Alt-Ring the genome with CRISPR- Cas9
|
|
- Miranda Franklin
- 5 years ago
- Views:
Transcription
1 Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1
2 Integrated DNA Technologies The Custom Biology Company 2
3 IDT was founded by a scientist for scientists Founded in 1987 by Dr Joseph Walder >1000 employees in 6 locations 4 manufacturing sites Dedicated R&D facilities Active basic research Largest custom nucleotide manufacturer worldwide 3
4 IDT is the largest oligonucleotide manufacturer worldwide enabling new discoveries in biology and medicine >82,000 active customers >75,000 oligos synthesized per day >3,500 orders per day 300,000 web site visits per month 4
5 With our global facilities, the sun never sets on IDT Redwood City, CA, USA 743 m 2 Dedicated R&D site Development of genomics applications in NGS and qpcr Leuven, Belgium 2660 m 2 ISO 9001:2008 certified Europe, Africa, and Middle East production and support San Diego, CA, USA 1654 m 2 ISO 9001:2008 certified Production and next-day delivery for western United States Coralville, IA, USA (Headquarters) 14,300 m 2 Global infrastructure, production, and support offices ISO 9001:2008 certified ISO 13485:2003 certified and FDA-registered clean room: 310 m 2 Software development and IT: 2200 m 2 Product R&D: 1028 m 2 Skokie, IL, USA Administrative and financial office Singapore 804 m 2 bizsafe certified Asia-Pacific production and support 5
6 5 drivers of IDT s leadership in custom oligonucleotide manufacturing Vertical integration Broad nucleic acid portfolio Dedication to high quality Speed of delivery Unrivalled customer service Design and build proprietary DNA synthesizers In-house formulation of all key synthesis reagents Standard DNA oligos Modified oligos RNA High volume plate orders 100% QC of oligos by ESI mass spec Daily monitoring of synthesis quality and manufacturing equipment >90% of orders are shipped in <24 hours >3,500 packages shipped each day >165,000 customer support interactions annually Most widely used online oligo design and analysis tools Creation of proprietary manufacturing software Large scale Double-stranded DNA (gblocks fragments) Custom genes 6
7 High automation allows fast turnaround times of quality nucleic acid products 7
8 Our proprietary, automated synthesis platforms increase quality and speed, with less chance of human error 8
9 Have a bag of crispy CRISPR Clustered Regularly Interspaced Short Palindromic Repeat Adapted to edit genomes 9
10 Significance of CRISPR There are ~ 25,000 annotated genes in the human genome
11 Seen this film? Released 2 May 1998 Stars Ethan Hawke, Uma Thurman and Jude Law Vincent Freeman (Ethan Hawke) has always fantasized about traveling into outer space, but is grounded by his status as a genetically inferior "in-valid." He decides to fight his fate by purchasing the genes of Jerome Morrow (Jude Law), a laboratory-engineered "valid." He assumes Jerome's DNA identity and joins the Gattaca space program, where he falls in love with Irene (Uma Thurman).
12 Engineering a valid just like in Gattaca
13 More on engineering an in-valid to a genetic valid
14 Timeline of CRISPR-Cas Genome Engineering CRISPRs first described 1987 CRISPR-Cas identified as an immune system for bacteria 2007 CRISPR-Cas9 is RNA-guided DNA endonuclease (Jinek et al.) CRISPRs comprised of viral sequences Characterization of type II CRISPR-Cas systems cutting DNA, identification of tracrrna 2013 Cas9-RNA used for genome editing in human cells and other eukaryotes
15 How does CRISPR do it?
16 One major restriction! Jinek, M., et al Science 337: 816 (2012)
17 CRISPR/Cas9 as a tool for genome editing CRISPR requires two parts: Cas9 nuclease The nuclease that will cut at the targeteddna site Guide RNA (grna) Forms a complex with Cas9 (RNP) Specifies where the DNA cutting shouldoccur Either a RNA duplex (2 RNAs) or one single long RNA
18 Background CRISPR/Cas9 for Genome Editing DNA repair pathways: Non-homologous end joining (NHEJ) Error prone repair Creates insertions/deletions Homology-directed repair (HDR) Error free Can be used for intentional insertions or mutations
19
20 6
21 Options for the CRISPR grna
22 CRISPR/Cas9 using a single guide RNA (sgrna) Single guide RNAs (sgrna) One long RNA combining the crrna and tracrrna by the addition of a linker sequence Too long (~ 100+) for efficient or affordablerna synthesis In vitro transcription can be used
23 CRISPR/Cas9 using a 2-Part guide RNA (grna) 2-Part crrna:tracrrna Complex Two separate RNAs that include hybridization region for duplexing crrna includes ~20 base targeting region and 16 additional bases for duplexingwithtracrrna tracrrna forms a duplex with crrna and complex with Cas9 tracrrna sequence does not change for different targets, only the crrna sequence changes
24 Using CRISPR CRISPR can be used in many ways Continuous cell culture Primary cell culture Animal model generation NGS sample preparation Test tube DNA digestions Generally, the delivery is the only component of the process that changes
25 Many future scenarios
26 gblocks Gene Fragments for CRISPR-Cas9 gene editing gblocks Gene Fragments have been used in numerous published CRISPR studies: Generating Cas9 and sgrna vectors Transfecting sgrna expression cassettes under U6 promoter control as described by the Church Lab (Harvard Medical School, Boston MA) Citations at 26
27
28 What are gblocks? Double-stranded linear synthetic DNA fragments Sequence verified 200 ng delivered (for 500 bp) Affordable for research needs For all purposes that require dsdna 28
29 Established and preferred for genome editing grna backbone Current Protocols in Molecular Biology (2014),
30 Complexed RNA oligonucleotides as the CRISPR grna
31 Both the crrna and the tracrrna can be truncated 1. Short/Short Better Worse when too short 2. Long/Short 3. Short/Long 4. Long/Long Worse 31
32 Verify editing using T7 Endonuclease I (T7EI) assay 1. PCR amplify region flanking the CRISPR site ( base amplicons) Heat, cool to form heteroduplexes 2. Incubate with T7EI (New England BioLabs) 3. Run on gel or Fragment Analyzer (Advanced Analytical) to visualize cleavage at heteroduplex mismatch sites 32
33 IDT CRISPR gene editing and mutation detection workflow Transfect 2 part RNA at 30 nm or gblocks fragment at 3 nm into Cas9 expressing cells Extract gdna after 48 hr with QuickExtract DNA Solution Heat gdna extract at 65 C for 15 min followed by 95 C for 15 min Amplify gdna with KAPA HiFi Polymerase and PCR assay targeting region of interest Add NEB buffer 2 to PCR, heat to 95 C and slowly cool to allow heteroduplex formation Digest heteroduplexes with 2 units of T7EI at 37 C for 1 hr Analyze digestion on Fragment Analyzer Electropherogramand peak table of separated sample on Fragment Analyzer 52% T7 cleavage The Fragment Analyzer (Advanced Analytical) provides reliable quantification of T7EI heteroduplex cleavage assay with 96-channel CE High resolution analysis of fragments 10 40,000 bp Rapid 1 hr run 1/10 th amount of DNA required to visualize
34 CRISPR gblocks Gene Fragment in HPRT gene (HEK293 Cas9 cells) S S S S S S S S S S S S S S S + 2% Agarose gel Fragment Analyzer 23% 46% 43% 21% 0% 31% 27% 3% 47% 0% 41% 14% 39% 4% 36% + Note: sequence analysis shows 30% cleavage in T7EI assay = 60 70% total editing
35 T7EI cleavage (%) Optimized 2-part CRISPR RNAs are superior to other grnas CRISPR grna Comparison 12 grnas Targeting HPRT (HEK293 Cas9 Cells) 2 part RNA (36/67) Native RNA (42/89) In vitro transcribed sgrna sgrna Expression Plasmid (2.7 kb) gblocks Gene Fragments sgrna HEK Cas9 cells 2 part RNA (30 nm) IVT RNA (30 nm) Plasmid (100 ng) gblocks Fragment (3 nm) 0 HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT S S S S S AS AS AS AS AS AS AS
36 T7EI cleavage (%) Activity of 2-part RNA vs in-vitro transcribed sgrnas part RNA vs. IVT sgrna HPRT 12 sites (HEK293 Cas9 Cells) 2 part RNA IVT sgrna 0 HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT S S S S S AS AS AS AS AS AS AS
37 CRISPR on-target mutation profiles for varying RNA triggers Sanger sequencing of amplicons from one target site in HPRT as varying RNA triggers
38 Immune responses from in-vitro transcribed RNA IFITM1, RIGI, and OAS2 had similarly high induction when treated with in vitro transcribed sgrna (triphosphate removed) No inductions were detected when treated with 2-part RNA oligos
39 RNA triggers solved, what about the nuclease? Cas9 solutions from IDT 39
40 IDT Cas9 expression plasmid minimal vector Minimal vector (7.3 kb) Origin of replication Ampicillin resistance No selection marker Deliver Cas9 expression plasmid, followed by delivery of 2-part RNA Improvements in editing, other plasmid associated problems remain
41 CRISPR grna + Cas9 as ribonucleoprotein complex Simple, fast, and robust delivery Complex grna & Cas9 protein Deliver directly to cells using lipofection or electroporation Cas9 RNP = preferred method Protection of RNA reduced risk of degradation Higher editing compared to plasmid delivery No DNA present no integration events Tight control of Cas9 (on/off, nothing present in the cell that can make more) Reduced risk of mosaicism in animal embryo studies
42 S. p. Cas9 Nuclease 3NLS Recombinant Cas9 nuclease 1X N-terminal nuclear localization sequence (NLS) 2X C-terminal NLS Available in 100 µg and 500 µg amounts
43 Alt-R CRISPR-Cas9 System products from IDT Description Formats Alt-R CRISPR crrna Tubes: 2, 10 nmol; Plates: 2 nmol Alt-R CRISPR tracrrna 5, 20, 100 nmol Alt-R HPRT Positive Control Kits 2 nmol: human, rat and mouse Alt-R HPRT Positive Control crrna 2 nmol: human, rat and mouse Alt-R Negative Control crrna 3 sequence options Alt-R HPRT PCR Primer Mix 2 nmol each: human, rat and mouse Alt-R S.p. Cas9 Expression Plasmid Minimal plasmid (7 kb) Alt-R S.p. Cas9 3NLS nuclease 100 and 500 µg
44 Join the conversation.
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA
More informationCRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
More informationAmplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered
More informationGetting started with CRISPR: A review of gene knockout and homology-directed repair
Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background
More informationSimple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationApplications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
More informationAlt-R CRISPR-Cas9 System:
genome editing user guide Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complex into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use
More informationAlt-R CRISPR-Cas9 System:
Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complexes into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use Only Version 4 genome editing
More informationOptimizing CRISPR ribonucleoprotein components for precision genome editing
Optimizing CRISPR ribonucleoprotein components for precision genome editing Justin Barr Sr. Product Manager, Integrated DNA Technologies VIB CRISPR User Meeting 18 September 2018 1 Agenda Overview of CRISPR-Cas9
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationLipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit)
Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationUser Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationDesigning CRISPR mediated Gene disruptions with gblocks Gene Fragments
Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Adam Clore, PhD Manager, Synthetic Biology Design Integrated DNA technology Typical CRISPR timeline in Mammalian cell lines Design
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationElectroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)
Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationCRISPR 101: Optimizing Your Gene Editing Experiments
CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationAlt-R CRISPR-Cpf1 System:
user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationLabBOOK VIROMER CRISPR. for RNP delivery
LabBOOK VIROMER CRISPR for RNP delivery General information Technology Viromer are polymer-based transfection reagents featuring a viral mechanism of membrane fusion. They do form transfection complexes
More informationIntroduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design
Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationCRISPR/Cas9 Gene Editing
CRISPR/Cas9 Gene Editing Fragment Analyzer Automated CE System Identify single-cell mutations and determine mutation frequency. Mutation analysis by capillary electrophoresis provides significant benefits
More informationNucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System)
Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) BACKGROUND This protocol describes how to transfect
More informationElectroporation of human induced pluripotent stem (ips) cells
Electroporation of human induced pluripotent stem (ips) cells Ribonucleoprotein delivery using the Alt-R CRISPR-Cas9 System and the NEPA21 Electroporator Contributed by Nepa Gene, Chiba, Japan (info@nepagene.jp)
More informationEnGen sgrna Synthesis Kit, S. pyogenes
RNA ENZYMES & GENE ANALYSIS EnGen sgrna Synthesis Kit, S. pyogenes Instruction Manual NEB #E3322S 20 reactions Version 2.0 7/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research
More informationHomology-directed repair with Dharmacon Edit-R CRISPR-Cas9 reagents and single-stranded DNA oligos
APPLICATION NOTE Homology-directed repair with Dharmacon Edit-R CRISPR- reagents and single-stranded DNA oligos John A. Schiel, Eldon Chou, Maren Mayer, Emily M. Anderson, and Anja van Brabant Smith Horizon
More informationA Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
More informationAccurate Nucleic Acid Analysis is Critical to Successful Sequencing. Steve Siembieda VP Commercialization November 10, 2016
Accurate Nucleic Acid Analysis is Critical to Successful Sequencing Steve Siembieda VP Commercialization November 10, 2016 1 Advanced Analytical Privately-held instrumentation company, established in 1998
More informationTECHNICAL BULLETIN. FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli
FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli Catalog Number FNCAS9PROT Storage Temperature 20 C TECHNICAL BULLETIN Product Description FnCas9 protein is a recombinant
More informationIncorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research
More informationDevelopment of High Quality CRISPR/Cas9 Agents
Development of High Quality CRISPR/Cas9 Agents TIDES May 7 th, 2018 Terence Ta editasmedicine.com 1 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled
More informationEnGen Mutation Detection Kit
DNA MODIFYING ENZYMES EnGen Mutation Detection Kit Instruction Manual NEB #E3321S 25 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.
More informationGenome Engineering with ZFNs, TALENs and CRISPR/Cas9
Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Designer Endonucleases ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR/Cas9 (clustered regularly interspaced
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationNew Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationTECHNICAL MANUAL. Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in
Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in Contents 1 Introduction to the CRISPR-Cas9 system for gene engineering...3 CRISPR-Cas: an adaptive immunity defense mechanism in
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationBart Williams, PhD Van Andel Research Center
A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationCRISPRcraft S.p. Cas9 Nuclease. CRISPRcraft S.p. Cas9 Control Kit
CRISPRcraft S.p. Cas9 Control Kit FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)
More informationProtocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
More informationNUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products
More informationIntroducing Your Students To Gene Editing With CRISPR
Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education!
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationAutomated Electrophoresis Applications for Synthetic Biology
Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated
More informationFor designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g.
DESIGN OF grnas For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. http://crispr.mit.edu/, https://benchling.com). Assembly of grna transcriptional cassettes
More informationSUREGUIDE CRISPR LIBRARIES
SUREGUIDE CRISPR LIBRARIES Fidelity The Agilent Advantage Guide Representation Customization The Agilent Advantage Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be
More informationSureGuide CRISPR Libraries
SureGuide CRISPR Libraries Fidelity The Agilent Advantage Guide Representation Customization Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be difficult to achieve.
More informationcharacter design & illustration: ryuji nouguchi Special Edition
character design & illustration: ryuji nouguchi Special Edition Hmm... my sirna experiment worked, and now I want to know more about this gene. Can I completely knock out its expression in cells? Hello
More informationISU CBC CRISPR Workshop. Michael Collingwood & Mollie Schubert
ISU CBC CRISPR Workshop Michael Collingwood & Mollie Schubert 1 Genome editing (Cas12a) 2 Alt-R CRISPR System complete workflow Design Cut Repair Analyze Cas9/Cas12a + Guide RNA (grna) 3 CRISPR-Cas9 genome
More informationSupplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
More informationUsing CRISPR for genetic alteration
Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic
More informationSupplementary Information
Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationBiotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications
Biotechnology DNA technology and its applications Biotechnology and Molecular Biology Concepts: Polymerase chain reaction (PCR) Plasmids and restriction digests Recombinant protein production UV spectrophotometry
More informationProtocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationLentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors
Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb
More informationIntroduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products
Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products which one is right for you? CRISPR Workflow abm s Toolbox
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationDharmacon Edit-R CRISPR-Cas9 genome engineering with Cas9 Nuclease mrna and synthetic guide RNAs
A Horizon Discovery Group Company Dharmacon Edit-R CRISPR-Cas9 genome engineering with Cas9 Nuclease mrna and synthetic guide RNAs Contents 1 Introduction to the CRISPR-Cas9 system for gene editing...3
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationTechnical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationCRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing
CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing Fei Ann Ran Broad Institute Cambridge, Massachusetts ran@fas.harvard.edu I will provide some background on the CRISPR/Cas9 technology,
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationEasi CRISPR for conditional and insertional alleles
Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome
More informationSUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity
SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University
More informationCRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com
CRISPR/Cas9 From Yoghurt to Designer Babies Source: nextbigfuture.com OBJECTIVES 1. Relate the functioning of bacterial CRISPR/Cas systems to acquired immunity 2. Describe how CRISPR/Cas9 cuts DNA 3. Explain
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More information12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule
I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,
More informationAllele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
More informationPuro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
More informationGenome edi3ng with the CRISPR-Cas9 system
CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,
More informationTesting Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA
Testing Non-Transgenic CRISPR Technology for Wheat Improvement KALI M BRANDT, HILARY L GUNN, BRETT L BUSCHKE, ADAM HEESACKER, NATHALIA MORET TI, ALEXANDER KARASEV, ROBERT S ZEMETRA 13 TH IWGS - TULLN,
More informationDig System for Starters
Dig System for Starters Content 1. Powerful and Versatile DIG System 2. Labeling Nucleic Acids using the DIG System 3. Critical Hints for PCR Labeling 1 2 3 1. Powerful and Versatile DIG System Powerful
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. Overview SapTrap (Schwartz and Jorgensen,
More informationSupplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationLarge scale genome editing for. Senior Scientist, GenScript
Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes
More informationProtocols for cell lines using CRISPR/CAS
Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More information