DNA-conjugated Amphiphilic Aggregation-induced Emission Probe for Cancer Tissue Imaging and Prognosis Analysis

Transcription

1 DNA-conjugated Amphiphilic Aggregation-induced Emission Probe for Cancer Tissue Imaging and Prognosis Analysis Xudong Wang, a# Jun Dai, a# Xuehong Min, a Zhihua Yu, a Yong Cheng, a Kaixun Huang, a Juliang Yang, b Xiaoqing Yi, b Xiaoding Lou *b and Fan Xia *ab a Hubei Key Laboratory of Bioinorganic Chemistry & Materia Medica, School of Chemistry and Chemical Engineering, Department of Obstetrics and Gynecology, Tongji Hospital Tongji Medical College, Institute of Pathology of Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan , P. R. China. b Engineering Research Center of Nano-Geomaterials of Ministry of Education, Faculty of Materials Science and Chemistry, China University of Geosciences, 388 Lumo Road, Wuhan , P. R. China louxiaoding@cug.edu.cn xiafan@hust.edu.cn; xiafan@cug.edu.cn S-1

2 Table of contents General procedures. Scheme S1. The main synthetic routes of TPE-R-N 3. Figure S1. HRMS (MALDI-TOF) of compound TPE-R-N 3. Table S1. DNA sequences used in this experiment. Figure S2. Stability of TPE-R-DNA. Figure S3. PAGE analysis. Figure S4. The relative fluorescence intensity of TPE-R-DNA in BSA, trypsin, Bst DNA polymerase (Bst) and PBS in the presence of Exo III. Table S2. Comparison between the current mrna assay and other previously reported mrna detection methods. Figure S5. Fluorescence response of TPE-R-DNA toward perfect match (PM), single mismatched targets and triple mismatched targets. Figure S6 The cytotoxicity of Exo III. Figure S7. The relative intensity of TPE-R-DNA in the presence of PBS, the supernatant from that Exo III incubated with cells at 37 for 1h and then collected and Exo III. Figure S8. CLSM images of Hela cells with cordycepin stimulation for different time and then incubated with the TPE-R-DNA and exonuclease III for 1h. Figure S9. CLSM images of Hela cells with LPS stimulation for different lengths of time and then incubated with the TPE-R-DNA and exonuclease III for 1h. Figure S10. CLSM images of MCF 7 cells with cordycepin stimulation for different lengths of time and then incubated with the TPE-R-DNA and exonuclease III for 1h. Figure S11. CLSM images of MCF 7 cells with LPS stimulation for different lengths of time and then incubated with the TPE-R-DNA and exonuclease III for 1h. S-2

3 Figure S12. CLSM images of mrna in MCF-7 cells under different conditions. Cells were pretreated with cordycepin, PBS or LPS (10 objective). Figure S13. CLSM images of mrna in MCF-7 cells under different conditions. Cells were pretreated with cordycepin, PBS or LPS (10 objective). Figure S14. Fluorescence images of mrna in MCF-7 cells under different conditions. Cells were pretreated with cordycepin, PBS or LPS (5 objective). Figure S15. PCR analysis of MnSOD mrna expression level. Figure S16. CLSM images of renal cancer and its adjacent normal tissue incubated with the TPE-R-DNA and exonuclease III for 1h. Table S3. The relative fluorescence intensity of cancer tissue (Ca.) and its adjacent normal tissue (AT). S-3

4 Synthesis of TPE-R-N 3. 1 was synthesized according to the procedures in literatures. 1 2 was synthesized according to the procedures in literatures. 2 A mixture of 1 (103.5 mg, 0.5 mmol) and 2 (210.1 mg, 0.5 mmol) in dry EtOH (15 ml) was refluxed under nitrogen for 48 h. After cooling, the solvent was then removed under vacuum. The solid was dissolved in acetone (5 ml) and then a saturated aqueous solution of KPF 6 (5 ml) was added. After stirring was continued at room temperature for 30 min, the solvent was removed under a reduced pressure to obtain the crude product. The crude was purified by chromatography on silica gel, eluting with dichloromethane to afford TPE-R-N 3 as a red solid (84.9 mg, 23%). HRMS Calcd. For C 39 H 37 N 4 O 2 : [M] +, Found: Scheme S1. The main synthetic routes of TPE-R-N 3. S-4

5 Figure S1. HRMS (MALDI-TOF) of compound TPE-R-N 3. Table S1. DNA sequences designed in this work. Name Sequence (5 to 3 ) Target SM Target TM Target TPE-R-DNA H-SOD2-F H-SOD2-R AAT CAA CTG GGA GAA TGT AAC TG AAT CAA CTC GGA GAA TGT AAC TG AAT CAA ATC CGA GAA TGT AAC TG TPE-R- ATT CTC CCA GTT GAT T CCGACCTGCCCTACGACTA ACGCCTCCTGGTACTTCTCC S-5

6 Figure S2. (A) The relative fluorescence intensity of TPE-R-DNA in the presence of salt (20 mm Tris-HCl, 150 mm NaCl and 5 mm MgCl 2 ), Bst DNA polymerase (16 U), ph=7.4, ph=6.0, ATP (2 mm), cell lysates and serum for 1h. (B) PAGE analysis of TPE-R-DNA in the presence of (a) water and (b) salt (20 mm Tris-HCl, 150 mm NaCl and 5 mm MgCl 2 ), (c) Bst DNA polymerase (16 U), (d) ph=7.4, (e) ph=6.0, (f)atp (2 mm), (g) cell lysates and (h) serum for 1h. Figure S3. PAGE analysis: Lane a, marker; Lane b, target; Lane c, Alk-DNA; Lane d, TPE-R-DNA+ target; Lane e, TPE-R-DNA + target; Lane f, TPE-R-DNA + Exo III + 1nM target. S-6

7 Figure S4. The relative fluorescence intensity of TPE-R-DNA (10 µm) in BSA (10 mg/l), trypsin (10 nm), Bst DNA polymerase (Bst) (16U) and PBS in the presence of Exo III (300 U). Table S2. Comparison between the current mrna assay and other previously reported mrna detection methods. Method System Detection limit Reference Fluorescence upconversion nanobeacon 1.1nM Fluorescence bhcr circuit 500 fm Fluorescence DNA tetrahedron 1.2 nm Fluorescence HCR-based nanosensor 0.5 pm Electrochemical magnetic separation and bdna 0.68 pm 7 detection amplification technology S-7

8 Figure S5. Fluorescence response of TPE-R-DNA (10 µm) toward perfect match (PM) (1 nm), single mismatched targets (1 nm) and triple mismatched targets (1 nm) in the presence of 300U Exo III. Figure S6 The cytotoxicity of Exo III was tested with Hela cells by MTT assay. MCF-7 cells were incubated with Exo III of different concentration (0, 0.5, 0.75, 1.0, 1.5, 2 U/µL) for 24h. S-8

9 Figure S7. The relative intensity of TPE-R-DNA in the presence of (A) PBS, (B) the supernatant from that Exo III (300 U) incubated with cells at 37 for 1h and then collected and (C) Exo III (300 U). S-9

10 Figure S8. CLSM images of Hela cells with cordycepin (150 µg/ml) stimulation for 1h (A), 2h (B) and 3h (C) and then incubated with the TPE-R-DNA (6.6 µm) and exonuclease III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. The fluorescence intensity ratio of TPE-R-DNA to Hoechst (F T /F H ) at treatment with cordycepin for (D) 1h, (E) 2h and (F) 3h. Scale bar: 20 µm. S-10

11 Figure S9. CLSM images of Hela cells with LPS stimulation for different lengths of time (1h (A), 2h (B) and 4h (C)), and then incubated with the TPE-R-DNA (6.6 µm) and exonuclease III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. The ratio of fluorescence intensity of TPE-R-DNA to Hoechst (F T /F H ) at at treatment with LPS for (D) 1h, (E) 2h and (F) 3h.. Scale bar: 20µm. S-11

12 Figure S10. CLSM images of MCF 7 cells with cordycepin stimulation for different lengths of time (1h (A), 2h (B) and 3h (C)), and then incubated with the TPE-R-DNA (6.6 µm) and exonuclease III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. The ratio of fluorescence intensity of TPE-R-DNA to Hoechst (F T /F H ) at treatment with cordycepin for (D) 1h, (E) 2h and (F) 3h. Scale bar: 20 µm. S-12

13 Figure S11. CLSM images of MCF 7 cells with LPS stimulation for different lengths of time (1h (A), 2h (B) and 4h (C)) and then incubated with the TPE-R-DNA (6.6 µm) and exonuclease III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. The ratio of fluorescence intensity of TPE-R-DNA to Hoechst (F T /F H ) at treatment with LPS for (D) 1h, (E) 2h and (F) 4h. Scale bar: 20µm. S-13

14 Figure S12. CLSM images of mrna in MCF-7 cells under different conditions. Cells were pretreated with (A) 150 µg/ml cordycepin, (B) PBS or (C) 10 µg/ml LPS for 2 h and then incubated with the TPE-R-DNA (6.6 µm) and Exo III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. The relative fluorescence intensity of (D) cordycepin, (E) PBS or (F) LPS. The fluorescence images were collected at red channel ranging from 550 to 650 nm with an excitation at 488nm. Scale bar: 50µm. S-14

15 Figure S13. CLSM images of mrna in MCF-7 cells under different conditions. Cells were pretreated with (A) 150 µg/ml cordycepin, (B) PBS or (C) 10 µg/ml LPS for 2 h and then incubated with the TPE-R-DNA (6.6 µm) and Exo III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. The relative fluorescence intensity of (D) cordycepin, (E) PBS or (F) LPS. The fluorescence images were collected at red channel ranging from 550 to 650 nm with an excitation at 488nm.Scale bar: 50µm. S-15

16 Figure S14. Fluorescence images of mrna in MCF-7 cells under different conditions. Cells were pretreated with (A) 150 µg/ml cordycepin, (B) PBS or (C) 10 µg/ml LPS for 2 h and then incubated with the TPE-R-DNA (6.6 µm) and Exo III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. (D) The relative fluorescence intensity of cordycepin, PBS or LPS. Scale bar: 200 µm. Figure S15. Real time quantitative PCR analysis of MnSOD mrna expression level in MCF-7 cells treated with PBS, 150 µg/ml cordycepin or 10 µg/ml LPS for 2 h. S-16

17 Figure S16. CLSM images of renal cancer and its adjacent normal tissue incubated with the TPE-R-DNA (6.6 µm) and exonuclease III (1.33 U/µL) for 1h under the standard cell culture conditions, respectively. Scale bar: 1mm. Table S3. The relative fluorescence intensity of renal cancer tissue (Ca.) and its adjacent normal tissue (AT). S-17

18 References: 1. X. Min, M. Zhang, F. Huang, X. Lou and F. Xia, ACS Appl. Mater. Inter. 2016, 8, N. Pradhan, D. Jana, B. K. Ghorai and N. R. Jana, ACS Appl. Mater. Inter. 2015, 7, Q. Ding, Q. Zhan, X. Zhou, T. Zhang and D. Xing, Small, 2016, 12, L. Liu, J. W. Liu, H. Wu, X. N. Wang, R. Q. Yu and J. H. Jiang, Anal. Chem., 2018, 90, S. Wang, M. Xia, J. Liu, S. Zhang and X. Zhang, Acs Sensors, 2017, 2, Wu, Z.; Liu, G. Q.; Yang, X. L.; Jiang, J. H. J. Am. Chem. Soc. 2015, 137, Mao, X.; Liu, G.; Wang, S.; Lin, Y.; Zhang, A.; Zhang, L.; Ma, Y. Electrochem. Commun. 2008, 10, S-18