Computational design of a circular RNA with prion-like behavior
|
|
|
- Walter Tucker
- 5 years ago
- Views:
Transcription
1 Computational design of a circular RNA with prion-like behavior Stefan Badelt 1, Christoph Flamm 1 and Ivo L. Hofacker 1,2 {stef,xtof,ivo}@tbi.univie.ac.at 1 Institute for Theoretical Chemistry, University of Vienna, Währingerstraße 17/3, A-1090 Vienna, Austria 2 Research Group Bioinformatics and Computational Biology, University of Vienna, Währingerstraße 29, A-1090 Vienna, Austria July 31,
2 RNA and artificial life RNA functional diversity around 1980 discovery of catalytic RNA around 2000 Ribosome is an RNA Enzyme mirna as regulatory elements to inhibit translation Complexity of Organisms e.g. ratio RNA/Protein scales with complexity 2006: ENCODE, practically whole genome is transcribed RNA synthetic biology RNA world theory genetic material + enzymatic function engineering devices for altered gene expression aptazymes (switches + ribozymes) to control gene expression self-replicating RNA self-polymerizing RNA self-switching RNA bottom up Artificial life inspired by nature 2
3 Prions and conformational self-replication Prions are proteins known to be the infectious agents for several neurological diseases (e.g. Altzheimer, Creuzfeld-Jakob,...) The protein only hypothesis states that a single mis-folded infectious prion can convert the other correctly folded proteins to the infectious agent. PrP + N C PrP C N C PrP C N + N C N C N N N PrP C PrP Sc PrP C -PrP Sc PrP Sc -PrP Sc dimer PrP Sc oligomer heterodimer PrP Sc protofibril PrP Sc oligomer N PrP Sc N PrP Sc N PrP Sc Annu. Rev. Pathol. Mech. Dis : Downloaded from by University of Vienna - Main Library and Archive Services on 07/31/14. For personal use only. Can we design a minimal RNA with prion-like behavior? 3
4 Prions and conformational self-replication Requirements for an RNA prion Energy Landscape S1 normal S2 infectious free energy [kcal/mol] maximize refolding barrier E(B) S2 S1 MFE 4
5 Prions and conformational self-replication Requirements for an RNA prion Energy Landscape S1 normal S2 infectious free energy [kcal/mol] maximize refolding barrier E(B) S2 S1 MFE S1 S2 S2 S2 + HIV Dis type kissing loop komplex S1 S2 S2 S2 free energy [kcal/mol] MFE minimize refolding barrier E(B) S1 S2 S2 S2 4
6 Computational RNA folding Sequence Structure UGCGACGUCCGACCUCGUUUACGCCAGUACCCCACUUCUCUUUG 0 free energy [kcal/mol] MFE minimum free energy structure prediction folding pathways suboptimal structure prediction G = ktln(z) Z = S Ω e E(S) kt P(S) = e E(S) kt Z 5
7 Computational RNA design Structure Sequence (inverse of RNA folding problem) Simplest case: Find a sequence that forms a predefined structure structure is the MFE of the designed sequence maximize probability of the desired structure sequence must be biologically reasonable (GC content) Even harder: Find a sequence that forms two predefined structures sequence must be bi-stable (like a Prion).(((.((.(((...))).)).))) (((...)))((...))((...)). 6
8 Computational Prion design switch.pl with two conformations and HIV-Dis loop...(((((((..((((...(((((...)))))...))))..))))))) (((((((...)))))))...((((((...)))))). NNNNNNNAACCGACGANNNNNNNNNNNNNNNNNAACGUCGGANNNNNNN Generate lots of sequences (128 different results) Select candidate with required prion features 7
9 Evaluation of prion-like behavior dup M c c S S Z M... Partition function of the Monomer Z c1... Partition function constrained that c1 (cyan) is unpaired Z c2... Partition function constrained that c2 (green) is unpaired Z S1... Partition function constrained that S1 can form Z S2... Partition function constrained that S2 can form Z dup... Partition function constrained that duplex can form 8
10 Evaluation of prion-like behavior dup M Z M... Partition function of the Monomer Z c1... Partition function constrained that c1 (cyan) is unpaired Z c2... Partition function constrained that c2 (green) is unpaired Z S1... Partition function constrained that S1 can form Z S2... Partition function constrained that S2 can form Z dup... Partition function constrained that duplex can form 8
11 Evaluation of prion-like behavior dup M Partition function of the Dimer: Z D = Z c1 Z c2 Z dup (1) Partition function of all Structures that are neither S1 nor S2: Z!S1 &!S2 = Z M Z S1 Z S2 Equilibrium Constant for Dimerization: [M]+[M] [D] K = [D] [M] 2 = Z D Z 2 M 9
12 Evaluation of prion-like behavior 1 e number of species Monome ) Dime ) 0 1e-09 1e-08 1e concentra K[D] = [M] [M] 10
13 Evaluation of prion-like behavior & Z$" Z$# M e number of species *-2 *-+ *-/ Monom :;< Dim :;< =84>?8>43 A O8B34 584>?8>43s Z!" Z dup *-. Z!# 0 1e-09 1e-08 1e-0% &'(*+ &'(*, *-***& *-**& *-*& *-& & concentra [S1] = Z ( S1 ZS1+c1 [M]+ Z M Z c1 + Z ) S1+c2 [D] (2) Z c2 [S2] = Z ( S2 ZS2+c1 [M]+ + Z ) S2+c2 [D] Z M Z c1 Z c2 11
14 Evaluation of prion-like behavior S1 and S2 are separated by a high energy barrier: S kcal/mol free energy [kcal/mol] kcal/mol S kcal/mol length of refolding path [base-pair moves] 12
15 Evaluation of prion-like behavior S2 catalyzes reaction from S1 to S2: S kcal/mol S1 + S kcal/mol free energy [kcal/mol] kcal/mol kcal/mol kcal/mol kcal/mol kcal/mol 6.00 kcal/mol Energy Model 1 Energy Model kcal/mol kcal/mol S kcal/mol S2 + S2 + kiss length of refolding path [base-pair moves] 12
16 Evaluation of prion-like behavior S2 catalyzes reaction from S1 to S2: S kcal/mol S1 + S kcal/mol free energy [kcal/mol] kcal/mol kcal/mol kcal/mol kcal/mol kcal/mol 6.00 kcal/mol Energy Model 1 Energy Model kcal/mol kcal/mol length of refolding path [base-pair moves] S kcal/mol S2 + S2 + kiss CD EF CGH GIJKL MNPQRTUQ CG EF CDH GVJIL MNPQRTUQ CG EF CDH WJXL MNPQRTUQ 12
17 Summary RNAprions are a from of conformational self-replication Computatinal RNA folding and design HIV-Dis loops can be used to favor the infectious conformation for dimers Different energy models for refolding pathways all show that S2 can act as a catalyst 13
18 thanks to This work: Ivo L. Hofacker Christoph Flamm General: Sabine Müller Peter F. Stadler the TBI group Flamm et al. (2001) Design of multi-stable RNA Molecules Weixlbaumer et al. (2004) Determination of Thermodynamic Parameters for HIV-1 DIS Type Loop-Loop Kissing Complexes Lorenz et al. (2011) ViennaRNA Package 2.0 The research was funded by the Austrian Science Fund (FWF): W1207-B09, I670-B11 14
19 Computational RNA folding GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA Acceptor Stem D-Loop T-Loop A secondary structure is a list of base pairs (i,j), where: A base may participate in at most one base pair. Base pairs must not cross, i.e., no two pairs (i,j) and (k,l) may have i < k < j < l. Only isosteric base-pairs GC,CG,AU,UA,GU,UG are allowed. Hairpin loops have at least length 3 ( j i > 3) 15
20 Computational RNA folding H I M I I H E(S) = l S E(l) I I H loop I p M Nearest Neighbor Energy Model: The free energy E of a secondary structure S is the sum of the energies of its loops l Energies depend on loop type and size, with some sequence dependence. Most relevant parameters are measured experimentally. 16
21 Computational RNA design switch.pl in a nutshell: build a dependency graph mutate an initial sequence guided by dependency graph accept/reject mutations according to a cost function.(((.((.(((...))).)).))) (((...)))((...))((...)). Cost Function: E(x,S 1 )+E(x,S 2 ) 2G(x)+ξ(E(x,S 1 ) (E(x,S 2 )+ǫ)) 2 17
Computational design of a circular RNA with prion-like behavior
Computational design of a circular RNA with prion-like behavior Stefan Badelt 1, Christoph Flamm 1 and Ivo L. Hofacker 1,2 {stef,xtof,ivo}@tbi.univie.ac.at 1 Institute for Theoretical Chemistry, University
NMR Structural Profiling of Transcriptional Intermediates Reveals Riboswitch Regulation by Metastable RNA Conformations.
Supporting Information for: NMR Structural Profiling of Transcriptional Intermediates Reveals Riboswitch Regulation by Metastable RNA Conformations. Christina Helmling, Anna Wacker, Michael T. Wolfinger,,
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,
COMP598: Advanced Computational Biology Methods & Research
COMP598: Advanced Computational Biology Methods & Research Introduction to RNA secondary structure prediction Jérôme Waldispühl School of Computer Science, McGill RNA world In prebiotic world, RNA thought
Genotype-Phenotype Maps: from molecules to simple cells
Genotype-Phenotype Maps: from molecules to simple cells Camille Stephan-Otto Attolini Institute for Theoretical Chemistry, University of Vienna, Austria Vienna, February 28th, 2006 The Genotype-Phenotype
RNA Folding Algorithms with G-Quadruplexes
R Folding lgorithms with -Quadruplexes Ronny Lorenz 1, Stephan. Bernhart 2, Fabian Externbrink 2, Jing Qin 4, hristian öner zu Siederdissen 1, Fabian mman 1, ndrea Tanzer 7, Ivo L. ofacker 1,3, and Peter
Structural Bioinformatics (C3210) Conformational Analysis Protein Folding Protein Structure Prediction
Structural Bioinformatics (C3210) Conformational Analysis Protein Folding Protein Structure Prediction Conformational Analysis 2 Conformational Analysis Properties of molecules depend on their three-dimensional
A novel theophylline triggered RNaseP riboswitch. Stefan Hammer Bled 2018
A novel theophylline triggered RNaseP riboswitch Stefan Hammer Bled 2018 Transcription/Translation 3' RNA polymerase DNA helix 3' factor trnas Ribosomes Tyr Phe Met RNA strand Translation Proteins + NH3
RIsearch2. Large-scale RNA RNA interaction prediction. Anne Wenzel. Center for non-coding RNA in Technology and Health
t e ersitet university of copenhagen f a c u lt y o f h e a lt h a n d m e d i c a l s c i e n c e s RIsearch2 Large-scale RNA RNA interaction prediction Anne Wenzel Center for non-coding RNA in Technology
Prediction of noncoding RNAs with RNAz
Prediction of noncoding RNAs with RNAz John Dzmil, III Steve Griesmer Philip Murillo April 4, 2007 What is non-coding RNA (ncrna)? RNA molecules that are not translated into proteins Size range from 20
RNA secondary structure prediction and analysis
RNA secondary structure prediction and analysis 1 Resources Lecture Notes from previous years: Takis Benos Covariance algorithm: Eddy and Durbin, Nucleic Acids Research, v22: 11, 2079 Useful lecture slides
RNA Structure Prediction. Algorithms in Bioinformatics. SIGCSE 2009 RNA Secondary Structure Prediction. Transfer RNA. RNA Structure Prediction
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
RNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
RNA Structure Prediction and Comparison. RNA Biology Background
RN Structure Prediction and omparison Session 1 RN Biology Background Robert iegerich Faculty of Technology robert@techfak.ni-bielefeld.de October 13, 2013 Robert iegerich Overview of lecture topics The
Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
RNA Structure Prediction and Comparison. RNA Biology Background
RN Structure Prediction and omparison Session 1 RN Biology Background édric Saule Faculty of Technology cedric.saule@ni-bielefeld.de pril 13, 2015 édric Saule Overview of lecture topics The lecture plan
Introduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
Chapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
RNA folding & ncrna discovery
I519 Introduction to Bioinformatics RNA folding & ncrna discovery Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Non-coding RNAs and their functions RNA structures RNA folding
Current Status and Future Prospects p. 46 Acknowledgements p. 46 References p. 46 Hammerhead Ribozyme Crystal Structures and Catalysis
Ribozymes and RNA Catalysis: Introduction and Primer What are Ribozymes? p. 1 What is the Role of Ribozymes in Cells? p. 1 Ribozymes Bring about Significant Rate Enhancements p. 4 Why Study Ribozymes?
Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
Chapter 11. Transcription. The biochemistry and molecular biology department of CMU
Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be
Chapters 31-32: Ribonucleic Acid (RNA)
Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine
produces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
Figure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
RNA folding and its importance. Mitesh Shrestha
RNA folding and its importance Mitesh Shrestha Diseases Caused due to Protein Misfolding Alzheimer s Disease Parkinson s Disease Cataracts Sickle Cell Disease Prion Diseases Cystic Fibrosis Ribozymes Ribonucleic
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
Genetics. Chapter 9 - Microbial Genetics. Chromosome. Genes. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 - Microbial Genetics Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Genetics Genome (The sum total of genetic material of a cell is referred to as the genome.) Chromosome
DNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav
DNA Structure and Properties Basic Properties Predicting Melting Temperature Dinesh Yadav Nucleic Acid Structure Question: Is this RNA or DNA? Molecules of Life, pp. 15 2 Nucleic Acid Bases Molecules of
RNA Secondary Structure Prediction
RNA Secondary Structure Prediction Outline 1) Introduction: RNA structure basics 2) Dynamic programming for RNA secondary structure prediction The Central Dogma of Molecular Biology DNA CCTGAGCCAACTATTGATGAA
Section 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
Chapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
From Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
Genes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
Transcription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
microrna Shifra Ben-Dor March 2010
microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target
Biotechnology Unit: Viruses
Biotechnology Unit: Viruses What do you see here? What is the cause: bacteria or virus? In the late 1800 s Martinus Beijerinck performed this experiment and saw that something smaller than bacteria was
Expression of the genome. Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell
Expression of the genome Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell 1 Transcription 1. Francis Crick (1956) named the flow of information from DNA RNA protein the
RNA Secondary Structure Prediction Computational Genomics Seyoung Kim
RNA Secondary Structure Prediction 02-710 Computational Genomics Seyoung Kim Outline RNA folding Dynamic programming for RNA secondary structure prediction Covariance model for RNA structure prediction
Computational Genomics. Reconstructing signaling and dynamic regulatory networks
02-710 Computational Genomics Reconstructing signaling and dynamic regulatory networks Input Output Hidden Markov Model Input (Static transcription factorgene interactions) Bengio and Frasconi, NIPS 1995
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
Part II ORIGIN OF LIFE
Part II ORIGIN OF LIFE BIO 111 Biological Diversity and Evolution Varsha 2017 Ullasa Kodandaramaiah 23/08/17 Simplest life forms today have: nucleic acids store information proteins capture energy, replicate
Delve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,
Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
RNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm
RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 13 Protein Synthesis
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 13 Protein Synthesis 2 3 4 5 6 7 8 9 10 Are You Getting It?? Which properties are characteristic of the normal genetic code? (multiple answers) a) A
DNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE
DNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE Recommended reading: The Double Helix: A Personal Account of the Discovery of the Structure of DNA, by James D.
BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
Chapter 18. Viral Genetics. AP Biology
Chapter 18. Viral Genetics AP Biology What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron microscope size smaller than ribosomes ~20 50 nm
The Transition to Life
The Transition to Life The Transition to Life Chemical Evolution? Biological Evolution Interacting Chemicals Reproduction of Organisms Natural Selection Based on Simplest Life Now: Need: 1. Nucleic Acids
The Transition to Life
The Transition to Life The Transition to Life Chemical Evolution? Biological Evolution Interacting Chemicals Reproduction of Organisms Natural Selection 1 Based on Simplest Life Now: Need: 1. Nucleic Acids
BIOLOGICAL SCIENCE. Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge. FIFTH EDITION Freeman Quillin Allison
BIOLOGICAL SCIENCE FIFTH EDITION Freeman Quillin Allison 4 Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge In this chapter you will learn that Nucleic acids store the
Molecular biology WID Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background:
Molecular biology WID 602 - Masters of Science in Tropical and Infectious Diseases-Transcription Lecture Series RNA I. Introduction and Background: DNA and RNA each consists of only four different nucleotides.
MODULE: PRINCIPLES OF EVOLUTIONARY BIOLOGY. Part II ORIGIN OF LIFE
MODULE: PRINCIPLES OF EVOLUTIONARY BIOLOGY Part II ORIGIN OF LIFE BIO 111 Biological Diversity and Evolution Varsha 2018 Ullasa Kodandaramaiah Simplest life forms today have: nucleic acids (RNA/DNA) store
Nucleic Acids and the RNA World. Pages Chapter 4
Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently
O C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
The Vienna RNA Websuite
W70 W74 Nucleic Acids Research, 2008, Vol. 36, Web Server issue Published online 19 April 2008 doi:10.1093/nar/gkn188 The Vienna RNA Websuite Andreas R. Gruber 1, Ronny Lorenz 1, Stephan H. Bernhart 2,
RNA World Hypothesis and RNA folding. By Lixin Dai
RNA World Hypothesis and RNA folding By Lixin Dai Outline: RNA World Hypothesis RNA structure primary secondary tertiary Folding of RNA structure Problems with the folding Solutions RNA World Hypothesis:
CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
COMP 555 Bioalgorithms. Fall Lecture 1: Course Introduction
COMP 555 Bioalgorithms Fall 2014 Jan Prins Lecture 1: Course Introduction Read Chapter 1 and Chapter 3, Secns 3.1-3.7 1 Intended Audience COMP 555: Bioalgorithms Suitable for both undergraduate and graduate
NCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence
NCEA Level 2 Biology (91159) 2017 page 1 of 6 Assessment Schedule 2017 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Excellence Demonstrate understanding
A primer on the structure and function of genes
A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences
Nucleic Acids and the Encoding of Biological Information. Chapter 3
Nucleic Acids and the Encoding of Biological Information Chapter 3 GRIFFITH S EXPERIMENT ON THE NATURE OF THE GENETIC MATERIAL In 1928, Frederick Griffith demonstrated that molecules can transfer genetic
Chapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis
Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the
Transcription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
DNA: STRUCTURE AND REPLICATION
DNA: STRUCTURE AND REPLICATION DNA was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation
Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
BASIC MOLECULAR GENETIC MECHANISMS Introduction:
BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:
DNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics
A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these
BIO 101 : The genetic code and the central dogma
BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;
STOCHASTIC CONTEXT-FREE GRAMMARS METHOD AIDED CALCULATION OF THE LOCAL FOLDING POTENTIAL OF TARGET RNA
International Journal of Bio-Technology and Research (IJBTR) ISSN(P): 2249-6858; ISSN(E):2249-694X Vol. 3, Issue 5, Dec 2013, 1-10 TJPRC Pvt. Ltd. STOCHASTIC CONTEXT-FREE GRAMMARS METHOD AIDED CALCULATION
Thermodynamic criteria for high hit rate antisense oligonucleotide design
Nucleic Acids Research, 2003, Vol. 31, No. 17 4989±4994 DOI: 10.1093/nar/gkg710 Thermodynamic criteria for high hit rate antisense oligonucleotide design O. V. Matveeva*, D. H. Mathews 1, A. D. Tsodikov
We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
COMP364. Introduction to RNA secondary structure prediction. Jérôme Waldispühl School of Computer Science, McGill
COMP364 Introduction to RNA secondary structure prediction Jérôme Waldispühl School of Computer Science, McGill RNA world In prebiotic world, RNA thought to have filled two distinct roles: 1. an information
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
Module I: Introduction
Module I: Introduction 20.109 Lecture 1 3 February, 2011 Introduction to: Module Overview Fundamental concepts and techniques in molecular biology Appreciating nucleic acids (RNA in particular) as more
AP Biology Book Notes Chapter 3 v Nucleic acids Ø Polymers specialized for the storage transmission and use of genetic information Ø Two types DNA
AP Biology Book Notes Chapter 3 v Nucleic acids Ø Polymers specialized for the storage transmission and use of genetic information Ø Two types DNA Encodes hereditary information Used to specify the amino
Gene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 19 Viruses PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
Biotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
BCH Graduate Survey of Biochemistry
BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Marsha Durosier Lecture 17 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html
Therapeutic & Prevention Application of Nucleic Acids
Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers
The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
From RNA To Protein
From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution
Applicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
Molecular Basis of Inheritance
Molecular Basis of Inheritance Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Answer Nitrogenous bases present in the
UNIT 3 GENETICS LESSON #41: Transcription
UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have
Basic Concepts and History of Genetic Engineering. Mitesh Shrestha
Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique
Assessment Schedule 2014 Biology: Demonstrate understanding of gene expression (91159)
NCEA Level 2 Biology (91159) 2014 page 1 of 5 Assessment Schedule 2014 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Excellence Demonstrate understanding
Positional Preference of Rho-Independent Transcriptional Terminators in E. Coli
Positional Preference of Rho-Independent Transcriptional Terminators in E. Coli Annie Vo Introduction Gene expression can be regulated at the transcriptional level through the activities of terminators.