-locus variation tends to be reduced. 2pq 0.4 2pq 0.2 2pq 0
7 An important consequence: hitchhiking sweeps away variation near the selected locus Typical r 10-8 /bp. Suppose s Then r/s 10-5 /bp. So r/s 0.1 within 10,000 bp of the selected locus. (10-5 * 10 4 = 0.1) (r/s)
8 LCT region and putative lactase persistence mutations intron 13 Ingram et al. (2009) Human Genetics 124:
9 Lactase in Utah, again! The first 26 chromosomes share the consensus sequence (as do 60 others omitted to save space). The other 34 chromosomes are shown as differences from the consensus. These 101 variable sites are embedded in a region of roughly 140,000 base pairs. In what sense are the consensus chromosomes younger than the others? Are their mutations younger? Or is it just the combination of mutations? Enlightening exercise: Identify and describe a few recombination events. cons aaggaggcgacattccgcttcaggcattcctatctaaacagaccaacgtaagggtacaatgcctaacccagacgtttcaactctggctgttattcctcgat t t c g gg.a.ca.ag.g.gt G G G G G G..a.gt...t...gac.c.tgtct...a..gc..t.t..c 38...c...ccgga...gat..at..gg..c...tc.gGaaa.g..ccttt...tg...c...t.t...g...t g...g..c...ccgga...gat..at..gg..c...tc.gGaaa.g..ccttt...tg...c...t.t...g...t gg.a..at.gt.c.t..tcc...agtag.t.cat..g...t..ttccgg..a.gt...t...gac.c.tgtct c.t..tcc...agtag.t.cat..g...t.gttccgG..a.gt...t...gac.c.tgtct...a..gc..t.t..c 42...c.t..tcc...agtag.t.cat..g...t.gttccgG..a.gt...t...gac.c.tgtct...a..gc..t.t..c 43..aa..at.gt.c.t..tcc...agtag.t.cat..g...t.g.tc.gG..a.gt...t...gac.c.tgtct...g...t.t..c 44..aa..at.gt.c.t..tcc...agtag.t.cat..g...t..ttc.gG..acgt...t...gac.c.tgtct...a..gc..t.t..c 45..aa..at.gt.c.t..tcc...agtag.t.cat..g...t.gttc.gG..a.gt...t...gac.c.tgtct...a..gc..t.t..c 46...g...g..c...ccgga...gat..at..gg..c...tc.gGaaa.g..ccttt...tg...cg.gt.t..ctata.ccg.c..ctcg. 47 gg.a..at.gt.c.t..tcc...agtag.t.cat..g...t.gttccgg..a.gt...t...gac.c.tgtct...a..gc..t.t..c 48 gg.a..at.gt.c.t..tcc...agtag.t.cat..g...t.gttccgg..a.gt...t...gac.c.tgtct...a..gc..t.t..c 49 gg.a..at.gt.c.t..tcc...agtag.t.cat..g...t.gttccgg..a.gt...t...gac.c.tgtct...a..gc..t.t..c 50...g..c..tatccgga...g.tc.atcgg.tc.g.tg.tc.gG..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.c..ctcg. 51 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ct...a..gc..t.t..c 52 gg.a.ca.ag.g.gtta.ccgga...g.t..atc.g.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.c..ctcg. 53 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.c..ctcg. 54 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.c..ctcg. 55 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.c..ctcg. 56 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.c..ctcg. 57 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggtg..cg.gt.t..ctata.ccg.c..ctcg. 58 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.ca.ctcg. 59 gg.a.ca.ag.g.gtta.ccgga...g.tc.atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggt...cg.gt.t..ctata.ccg.c..ctcg. 60 gg.a.ca.ag.g.gtta.ccgga...g.t..atcgg.tc.g.tg.tc.gg..a.g.g...tg...ggtg..cg.gt.t..ctata.ccg.c..ctcg.
10 Homozygous intervals of chromosome 2 in 90 Utahans LCT-13190*T 2.4 Mbp 19 genes
11 Overall heterozygosity is drafted down at HapMap SNP loci. But why so modestly?
12 Exercise: Do this for s = 0.001, 0.01, 0.1 r = , 0.003, And consider initial B locus allele frequencies other than 0.5!
13 So, what are the predictions of this model? Less variation where sweeps are more frequent. Less variation where recombination rates are lower (Loci are strongly affected where r/s < 0.1). What if recombination is mutagenic? How could we test for this? (~r)
14 What determines the frequency of adaptive sweeps (ρ)? 1. The rate of environmental change. 2. The rate at which adaptive mutations occur in the population. Eqn. 4.6, page 114. N e and π From Kimura s model. Implies rate of evolution is mutation-limited. But if most species environments change at about the same rate, they will have similar Ne and π, regardless of N. y is the final frequency of the lucky hitchhiking gene copy.
15 But is the rate of environmental change similar for all genetic loci, in addition to being similar for all species? Π varies overall by roughly a factor of 100, which is really not enough. Most values fall between and 0.02, and are much smaller than 4Nμ!
16 Summary Genetic draft is the effect of a selective sweep at one locus on the variation at nearby (linked) loci. On average it reduces variation at those linked loci. In this way it reduces the apparent or effective N. Gillespie calls it a new stochastic force in evolution, arising from the stochasticity of the initial conditions. That is, when and where (on which chromosome) a favored mutation occurs. Whether we consider it a new force, or just an effect, it s important! But apparently we don t yet understand the whole story
Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations
Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.
Two-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles:
The human genome has ~30,000 genes. Drosophila contains ~10,000 genes. Bacteria contain thousands of genes. Even viruses contain dozens of genes. Clearly, one-locus models are oversimplifications. Unfortunately,
Molecular Evolution. COMP Fall 2010 Luay Nakhleh, Rice University
Molecular Evolution COMP 571 - Fall 2010 Luay Nakhleh, Rice University Outline (1) The neutral theory (2) Measures of divergence and polymorphism (3) DNA sequence divergence and the molecular clock (4)
Genetic load. For the organism as a whole (its genome, and the species), what is the fitness cost of deleterious mutations?
Genetic load For the organism as a whole (its genome, and the species), what is the fitness cost of deleterious mutations? Anth/Biol 5221, 25 October 2017 We saw that the expected frequency of deleterious
Introduction to Population Genetics. Spezielle Statistik in der Biomedizin WS 2014/15
Introduction to Population Genetics Spezielle Statistik in der Biomedizin WS 2014/15 What is population genetics? Describes the genetic structure and variation of populations. Causes Maintenance Changes
Algorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
Lecture 19: Hitchhiking and selective sweeps. Bruce Walsh lecture notes Synbreed course version 8 July 2013
Lecture 19: Hitchhiking and selective sweeps Bruce Walsh lecture notes Synbreed course version 8 July 2013 1 Hitchhiking When an allele is linked to a site under selection, its dynamics are considerably
MSc in Genetics. Population Genomics of model species. Antonio Barbadilla. Course
Group Genomics, Bioinformatics & Evolution Institut Biotecnologia I Biomedicina Departament de Genètica i Microbiologia UAB 1 Course 2012-13 Outline Cataloguing nucleotide variation at the genome scale
Population Genetics II. Bio
Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT
Questions we are addressing. Hardy-Weinberg Theorem
Factors causing genotype frequency changes or evolutionary principles Selection = variation in fitness; heritable Mutation = change in DNA of genes Migration = movement of genes across populations Vectors
An Introduction to Population Genetics
An Introduction to Population Genetics THEORY AND APPLICATIONS f 2 A (1 ) E 1 D [ ] = + 2M ES [ ] fa fa = 1 sf a Rasmus Nielsen Montgomery Slatkin Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Neutrality Test. Neutrality tests allow us to: Challenges in neutrality tests. differences. data. - Identify causes of species-specific phenotype
Neutrality Test First suggested by Kimura (1968) and King and Jukes (1969) Shift to using neutrality as a null hypothesis in positive selection and selection sweep tests Positive selection is when a new
Haplotypes, linkage disequilibrium, and the HapMap
Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique
Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions
Measurement of Molecular Genetic Variation Genetic Variation Is The Necessary Prerequisite For All Evolution And For Studying All The Major Problem Areas In Molecular Evolution. How We Score And Measure
The Evolution of Populations
The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether
B. Incorrect! 64% is all non-mm types, including both MN and NN. C. Incorrect! 84% is all non-nn types, including MN and MM types.
Genetics Problem Drill 23: Population Genetics No. 1 of 10 1. For Polynesians of Easter Island, the population has MN blood group; Type M and type N are homozygotes and type MN is the heterozygous allele.
What is molecular evolution? BIOL2007 Molecular Evolution. Modes of molecular evolution. Modes of molecular evolution
BIOL2007 Molecular Evolution What is molecular evolution? Evolution at the molecular level Kanchon Dasmahapatra k.dasmahapatra@ucl.ac.uk Modes of molecular evolution INDELS: insertions and deletions Modes
POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
Molecular variation. Joe Felsenstein. GENOME 453, Autumn Molecular variation p.1/32
Molecular variation Joe Felsenstein GENOME 453, Autumn 2009 Molecular variation p.1/32 Views of genetic variation before 1966 The Classical view The Balancing Selection view Hermann Joseph Muller Most
B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).
Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are
Variation Chapter 9 10/6/2014. Some terms. Variation in phenotype can be due to genes AND environment: Is variation genetic, environmental, or both?
Frequency 10/6/2014 Variation Chapter 9 Some terms Genotype Allele form of a gene, distinguished by effect on phenotype Haplotype form of a gene, distinguished by DNA sequence Gene copy number of copies
Explaining the evolution of sex and recombination
Explaining the evolution of sex and recombination Peter Keightley Institute of Evolutionary Biology University of Edinburgh Sexual reproduction is ubiquitous in eukaryotes Syngamy Meiosis with recombination
Signatures of a population bottleneck can be localised along a recombining chromosome
Signatures of a population bottleneck can be localised along a recombining chromosome Céline Becquet, Peter Andolfatto Bioinformatics and Modelling, INSA of Lyon Institute for Cell, Animal and Population
N e =20,000 N e =150,000
Evolution: For Review Only Page 68 of 80 Standard T=100,000 r=0.3 cm/mb r=0.6 cm/mb p=0.1 p=0.3 N e =20,000 N e =150,000 Figure S1: Distribution of the length of ancestral segment according to our approximation
What is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
Forces Determining Amount of Genetic Diversity
Forces Determining Amount of Genetic Diversity The following are major factors or forces that determine the amount of diversity in a population. They also determine the rate and pattern of evolutionary
homology - implies common ancestry. If you go back far enough, get to one single copy from which all current copies descend (premise 1).
Drift in Large Populations -- the Neutral Theory Recall that the impact of drift as an evolutionary force is proportional to 1/(2N) for a diploid system. This has caused many people to think that drift
Evolutionary Mechanisms
Evolutionary Mechanisms Tidbits One misconception is that organisms evolve, in the Darwinian sense, during their lifetimes Natural selection acts on individuals, but only populations evolve Genetic variations
Detecting selection on nucleotide polymorphisms
Detecting selection on nucleotide polymorphisms Introduction At this point, we ve refined the neutral theory quite a bit. Our understanding of how molecules evolve now recognizes that some substitutions
(c) Suppose we add to our analysis another locus with j alleles. How many haplotypes are possible between the two sites?
OEB 242 Midterm Review Practice Problems (1) Loci, Alleles, Genotypes, Haplotypes (a) Define each of these terms. (b) We used the expression!!, which is equal to!!!!!!!! and represents sampling without
7-1. Read this exercise before you come to the laboratory. Review the lecture notes from October 15 (Hardy-Weinberg Equilibrium)
7-1 Biology 1001 Lab 7: POPULATION GENETICS PREPARTION Read this exercise before you come to the laboratory. Review the lecture notes from October 15 (Hardy-Weinberg Equilibrium) OBECTIVES At the end of
Constancy of allele frequencies: -HARDY WEINBERG EQUILIBRIUM. Changes in allele frequencies: - NATURAL SELECTION
THE ORGANIZATION OF GENETIC DIVERSITY Constancy of allele frequencies: -HARDY WEINBERG EQUILIBRIUM Changes in allele frequencies: - MUTATION and RECOMBINATION - GENETIC DRIFT and POPULATION STRUCTURE -
689 Special Topics in Ecological Genomics. Spring January 22, 2015
689 Special Topics in Ecological Genomics Spring 2015 January 22, 2015 Animal mtdna Excep&ons: heteroplasmy, paternal leakage, intra- and interspecific recombina&on Animal mtdna Haploid and maternally
Review. Molecular Evolution and the Neutral Theory. Genetic drift. Evolutionary force that removes genetic variation
Molecular Evolution and the Neutral Theory Carlo Lapid Sep., 202 Review Genetic drift Evolutionary force that removes genetic variation from a population Strength is inversely proportional to the effective
Molecular variation. Joe Felsenstein. GENOME 453, Autumn Molecular variation p.1/34
Molecular variation Joe Felsenstein GENOME 453, Autumn 2015 Molecular variation p.1/34 Views of genetic variation before 1966 The Classical view The Balancing Selection view Hermann Joseph Muller Most
2. Write an essay on reinforcement and its relationship to sympatric speciation.
BIOL B242 Evolutionary and Population Genetics Exam 2006 Model Answers 2. Write an essay on reinforcement and its relationship to sympatric speciation. Reinforcement Suppose some adaptation has led to
Population Genetics. If we closely examine the individuals of a population, there is almost always PHENOTYPIC
1 Population Genetics How Much Genetic Variation exists in Natural Populations? Phenotypic Variation If we closely examine the individuals of a population, there is almost always PHENOTYPIC VARIATION -
Drift versus Draft - Classifying the Dynamics of Neutral Evolution
Drift versus Draft - Classifying the Dynamics of Neutral Evolution Alison Feder December 3, 203 Introduction Early stages of this project were discussed with Dr. Philipp Messer Evolutionary biologists
b. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.
NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops
Linkage Disequilibrium. Adele Crane & Angela Taravella
Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay
Crash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
Natural Selection Advanced Topics in Computa8onal Genomics
Natural Selection 02-715 Advanced Topics in Computa8onal Genomics Natural Selection Compara8ve studies across species O=en focus on protein- coding regions Genes under selec8ve pressure Immune- related
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
Selection and genetic drift
Selection and genetic drift Introduction There are three basic facts about genetic drift that I really want you to remember, even if you forget everything else I ve told you about it: 1. Allele frequencies
POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping
POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping - from Darwin's time onward, it has been widely recognized that natural populations harbor a considerably degree of genetic
Outline. Detecting Selective Sweeps. Are we still evolving? Finding sweeping alleles
Outline Detecting Selective Sweeps Alan R. Rogers November 15, 2017 Questions Have humans evolved rapidly or slowly during the past 40 kyr? What functional categories of gene have evolved most? Selection
1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds:
1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: natural selection 21 1) the component of phenotypic variance not explained by
Conifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 7 Measuring, Organizing, and Interpreting Marker Variation
Edexcel (B) Biology A-level
Edexcel (B) Biology A-level Topic 8: Origins of Genetic Variation Notes Meiosis is reduction division. The main role of meiosis is production of haploid gametes as cells produced by meiosis have half the
Genetic drift. 1. The Nature of Genetic Drift
Genetic drift. The Nature of Genetic Drift To date, we have assumed that populations are infinite in size. This assumption enabled us to easily calculate the expected frequencies of alleles and genotypes
Simple inheritance. Defective Gene. Disease
Simple inheritance Defective Gene Disease Cystic Fibrosis Hemochromatosis Achondroplasia Huntington s Disease Neurofibromatosis Fanconi Anemia Muscular Dystrophy Ataxia Telangiectasia Werner Syndrome Complex
Population Genetics Sequence Diversity Molecular Evolution. Physiology Quantitative Traits Human Diseases
Population Genetics Sequence Diversity Molecular Evolution Physiology Quantitative Traits Human Diseases Bioinformatics problems in medicine related to physiology and quantitative traits Note: Genetics
Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
Applied Bioinformatics
Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA
Quantitative Genetics for Using Genetic Diversity
Footprints of Diversity in the Agricultural Landscape: Understanding and Creating Spatial Patterns of Diversity Quantitative Genetics for Using Genetic Diversity Bruce Walsh Depts of Ecology & Evol. Biology,
Conifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 3 Population Genetics Nicholas Wheeler & David Harry Oregon
Evolutionary Genetics: Part 1 Polymorphism in DNA
Evolutionary Genetics: Part 1 Polymorphism in DNA S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or definition
UHT Sequencing Course Large-scale genotyping. Christian Iseli January 2009
UHT Sequencing Course Large-scale genotyping Christian Iseli January 2009 Overview Introduction Examples Base calling method and parameters Reads filtering Reads classification Detailed alignment Alignments
CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes
CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual
Park /12. Yudin /19. Li /26. Song /9
Each student is responsible for (1) preparing the slides and (2) leading the discussion (from problems) related to his/her assigned sections. For uniformity, we will use a single Powerpoint template throughout.
Population Genetics. Ben Hecht CRITFC Genetics Training December 11, 2013
Population Genetics http://darwin.eeb.uconn.edu/simulations/drift.html Ben Hecht CRITFC Genetics Training December 11, 2013 1 Population Genetics The study of how populations change genetically over time
Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
LAB ACTIVITY ONE POPULATION GENETICS AND EVOLUTION 2017
OVERVIEW In this lab you will: 1. learn about the Hardy-Weinberg law of genetic equilibrium, and 2. study the relationship between evolution and changes in allele frequency by using your class to represent
January 6, 2005 Bio 107/207 Winter 2005 Lecture 2 Measurement of genetic diversity
January 6, 2005 Bio 107/207 Winter 2005 Lecture 2 Measurement of genetic diversity - in his 1974 book The Genetic Basis of Evolutionary Change, Richard Lewontin likened the field of population genetics
The Evolution of Populations
Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
COMPUTER SIMULATIONS AND PROBLEMS
Exercise 1: Exploring Evolutionary Mechanisms with Theoretical Computer Simulations, and Calculation of Allele and Genotype Frequencies & Hardy-Weinberg Equilibrium Theory INTRODUCTION Evolution is defined
Chapter 23: The Evolution of Populations. 1. Populations & Gene Pools. Populations & Gene Pools 12/2/ Populations and Gene Pools
Chapter 23: The Evolution of Populations 1. Populations and Gene Pools 2. Hardy-Weinberg Equilibrium 3. A Closer Look at Natural Selection 1. Populations & Gene Pools Chapter Reading pp. 481-484, 488-491
Summary. Introduction
doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size
POPULATION GENETICS. Evolution Lectures 4
POPULATION GENETICS Evolution Lectures 4 POPULATION GENETICS The study of the rules governing the maintenance and transmission of genetic variation in natural populations. Population: A freely interbreeding
Statistical Methods for Quantitative Trait Loci (QTL) Mapping
Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson
Overview of using molecular markers to detect selection
Overview of using molecular markers to detect selection Bruce Walsh lecture notes Uppsala EQG 2012 course version 5 Feb 2012 Detailed reading: WL Chapters 8, 9 Detecting selection Bottom line: looking
Why do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
Molecular Evolution. H.J. Muller. A.H. Sturtevant. H.J. Muller. A.H. Sturtevant
Molecular Evolution Arose as a distinct sub-discipline of evolutionary biology in the 1960 s Arose from the conjunction of a debate in theoretical population genetics and two types of data that became
Genome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
AP BIOLOGY Population Genetics and Evolution Lab
AP BIOLOGY Population Genetics and Evolution Lab In 1908 G.H. Hardy and W. Weinberg independently suggested a scheme whereby evolution could be viewed as changes in the frequency of alleles in a population
Mutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
Genetic drift 10/13/2014. Random factors in evolution. Sampling error. Genetic drift. Random walk. Genetic drift
Random factors in evolution Mutation is random is random is random fluctuations in frequencies of alleles or haplotypes Due to violation of HW assumption of large population size Can result in nonadaptive
Identifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
Lecture 10 : Whole genome sequencing and analysis. Introduction to Computational Biology Teresa Przytycka, PhD
Lecture 10 : Whole genome sequencing and analysis Introduction to Computational Biology Teresa Przytycka, PhD Sequencing DNA Goal obtain the string of bases that make a given DNA strand. Problem Typically
Introduction to population genetics. CRITFC Genetics Training December 13-14, 2016
Introduction to population genetics CRITFC Genetics Training December 13-14, 2016 What is population genetics? Population genetics n. In culture: study of the genetic composition of populations; understanding
Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
POPULATION GENETICS. Evolution Lectures 1
POPULATION GENETICS Evolution Lectures 1 POPULATION GENETICS The study of the rules governing the maintenance and transmission of genetic variation in natural populations. Population: A freely interbreeding
Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
-Is change in the allele frequencies of a population over generations -This is evolution on its smallest scale
Remember: -Evolution is a change in species over time -Heritable variations exist within a population -These variations can result in differential reproductive success -Over generations this can result
The Evolution of Populations
Chapter 23 The Evolution of Populations PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Genetic drift is change in allele frequencies due to chance fluctuations; its strength depends on population size.
Roadmap Genetic drift is change in allele frequencies due to chance fluctuations; its strength depends on population size. Rate of fixation (recap) Proportion of homozygotes in population (genetic diversity)
DNA is contained in the nucleus of every cell in your body. Cell Nucleus
DNA is contained in the nucleus of every cell in your body Cell Nucleus 1 DNA has a spiral staircase-like structure. The steps are formed by the nitrogen bases of the nucleotides where adenine pairs with
TEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human?
TEST FORM A Evolution PCB 4673 Exam # 2 Name SSN Multiple Choice: 3 points each 1. The horseshoe crab is a so-called living fossil because there are ancient species that looked very similar to the present-day
Analysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift
Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift Heather J. Cordell Professor of Statistical Genetics Institute of Genetic Medicine Newcastle University,
Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs
Population Genetic Differentiation and Diversity of the Blue Crab in the Gulf of Mexico Inferred with Microsatellites and SNPs Luis Hurtado, Isabel Caballero, Danielle Macedo, Mariana Mateos It is important
The Evolution of Populations
Microevolution The Evolution of Populations C H A P T E R 2 3 Change in allele frequencies over generations Three mechanisms cause allele frequency change: Natural selection (leads to adaptation) Genetic
LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION?
LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION? A. COLLINS Department of Human Genetics University of Southampton Duthie Building (808) Southampton General Hospital
Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation
Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also
CHAPTER 12 MECHANISMS OF EVOLUTION
CHAPTER 12 MECHANISMS OF EVOLUTION 12.1 Genetic Variation DNA biological code for inheritable traits GENES units of DNA molecule in a chromosome LOCI location of specific gene on DNA molecules DIPLOID
Lecture 10 Molecular evolution. Jim Watson, Francis Crick, and DNA
Lecture 10 Molecular evolution Jim Watson, Francis Crick, and DNA Molecular Evolution 4 characteristics 1. c-value paradox 2. Molecular evolution is sometimes decoupled from morphological evolution 3.
PopGen1: Introduction to population genetics
PopGen1: Introduction to population genetics Introduction MICROEVOLUTION is the term used to describe the dynamics of evolutionary change in populations and species over time. The discipline devoted to