Identification of Productive Trait Genes by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism

Transcription

1 INTERNATIONAL JOURNAL OF BIOTECHNOLOGY RESEARCH July-December 2011 Volume 4 No. 2, pp I J B R International Science Press Identification of Productive Trait Genes by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism M. Renuka and C.K. Kamble Central Sericultural Germplasm Resources Centre, Central Silk Board, Hosur , Tamil Nadu, India. ABSTRACT Silkworm Bombyx mori was used to differentiate high and low silk yielding silkworm strains. Restriction fragment length polymorphism in polymerase chain reaction amplified fragments (PCR-RFLP) of storage protein gene and yolk protein gene. Two restriction enzymes were screened on PCR product of storage protein and yolk protein DNA of ten different silkworm races possessing contrasting silk yield. The restriction fragment length polymorphism patterns were polymorphic in these races and were used to score a phylogenetic tree. The restriction fragments were used for trait specific character of silk yield. The high silk yielding silkworm races were clustered together and remaining low silk yielding races were formed a unique cluster. Using this study different silkworm strains were characterized and through restriction pattern and grouped together based on silk yield. The technique is rapid and inexpensive, enabling silkworm characterization within 48 hrs. Keywords: : Silkworm, EST, Bombyx mori, PCR-RFLP markers 1. INTRODUCTION The domesticated silkworm, Bombyx mori, has long been used as a model system for basic studies because of its large body size, ease of rearing in the laboratory, and economic importance in sericulture. The well-developed genetic resources of this species include more than 400 described mutants, comprising 28 linkage groups and is estimated a haploid nuclear genome size of 530-Mb as well as molecular linkage maps developed by using a variety of markers, a large and diverse collection of genetic markers, including RAPDs, RFLPs and SSRs, ESTs have been developed and mapped. The combined map contains more than a thousand molecular markers, at an average spacing of 2-cM (or about 500-Kb). In addition, among the more than 400 visible phenotypes, early 200 are assigned to linkage group, interestingly, some genes related to cocoon color, size/shape virus resistance and wingless mutation have been positional cloned and analyzed. These genetic resources make B. mori an ideal reference of Lepidoptera, and thereby this species facilitates studies of comparative genomics and basic research leading towards new genome-based approaches for sericulture and the control of pest species. The gene pool available in the country can be broadly divided in to two groups (Seuthuraman et al., 2002) the low yielding stocks (multivoltine) characterized by high adaptability to tropical conditions and the high yielding (bivoltine) stocks which exhibit regular diapause, but suffer from the low adaptability to the fluctuating tropical agro-climatic conditions (Datta, 2000; Chatterjee et al., 1993a) and are mainly developed from Japanese hybrids (Chatterjee & Datta, 1992, Goldsmith (1991) are used for gene tagged breeding to combine the best qualities of the temperate high yielding stocks with tropical hardiness. Attempts have been made to understand the genetics of yield potential in Bombyx mori (Chatterjee et al., 1993b; Datta 1984). for improvement of silkworm races. Vitellogenin (Vg), the precursor of major yolk protein in insects (Kunkel and Nordin, 1985: Sappington et al. 2002), is synthesized in fat body and secreted into the hemolymph, then transported to the developing oocytes through receptor-mediated endocytosis. After being incorporated into oocytes. Vg is deposited as viltellin (Vn) (Kanost et al., 1990; Raikhel and Dhadialla, 1992). In the egg development. Vgs are degraded as the source of lipids, amino acids, carbohydrates, sulphates, phosphates and transported to the embryons (Harnish et al., 1982). Vitellogenin of the silkworm, Bombyx mori, is a tetramer with molecular weight of 440k, composed of each two molecules of non-identical subunits termed heavy chain and light chain, respectively. Storage proteins are prominent events linked to the metamorphosis of holometabolous insects. Storage proteins are synthesized in fat body, secreted into the larval hemolymph and taken up by fat body shortly before pupation. Within the pupal fat body, these proteins are initially stored in protein granules, and later proteolytically broken down to supply amino acid resources necessary for the completion of adult development. In Bombyx mori, two storage proteins named SP-1 and SP-2 were shown to decline in concentration in the haemolymph and increase in the fat body during the larval-pupal transformation,

2 60 / M. Renuka and C.K. Kamble As the genes having specific association with many traits and it is imperative to analyze their gene organizations and allelic variations to relate the traits or to link with any putative markers. In this direction variations identified, which were strongly associated with quantitative trait. Silkworm Bombyx mori also processing many economic important traits which were controlled by a set of gene. Information available on the marker association with the traits is very limited in Bombyx mori. Therefore, in the present study, organization pattern of two important race specific genes viz., yolk protein gene and storage protein gene were analyzed for the genetic diversity using PCR-RFLP markers. Silkworm Races 2. MATERIALS AND METHODS Ten Bivoltine silkworm strains from different origin and parentage were chosen from the silkworm stocks maintained at Central Sericultural Germplasm Resources Centre, Hosur, Tamil Nadu based on the yield diversity. Data are presented in Table 1. Table 1 Details of the PCR-RFL Primers (Primer Length, Temperature, % GC Content) S.No Gene ID primer name sequence of the primers 5'-3' Primer Annealing length % GC Tm ( c) temp(ºc) 1 D yolk protein F ATGCTATTGTTTCGCTTTTC yolk protein R CTCTATTAGTGTCTGTTTCG AH storage protein F TTGATAGCTCGGCCTCATCT storage protein R AATGCACCGGACGTCTTATC Primer Designing The cdna sequences ( of respective genes were retrieved from NCBI. The up and down gene-specific primers were designed from the gene sequence of yolk protein gene and storage protein gene usingthe software programme of primer3 and ( frodo.wi.mit.edu/edu/cgibin/primer3) Primers details are given below in Table 2. Table 2 List of Silkworm Races, Quantitaative & Quantitative Traits of the Silkworm, Bombyx Mori S.No. SMGS Race Origin Parentage Fec (no) Hat% TLD VLD SCW SSW S.R% Filament Acc-N0 Name Length (M) 1 BBE M JAPAN NA BBI-0290 CSR-2 INDIA NA BBI-0338 DD-1 INDIA Daizo, NB4D & Japanese be races 4. BBI-0343 NK-4 INDIA NB4D2, Hugo, S. koriyean & chienese bv races 5. BBI-0344 NP-4 INDIA NP-2, NB4D2 & Japanese bv races 6. BBE P JAPAN NA BBE-0209 CN C140 JAPAN CN.C BBE-0213 FCC2(P) JAPAN original BBE FRANCE NA BBE-0298 PY-1 INDIA NA Fec = Fecundity, Hat=Hatching, TLD = Totla larval duration, VLD = Vth instar larval duration, SCW = Single Cocoon weight, SSW = Single weight, S.R% = Shell ratio. 3. GENOMIC DNA ISOLATION Genomic DNA was isolated by standard phenol chloroform method (Nagaraja and Nagaraju, 1995; Nagaraju.et al., 1995). Extraction buffer (100mM tris HCL, ph 8.0, 50mM Nacl, 50, 50mM EDTA and 1% SDS) and Proteinase K (100 µg/ml) were added to the ground tissue and incubated at 37 C. DNA was extracted with phenolchloroform-isoamylalcohol. The extracted DNA was dissolved in TE (10mM Tris-HCL, 1mM EDTA, ph 8.0). The genomic DNA was quantified in 0.8% agarose gels and further diluted to a uniform concentration (20ng/µl).

3 Identification of Productive Trait Genes by Polymerase Chain Reaction-Restriction Fragment... / PCR CONDITION AND ANALYSIS OF AMPLIFIED PRODUCTS The amplification of genomic DNA was performed with its standard procedure. The reaction carried out in a 20µl reaction volume containing 20ng of template DNA, 10 PCR buffer (10mM Tris-HCL, ph 8.3, 1.5mM Mgcl2 and 50mM Kcl), 10 picomole primer, 100µM each of datp, dctp, dgtp and dttp, and 3units of Taq DNA polymerase (Genei). Amplification was carried out in a MJ RESEARCH Pelteir thermal cycler (PTC 200,USA) following a PCR schedule of 94 C for 2 min, followed by 35 cycles of 94 C for 30 sec, 55 C for 30 sec and 72 C for 2 min with a final extension at 72 C for 10 minutes. The amplified products were resolved on 1.5% agarose gels using TBE buffer (89mM Tris, 89mM boric acid and 2mM EDTA). Electrophoresis was carried out with a constant voltage. The gels were stained with ethidium bromide (0.5ug/ml) and photographed using a gel documentation system (Syngene Corporation, UK). The PCR sample further restriction digestion with two restriction enzymes viz., Eco RI and Taq I. 5. STATISTICAL DATAANALYSIS The SPSS/PC-11.5 (M.J.Norusis,SPSS Inc.,Chicago) package ( was used for various statistical analysis. The PCR profiles were subjected to binary scoring (1 for presence and 0 for absence of DNA fragments). Clustering of 10 genotypes was done based on genetic distance. Genetic similarity coefficients among twenty races were estimated from the binary data by Hierarchical cluster analysis using Ward method. Two major groups were found in the cluster are represented in (Fig 1 & 2). 6. RESULT AND DISCUSSION Ten bivoltine races that are conserved in the Central Sericultural Germplasm Resources Centre (CSGRC), Hosur, of Central Silk Board, Bangalore were collected for the study. These ten races were originally collected from different states of India like Karnataka and Tamil nadu and few races also belong to Japan and France (Table 2). Some of the races are evolved through continuous breeding and the remaining races belong to the original parentage. All the ten races show distinct phenotypic diversity as far as cocoon colour, cocoon shape etc. The color of the cocoons is white and creamy white and the shape of the cocoons is either elongated or oval. There is significant diversity in the quantitative characters in all the races (Table 2). The total larval duration (TLD) varied from 555 hours (DD-1) to 641 (FCC2 (P)). The cocoon weight (SCW) varied from 1.21g (I-15) to 1.95g (14 M). The single shell weight (SSW) ranges from 0.19g (I-15) to 0.43 (14 M). The shell ratio (SR %) is between 15.91% (I-15) to 23.97% (CSR-2). Through BBE-0220 race has the lowest cocoon weight, shell weight and shell ratio, it is hardy silkworm race and commercially exploited in rainfed areas, hottest regions and unfavorable climates of India. The race 14 M is having high cocoon weight, shell weight and highest shell ratio as also highest hatching % is improved Bivoltine race evolved through continuous breeding. Whereas highest filament length was found in 14 M, i,e., 1177 m among the GRS taken for this study. The quantitative traits taken for the study were total larval duration [i.e. the duration in hours from hatching to initiation of spinning (TLD)], maximum single cocoon weight (SCW), Single shell weight (SSW), and shell ratio (SR%=SSW/SCW.100). In order to study the genetic divergence, the restriction patterns of EST markers of storage and yolk protein gene were analyzed. Similarity coefficients among ten races were estimated from the binary data by Hierarchical cluster analysis using Ward method (Figure. 1 & 2). The Eco RI and Taq I digested restriction patterns of Storage protein gene is shown in (Figure. 3). Figure 1: Dendrogram of Storage Protein Gene Based on Wards Method Figure 2: Dendrogram of Yolk Protein Gene Based on Wards Method Two major groups in the cluster were obtained. The silkworm races possessing high shell ratio ( %) is grouped in one cluster and the races with low shell ratio ( %) are grouped in another cluster. In the

4 62 / M. Renuka and C.K. Kamble first group with high shell ratio three sub groups are formed and in the second group with low shell ratio two sub groups are formed. The restriction patterns obtained through Eco RI and Taq I enzymes on yolk protein gene revealed genetic polymorphism. These polymorphism bands were further analyzed through Wards method and identified two major cluster groups differentiating one into high shell ratio race group another into low shell ratio groups (Fig. 3). The result indicates both storage as well as yolk protein gene restriction patterns also revealed a similar pattern grouping of high and low shell cluster separately. The results also indicate the restriction pattern of this vital gene which is strongly associated with quantitative traits. Simon et al., (1993) used PCR-RFLP to characterize the insect of Cicada broods. Later they found that the PCR-RFLP is less expensive and as high resolution than standard RFLP analysis. Sperling et al., (1994) modified the PCR-RFLP technique to differentiate three species of blow flies. In blow fly the RFLP differences in a 348 bp sequence from the mitochondrial COI gene (cytochrome oxidase I). Figure 3: Storage Protein Gene Restriction Pattern Digested with Taq I. In the present study two genes were analyzed using PCR-RFLP to relate silk yield. Among ten silkworm races five races were placed in high yielding group. Similarly the remaining five races where assembled in low yielding (Mohandas et al., 2004). The restriction fragment analysis of 470 bp length polymerase chain reaction products (PCR-RFLP) of storage gene yielded four conspicuous fragments in most of the races yield four bands, however the race produced only three bands. Such a phenomenon was also observed in other insects (Taylor et al., 1994). ACKNOWLEDGEMENTS The authors are thankful to the Director, Central Sericultural Germplasm Resources Centre (CSGRC), Hosur, for providing the lab facilities and also acknowledge with thanks the scientists for their help and guidance. REFERENCE [1] Chatterjee, S.N., and Datta, R.K. (1992), Hierarchical Clustering of 54 Races and Strains of the Mulberry Silkworm, Bombyx Mori L.: Significance of Biochemical Parameters. Theor. Appl. Genet. 85: pp [2] Chatterjee, S.N., Rao, C.G.P., Aswath, S.K., and Patnaik, A.K. (1993b), Correlation Between Yield and Biochemical Parameters in the Mulberry Silkworm, Bombyx Mori L. Theor. Appl. Genet. 87: pp [3] Chatterjee, S.N., Rao, P.R.M., Jayashwal, K.P., and Singh, Ravindra and Datta, R.K. (1993a), Genetic Variability in Mulberry Silkworm, Bombyx Mori L., Breeds with Low Silk Yield. Indian J. Seric. 32: pp [4] Datta, R.K. (1984), Improvement of Silkworm Races, Bombyx mori L. in India. Sericologia, 24: [5] Datta, R.K. (2000), Silkworm Breeding in India: Present Status and New Challenges. In Proceedings of National Conference on Strategies for Sericulture Research and Development. pp November, Central Sericulture Research and Training Institute,Central Silk Board,ysore, India. [6] Raikhel AS, Dhadialla TS, Hays AR (1992), Characterization of the Solubilized Mosquito Vitellogenin Receptor. Insect. Biochem. Mol. Biol. 22: pp [7] Goldsmith M.R. (1991), Silkworm Breeding for the 90 s: New Molecular and Genetic Tools to Meet the Challenge of the Tropics. Serocologia 31: pp [8] Harnish DG, White BN (1982), An Evolutionary Model for the Insect Vitellins. J. Mol. E 18: pp [9] Kanost MR, Kawooya JK, Law JH, Ryan RO, Van Heusden MC, Ziegier R (1990), Insect Haemolymph Proteins. Adv. Insect. Physio l.22: pp [10] Kunkal JG, Nordin JH (1985), Yolk Proteins. In Comprehensive Insect Physiology, Biochemistry and Pharmacology, Chapter 4, 1 Eds. Kerkut GA, Gilbert LI. Pergamon Press, pp [11] Mohandas. T.P, Sethuraman B.N, Saratchandra.B, Chatterjee S.N, (2004), Molecular Genetics Approach for Identifying Markers Associated with Yield Traits in the Silkworm, Bombyx Mori using RFLP-STS Primers. Genetica 122: pp [12] Nagaraja, G.M. and Nagaraju, J. (1995), Genome Fingerprinting of the Silkworm Bombyx Mori using Random Arbitrary Primers. Electrophoresis. 16: pp [13] Nagaraju, J., Sharma, A., Sethuraman, B. N. et al., (1995), DNA Fingerprinting in Silkworm Bombyx Mori using Banded Krait Minor Satellite DNA Derived Probe. Electrophoresis. 16: pp [14] Sethuraman, B.N., Mohandas, T.P. and Chatterjee, S.N., (2002), DNA Fingerprinting with Homologous Multi Locus Probes and Search for DNA Markers Associated with Yield Attributes in Silkworm, Bombyx mori, Eur. J. Entomology., 99: pp [15] Sperling. F.A.H, Anderson. G.S & Hickey. D.A (1994), A DNA-Based Approach to the Identification of Insect Species used for Postmortem Interval Estimation. Journal of Forensic Science, 39, pp

5 Identification of Productive Trait Genes by Polymerase Chain Reaction-Restriction Fragment... / 63 [16] Sappington TW, Oishi K, Raikhel AS (2002), Structural Characteristics of Insect Vitellogenins, In Progress in Vitellogenesis. Edited by Adiyodi KG,Adiyodi RG, Enfield NH: Sciences Publishers, Inc,USA; pp [17] Simon, C., MeIntosh, C & Deniega, J. (1993). Standard Restriction Fragment Length Analysis of the Mitochondrial Genome is not Sensitive Enough for phylogenetic analysis or Identification of 17-year Periodical Cicada Broods (Hemiptera: Cicaditae): the Potential for a new Technique. Annals of the Entomological Society of America, 86, pp [18] Taylor. D.B & Peterson. R.D.II (1994), Population Genetics and Gene Variation in Primary and Secondary Screwworm (Diptera: Calliphoridae). Annals of the Entomological Society of America, 87, pp