Supporting Information

Transcription

1 Supporting Information Mirror bisulfite sequencing a method for single-base resolution of hydroxymethylcytosine Darany Tan #, Tzu Hung Chung #, Xueguang Sun *, Xi-Yu Jia. School of Life Sciences, Guangzhou University, Guangzhou, China.. Division of Human genetics, Cincinnati Children s Hospital Medical Center, 3333 Burnet Ave, Cincinnati, OH USA. Zymo Research Corporation, Murphy Ave., Irvine, CA USA #. These authors contributed equally to this work. *. Correspondence should be addressed to X.S. (sunxg00@gmail.com) S-1

2 Experimental Section Supporting Figures: Figure S1. Overview of Mirror-RRBS library preparation. Figure S2. Monitoring Mirror-RRBS 5hmC detection efficiency using spike-in controls. Figure S3. Mirror-seq libraries can be generated from as low as 1ng DNA input. Figure S4. Correlation analysis between Mirror-RRBS libraries generated from different inputs and at different read coverage cut-offs. Figure S5. Global 5hmC levels detected using Mirror-RRBS for various human tissues, a DKO cell line, and human tumor and normal liver samples. Figure S6. Human tissue-specific hydroxymethylated regions. Supporting Tables: Table S1. DNA sequence for the four library spike-in controls with various 5hmC levels Table S2. The average methylation and bisulfite conversion efficiency of the spike-in controls (1-4) for the various libraries. Table S3. Summary of library sequencing results. Table S4. Pearson s correlation analysis of sites with false 5hmC calling (>50X coverage) in negative control libraries. Table S5. Top 1000 sites with highest hydroxymethylation difference between the human brain tissue and other human tissues. Table S6. Top 1000 sites with highest hydroxymethylation difference between the human liver tissue and other human tissues. Table S7. Top 1000 sites with highest hydroxymethylation difference between the human kidney tissue and other human tissues Table S8. Top 1000 sites with highest hydroxymethylation difference between the human spleen tissue and other human tissues S-2

3 Experimental Section DNA samples. Human brain, liver, kidney, and spleen genomic DNA as well as a DKO cell line genomic DNA was obtained from Zymo Research. The paired liver samples, a tumor and a normal adjacent tissue, were obtained from ILSbio, and genomic DNA was extracted using the ZR Genomic DNA Tissue Miniprep (Zymo Research). RRBS library preparation. Libraries were generated by digesting and adapterizing 400ng of human brain genomic DNA (Zymo Research) with 40 U MspI (NEB), 400 U T4 DNA Ligase (NEB), 100 µm ATP, and 200 nm of methylated Illumina P5 and P7 TruSeq adapters at 21 C for 6 hrs. The libraries were size-selected on a 2.5% NuSieve/Agarose gel with ethidium bromide into small ( bp) and large ( bp) fragments and purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research). The libraries were then bisulfite converted using the EZ DNA Methylation Lightning Kit (Zymo Research) and amplified with 200 nm P5 and P7 barcoding primers in OneTaq Hot Start 2X Master Mix (NEB) with an initial denaturation of 94 C for 30 sec, 15 cycles of 94 C for 30 sec, 58 C for 30 sec, and 68 C for 1 min, and a final extension at 68 C for 5 mins. The amplified libraries were purified with the DCC-5 kit, and equal molarities of the small and large fragments were then pooled for each sample. Six libraries were multiplexed using equal masses and sequenced on Illumina HiSeq 2000 using 50 bp paired-end reads (Illumina). TAB-RRBS library preparation. MspI restriction enzyme (NEB) was used to digest 500 ng of human brain genomic DNA for 8 hrs and purified using the DCC-5 kit. The 5hmC sites were then glucosylated and purified with the DCC-5 kit using the same conditions as described above; βgt was omitted in the negative control samples. Following the manufacturer s recommendation, the sample was split into two TET oxidation reactions (Wisegene) with about ng in each to ensure complete TET oxidation since the human brain has greater than 3% methylation. The DNA was oxidized in a 50 µl reaction with 3.5 µl TET oxidation reagent 1 (Lot# 0615), 15 µl TET oxidation reagent 2 (Lot# 0815), and 3 µl TET1 protein (Batch 57) at 37 C for 1 hr. Proteinase K was added to the reaction and allowed to incubate at 50 C for 1 hr; the sample was S-3

4 purified with Micro-Bio Spin 30 (BioRad) followed by DCC-5. Methylated Illumina P5 and P7 TruSeq adapters were ligated onto the oxidized DNA fragments at 21 C for 6 hrs. Size-selection, bisulfite conversion, and library amplification were carried out using the same procedures as the RRBS and Mirror-RRBS library preparations S-4

5 Figure S-1. Overview of Mirror-RRBS library preparation. Adapter-ligated libraries first underwent single-strand synthesis with methylated primer which share the same sequence as one of the non-methylated adapters; this allowed the new strand to be distinguished from the parental strand and selectively amplified. The adapters of libraries that did not undergo single-strand synthesis would be bisulfite converted and not be amplified. Glucosylation of 5hmC sites would inhibit methylation of the complementary CpG site on the synthesized strand. Therefore, after bisulfite conversion and PCR amplification, the complementary CpG site would be sequenced as a T, indicating the presence of a 5hmC on the parental strand. S-5

6 Figure S-2. Monitoring Mirror-RRBS 5hmC detection efficiency using spike-in controls. Amplicons with known 5hmC% were spiked into genomic DNA prior to library preparation and sequenced. The experimental 5hmC ratio (n = 7) was compared with the real 5hmC ratio to determine the efficiency of Mirror-RRBS library preparation. S-6

7 Figure S-3. Mirror-seq libraries can be generated from as low as 1ng DNA input. (A) Libraries were generated from various amounts of DNA: 400ng, 200ng, 50 ng. Libraries that had the extension primer omitted from the reaction did not undergo strand extension and, therefore, were not amplified during the final library amplification. S-7

8 Libraries generated with unmethylated adapters cannot be amplified after bisulfite conversion. S = bp size-selected library fragments; L = bp size-selected library fragments, M = 50bp ladder (Zymo Research). (b) Lower DNA inputs require additional library amplification cycles to visualize and sequence. The libraries were prepared in parallel with additional cycles as necessary, diluted 1:15, and analyzed by 2200 Tapestation (Agilent) using the High Sensitivity D1000 tape. The bands at 133bp are adapter dimers that were generated during library preparation. S-8

9 Figure S4. Correlation analysis between Mirror-RRBS libraries generated from different inputs and at different read coverage cut-offs. Comparison of (A) 400A versus 400B, (B) 400A versus 200 ng, and (C) 400A versus 100ng showed that lower inputs can be used for Mirror-RRBS libraries without decreasing the quality of the data. Also, as the cutoffs for the read coverage increased, the Pearson s coefficient increased. S-9

10 Figure S5 Global 5hmC levels detected using Mirror-RRBS for various human tissues, a DKO cell line, and human tumor and normal liver samples. Human brain tissue had the highest 5hmC level while the DKO cell line had the lowest level. Global 5hmC levels were determined using CpG sites that overlapped in all libraries and had > 10X read coverage. control libraries were prepared for all tissues, except the tumor and normal liver samples, to determine the background levels. S-10

11 S-11

12 Figure S6. Human tissue-specific hydroxymethylated regions. Enrichment of 5hmC varied between (A) brain, (B) liver, (C) kidney, and (D) spleen tissues at different regions of the genome. CpGs sites analyzed were covered by at least 10 reads. S-12

13 Table S1. Spike-in E. Coli K12 Position 5hmC% Sequence* 1 chr:109, , CATCGTTGACGAACACACCGGTCGTACCATGCA GGGCCGTCGCTGGTCCGATGGTCTGCACCAGGC TGTGGAAGCGAAAGAAGGTGTGCAGATCCAGA ACGAAAACCAAACGCTGGCTTCGATCACCTTCC AGAACTACTTCCGTCTGTATGAAAAACTGGCGG GGATGACCGGTACTGCTGATACCGAAG 2 chr:138, , GATTGCTATTAGTGCCTCCGGTGCTTTGCCAGAC ACATTAAGTAGCCTGCCTGCGTTACCTTCGCTG GAAGGGCTGACGGTACGCAAGCTGCAACTCTCT ATGGACCCGATGCTCGATATGATGGGGATGCAG ATGCTAATGGAGAAATATGGCGATCAGGCGATG GCCGGGATGGATCACAG 3 chr:1,825,400-1,825,579 5 GAAACCTGAGTTGCCGGAACTTCTATCGCCATA AAACCATTGACCCGCGCACGCAGGTTTGCCAGT AACTGTGACTGGCGAGCGAACGCCTGTTGGTGG CAAAACAGCACCTGGCGGTTACTCACGGCAATC ACGTCATTATGAAAAACGCCCTGGTCGATAACG TCCGGGTTTTGCTGG 4 chr:2,351,088-2,351,262 0 GGTGAAAGTTCCGGATGGCACCGTTGATCCATT TCGTCTGACCGCAGCAAACATGCTGGATGCCAA AGAACACGGTGCCGTTATCCTTACCGCTCATGA AGTCACGGGGCTGATTCGTGAAGGCGCGACGGT GTGCGGTGTTCGTGTACGTAACCATCTCACCGG CGAAACTCAG *The underlined cytosine indicates the site with the hemi-hydroxymethylated cytosine. DNA sequence for the four library spike-in controls with various 5hmC levels. The spike-in controls were generated by amplifying short regions (approximately bp) from Escherichia coli K12 with two CCGG sites approximately 155bp apart (Supplementary Table 1). The spike-ins had a single 5hmCpG site, and it is located at the internal cytosine of the upstream CCGG site. This hydroxymethylated site was generated by synthesizing the forward primer to contain the 5hmC site at the desired position. The spike-in controls were amplified using ZymoTaq 2X Premix using either the forward primer with or without the 5hmC modification at the CCGG site. The thermal cycler S-13

14 condition was 95 C for 10 mins, 30 cycles at 95 C for 30 sec, 58 C for 30 sec, and 72 C for 1 min. The amplicons were purified using DCC-5 and quantified by quantitative PCR. The 5hmC and C amplicon of the same sequence were mixed to the desired 5hmC%, which was then spiked into the genomic DNA prior to library preparation. S-14

15 Table S2. The average methylation and bisulfite conversion efficiency of the spike-in controls (1-4) for the various libraries. Library Detected 5hmC Level (%) Average of all CpG Methylation Efficiency (%) Bisulfite Conversion Rate (%) A B A 400B ng ng Brain Brain Liver Liver Kidney Kidney Spleen Spleen DKO DKO Average across all four amplicons and samples 97.4 ± 0.3% methylation ± 0.03% conversion S-15

16 Table S3. Summary of library sequencing results. Sample Name Description Total Number of Reads Mapped Reads Mapping Efficiency Number of CpGs CpG Coverage (X) Bisulfite Conversion Rate 400A Brain - 400ng Input 46,960,960 24,518,920 52% 4,191, % 400B Brain - 400ng Input 50,608,194 26,514,680 52% 4,291, % 400A 400B Brain - 400ng Control Brain - 400ng Control 49,267,702 25,963,890 53% 4,234, % 49,941,605 26,502,907 53% 4,218, % 200ng Brain - 200ng Input 30,741,333 17,330,723 56% 3,661, % 100ng Brain - 100ng Input 33,838,901 18,856,361 56% 3,452, % Brain Brain Mirror-RRBS 19,971,351 12,559,262 63% 3,951, % Brain Brain Control 23,673,063 14,610,124 62% 4,033, % Liver Liver Mirror-RRBS 21,160,121 12,845,974 61% 4,851, % Liver Liver Control 20,327,869 12,476,037 61% 4,777, % Kidney Kidney Mirror-RRBS 22,180,107 12,867,488 58% 3,901, % Kidney Kidney Control 20,463,759 13,242,265 65% 3,929, % Spleen Spleen Mirror-RRBS 37,532,603 24,079,239 64% 4,289, % Spleen Spleen Control 34,430,610 21,987,780 64% 4,874, % DKO DKO Mirror-RRBS 27,555,032 18,239,252 66% 3,962, % DKO DKO Control 32,155,343 21,028,590 65% 4,069, % Tumor Liver Tumor liver 42,491,714 28,899,428 68% 4,448, % Normal Liver Normal liver 41,679,861 26,853,665 64% 4,446, % RRBS Brain - RRBS 39,464,740 23,821,862 60% 6,429, % RRHP Brain - RRHP 30,387,489 25,001,349 82% 1,797, N/A TAB-RRBS Brain TAB-RRBS 57,078,610 27,768,171 49% 6,850, % TAB-RRBS Brain TAB-RRBS 29,861,644 18,487,089 62% 6,260, % Control S-16

17 Table S4. Pearson s correlation analysis of sites with false 5hmC calling (>50X coverage) in negative control libraries. 400A 400B Brain Liver Kidney Spleen DKO 400A 400B Brain Liver Kidney Spleen DKO S-17