Introducing Your Students To Gene Editing With CRISPR

Transcription

1 Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek

2 EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education! EDVOTEK Educ

3 EDVOTEK The Biotechnology Education Company Experiments Reagents Equipment Resources

4 What is CRISPR? In this experiment, students will simulate the use of CRISPR-Cas9 to target a genetic mutation found in a patient suffering from Cystic Fibrosis. Students will develop an understanding of guide RNA (grna) design, and use agarose gel electrophoresis to examine pre-prepared DNA samples after CRISPR treatment. Cat. # 119 Adapted from J Levin W, Wikimedia. CC BY-SA 4.0

5 What is CRISPR? Clustered Regularly Interspaced Short Palindromic Repeats CRISPR is a short series of repeating DNA segments with unique spacer sequences sitting between them. Serves as a basic immune system in bacteria Functions with Cas (CRISPR associated) enzymes to specifically target DNA Cat. # 119

6 What is CRISPR? CRISPR works by incorporating viral DNA sequences into the spacer regions, becoming a memory of previous viral attacks. Cat. # 119 Adapted from Thomas Splettstoesser, Wikimedia. CC BY-SA 3.0

7 The spacer regions are transcribed into short RNA sequences known as CRISPR RNAs or crrna. What is CRISPR? The crrnas exist in the bacteria and can bind to a complementary DNA sequence if found (say from a viral infection). Once bound to a target the RNA can recruit a Cas protein to the DNA The Cas protein can specifically digest the bound DNA Cat. # 119

8 Exploring CRISPR in your Classroom Students will simulate the use of CRISPR-Cas9 to target a specific genetic mutation found in a patient suffering from Cystic Fibrosis. Develop an understanding of guide RNA (grna) design and CRISPR-Cas9 targeting of specific DNA sequences. Use agarose gel electrophoresis to analyze pre-prepared DNA samples. Cat. #135

9 What Do I Need to Perform Electrophoresis Experiments? Horizontal electrophoresis apparatus D.C. power source Micropipet or transfer pipet Agarose Electrophoresis Buffer LabStation TM #5062 Samples dye, DNA, RNA PCR products A way to visualize samples

10 Casting the Agarose Gel

11 Performing Electrophoresis

12 Let s run our gels! Load 35 microliters of sample per well.

13 Electrophoresis Chambers for Classrooms of all Sizes Cat. # 502 Model M12 Two gels Cat. # 515 Model M36 Six gels

14 Power Supplies Provide Current for Electrophoresis Cat. #509 DuoSource 150 (75/150 V) Cat. #5010 QuatraSource (10-300V)

15 Designing guide RNA (grna) to target a specific DNA sequence CRISPR grna is made up of two parts: crispr RNA (crna) and tracrrna crna contains the unique 17-20nt RNA that is complementary to the target DNA tracrrna forms a scaffold that can associate with the Cas protein There are also single guide RNAs (sgrna) available that are a single RNA molecule containing both a crna and tracrrna

16 Designing guide RNA (grna) to target a specific DNA sequence The crna will be designed with two criteria in mind: 1) The sequence must be complementary to the target DNA sequence 2) There must be a PAM site immediately downstream (in the 3 direction) of the complementary DNA sequence.

17 Protospacer Adjacent Motif (PAM) Sequences PAM sequences are short DNA sequences that are recognized by specific Cas proteins. Each Cas enzyme will have a different PAM sequence that is recognized For Cas9 the PAM is: 5 -NGG-3 ( N can be any nucleotide base)

18 Putting it all together to design a grna 1) Determine the PAM sequence based on the Cas enzyme being used. If we are designing a grna for Cas9 we know that the PAM has to be NGG, so the possible options are: AGG TGG CGG GGG 2) Examine the DNA sequence immediately upstream (in the 5 direction) for a 20 nt sequence.

19 Putting it all together to design a grna Target DNA: 5 ACCTCAGTAGCTACTAGTTTACAGTCATAAGGTGA 3 3 TGGAGTCATCGATGATCAAATGTCAGTATTCCACT 5 Sample Name Target Sequence (Spacer) PAM sequence grna #1 GCTACTAGTTTACAGTCATA AGG 1. Find the complementary nucleotides to the target DNA. 2. Identify PAM sites. 3. Record the 20 nt upstream of the PAM site, this is the target sequence.

20 Module I: Designing grna to Target CFTR

21

22 Module I: Designing grna to Target CFTR

23 Using CRISPR in Gene Therapy CRISPR-Cas allows scientists and doctors to specifically target DNA sequences for cleavage. Cas9 cuts both strands of DNA (doublestranded break). Other Cas enzymes, or modified versions of Cas9, may cut differently DNA repair machinery will try to repair the break along with the resulting potential mutations that can arise. This makes it great for knocking out a gene!

24 Using CRISPR in Gene Therapy What if we need to very carefully repair an already mutated gene? Homology Directed Repair (HDR) allows scientists to provide a template for DNA repair at the double-stranded break. Sequence of correct DNA is flanked by homologous DNA sequences. CRISPR-Cas9 digested DNA is then repaired using the template to introduce the correct sequence.

25 Using CRISPR in Gene Therapy In this experiment we are using CRISPR as a therapeutic for William, a patient suffering from Cystic Fibrosis. William has a large deletion in his CFTR gene which results in a misfolded, inactive protein. William s doctors would like to use CRISPR to repair the gene deletion.

26 Using CRISPR in Gene Therapy The doctors are hoping to use CRISPR-cas9 to cleave the DNA around the site of William s mutation, and then repair using HDR and a template strand of DNA.

27 Summary of Electrophoresis

28 Electrophoresis Separates DNA Fragments By Size The sugar-phosphate backbone of DNA has a strong negative charge. A B C When an electrical current is passed through the gel, the current drives the DNA fragments through the gel towards the positive electrode.

29 Electrophoresis Separates DNA Fragments By Size The gel contains small channels through which the DNA can pass. A B C Small DNA fragments move through these holes easily, but large DNA fragments have a more difficult time squeezing through the tunnels.

30 Electrophoresis Separates DNA Fragments By Size Because molecules of different sizes travel at different speeds, discrete bands are formed. A B C After the current is stopped, the bands can be visualized using a stain that sticks to DNA. UV-reactive dyes simulate DNA fragments, eliminating poststaining time.

31 DNA Stain In-gel Staining Melt agarose and cool to 65 C. Add concentrated Sybr Safe stain to the molten gel at 1:10,000 dilution (5 µl per 50 ml agarose solution). Run DNA samples through gel no post staining or destaining necessary! Post-electrophoresis Staining Dilute concentrated stain to 1:20,000 (5 µl per 100 ml distilled water). After electrophoresis, place gel in tray. Cover gel with diluted Sybr Safe stain. Kit #109 Transilluminator #558 SybrSafe Stain #608 Stain gel for minutes.

32 TruBlu Bluelight Transilluminator Optimized for SYBR Safe stained gels Large viewing area No harmful UV

33 Which grnas were successfully able to target the CFTR gene? DNA samples in lanes 3 and 5 show two bands, indicating that the DNA has been digested. This indicates that grnas #2 and #4 were able to successfully target the DNA for cleavage by Cas9. The scientists can now follow up with these grnas and HDR to attempt gene therapy with a sample of William s cells.

34 Introducing Your Students to Gene Editing With CRISPR. CRISPR is a naturally occurring single-celled defense against viral infection. There are two main components: the guide RNA (grna) and a Cas enzyme. Once directed to a target sequence by the grna the Cas enzyme will cleave the DNA. Using homology directed repair, the digest DNA can be repaired.

35 Mistakes Hurt! Happen! Online Call Website EDVOTEK YouTube Facebook Twitter Pinterest We are ready to help!

36 Mistakes Hurt! Happen! Call Monday Friday 8AM-5:30PM EST EDVOTEK We are ready to help!

37 EDVOTEK, Inc. The Biotechnology Education Company Come visit us at Booth #1661! Presentation and literature available at: For Orders & Technical Service: Phone: EDVOTEK ( ) Web site: Check out our YouTube Channel: Like us on Facebook for offers & updates: