Alt-Ring the genome with CRISPR- Cas9

Size: px
Start display at page:

Download "Alt-Ring the genome with CRISPR- Cas9"

Transcription

1 Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1

2 Integrated DNA Technologies The Custom Biology Company 2

3 IDT was founded by a scientist for scientists Founded in 1987 by Dr Joseph Walder >1000 employees in 6 locations 4 manufacturing sites Dedicated R&D facilities Active basic research Largest custom nucleotide manufacturer worldwide 3

4 IDT is the largest oligonucleotide manufacturer worldwide enabling new discoveries in biology and medicine >82,000 active customers >75,000 oligos synthesized per day >3,500 orders per day 300,000 web site visits per month 4

5 With our global facilities, the sun never sets on IDT Redwood City, CA, USA 743 m 2 Dedicated R&D site Development of genomics applications in NGS and qpcr Leuven, Belgium 2660 m 2 ISO 9001:2008 certified Europe, Africa, and Middle East production and support San Diego, CA, USA 1654 m 2 ISO 9001:2008 certified Production and next-day delivery for western United States Coralville, IA, USA (Headquarters) 14,300 m 2 Global infrastructure, production, and support offices ISO 9001:2008 certified ISO 13485:2003 certified and FDA-registered clean room: 310 m 2 Software development and IT: 2200 m 2 Product R&D: 1028 m 2 Skokie, IL, USA Administrative and financial office Singapore 804 m 2 bizsafe certified Asia-Pacific production and support 5

6 5 drivers of IDT s leadership in custom oligonucleotide manufacturing Vertical integration Broad nucleic acid portfolio Dedication to high quality Speed of delivery Unrivalled customer service Design and build proprietary DNA synthesizers In-house formulation of all key synthesis reagents Standard DNA oligos Modified oligos RNA High volume plate orders 100% QC of oligos by ESI mass spec Daily monitoring of synthesis quality and manufacturing equipment >90% of orders are shipped in <24 hours >3,500 packages shipped each day >165,000 customer support interactions annually Most widely used online oligo design and analysis tools Creation of proprietary manufacturing software Large scale Double-stranded DNA (gblocks fragments) Custom genes 6

7 High automation allows fast turnaround times of quality nucleic acid products 7

8 Our proprietary, automated synthesis platforms increase quality and speed, with less chance of human error 8

9 Have a bag of crispy CRISPR Clustered Regularly Interspaced Short Palindromic Repeat Adapted to edit genomes 9

10 Significance of CRISPR There are ~ 25,000 annotated genes in the human genome

11 Seen this film? Released 2 May 1998 Stars Ethan Hawke, Uma Thurman and Jude Law Vincent Freeman (Ethan Hawke) has always fantasized about traveling into outer space, but is grounded by his status as a genetically inferior "in-valid." He decides to fight his fate by purchasing the genes of Jerome Morrow (Jude Law), a laboratory-engineered "valid." He assumes Jerome's DNA identity and joins the Gattaca space program, where he falls in love with Irene (Uma Thurman).

12 Engineering a valid just like in Gattaca

13 More on engineering an in-valid to a genetic valid

14 Timeline of CRISPR-Cas Genome Engineering CRISPRs first described 1987 CRISPR-Cas identified as an immune system for bacteria 2007 CRISPR-Cas9 is RNA-guided DNA endonuclease (Jinek et al.) CRISPRs comprised of viral sequences Characterization of type II CRISPR-Cas systems cutting DNA, identification of tracrrna 2013 Cas9-RNA used for genome editing in human cells and other eukaryotes

15 How does CRISPR do it?

16 One major restriction! Jinek, M., et al Science 337: 816 (2012)

17 CRISPR/Cas9 as a tool for genome editing CRISPR requires two parts: Cas9 nuclease The nuclease that will cut at the targeteddna site Guide RNA (grna) Forms a complex with Cas9 (RNP) Specifies where the DNA cutting shouldoccur Either a RNA duplex (2 RNAs) or one single long RNA

18 Background CRISPR/Cas9 for Genome Editing DNA repair pathways: Non-homologous end joining (NHEJ) Error prone repair Creates insertions/deletions Homology-directed repair (HDR) Error free Can be used for intentional insertions or mutations

19

20 6

21 Options for the CRISPR grna

22 CRISPR/Cas9 using a single guide RNA (sgrna) Single guide RNAs (sgrna) One long RNA combining the crrna and tracrrna by the addition of a linker sequence Too long (~ 100+) for efficient or affordablerna synthesis In vitro transcription can be used

23 CRISPR/Cas9 using a 2-Part guide RNA (grna) 2-Part crrna:tracrrna Complex Two separate RNAs that include hybridization region for duplexing crrna includes ~20 base targeting region and 16 additional bases for duplexingwithtracrrna tracrrna forms a duplex with crrna and complex with Cas9 tracrrna sequence does not change for different targets, only the crrna sequence changes

24 Using CRISPR CRISPR can be used in many ways Continuous cell culture Primary cell culture Animal model generation NGS sample preparation Test tube DNA digestions Generally, the delivery is the only component of the process that changes

25 Many future scenarios

26 gblocks Gene Fragments for CRISPR-Cas9 gene editing gblocks Gene Fragments have been used in numerous published CRISPR studies: Generating Cas9 and sgrna vectors Transfecting sgrna expression cassettes under U6 promoter control as described by the Church Lab (Harvard Medical School, Boston MA) Citations at 26

27

28 What are gblocks? Double-stranded linear synthetic DNA fragments Sequence verified 200 ng delivered (for 500 bp) Affordable for research needs For all purposes that require dsdna 28

29 Established and preferred for genome editing grna backbone Current Protocols in Molecular Biology (2014),

30 Complexed RNA oligonucleotides as the CRISPR grna

31 Both the crrna and the tracrrna can be truncated 1. Short/Short Better Worse when too short 2. Long/Short 3. Short/Long 4. Long/Long Worse 31

32 Verify editing using T7 Endonuclease I (T7EI) assay 1. PCR amplify region flanking the CRISPR site ( base amplicons) Heat, cool to form heteroduplexes 2. Incubate with T7EI (New England BioLabs) 3. Run on gel or Fragment Analyzer (Advanced Analytical) to visualize cleavage at heteroduplex mismatch sites 32

33 IDT CRISPR gene editing and mutation detection workflow Transfect 2 part RNA at 30 nm or gblocks fragment at 3 nm into Cas9 expressing cells Extract gdna after 48 hr with QuickExtract DNA Solution Heat gdna extract at 65 C for 15 min followed by 95 C for 15 min Amplify gdna with KAPA HiFi Polymerase and PCR assay targeting region of interest Add NEB buffer 2 to PCR, heat to 95 C and slowly cool to allow heteroduplex formation Digest heteroduplexes with 2 units of T7EI at 37 C for 1 hr Analyze digestion on Fragment Analyzer Electropherogramand peak table of separated sample on Fragment Analyzer 52% T7 cleavage The Fragment Analyzer (Advanced Analytical) provides reliable quantification of T7EI heteroduplex cleavage assay with 96-channel CE High resolution analysis of fragments 10 40,000 bp Rapid 1 hr run 1/10 th amount of DNA required to visualize

34 CRISPR gblocks Gene Fragment in HPRT gene (HEK293 Cas9 cells) S S S S S S S S S S S S S S S + 2% Agarose gel Fragment Analyzer 23% 46% 43% 21% 0% 31% 27% 3% 47% 0% 41% 14% 39% 4% 36% + Note: sequence analysis shows 30% cleavage in T7EI assay = 60 70% total editing

35 T7EI cleavage (%) Optimized 2-part CRISPR RNAs are superior to other grnas CRISPR grna Comparison 12 grnas Targeting HPRT (HEK293 Cas9 Cells) 2 part RNA (36/67) Native RNA (42/89) In vitro transcribed sgrna sgrna Expression Plasmid (2.7 kb) gblocks Gene Fragments sgrna HEK Cas9 cells 2 part RNA (30 nm) IVT RNA (30 nm) Plasmid (100 ng) gblocks Fragment (3 nm) 0 HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT S S S S S AS AS AS AS AS AS AS

36 T7EI cleavage (%) Activity of 2-part RNA vs in-vitro transcribed sgrnas part RNA vs. IVT sgrna HPRT 12 sites (HEK293 Cas9 Cells) 2 part RNA IVT sgrna 0 HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT HPRT S S S S S AS AS AS AS AS AS AS

37 CRISPR on-target mutation profiles for varying RNA triggers Sanger sequencing of amplicons from one target site in HPRT as varying RNA triggers

38 Immune responses from in-vitro transcribed RNA IFITM1, RIGI, and OAS2 had similarly high induction when treated with in vitro transcribed sgrna (triphosphate removed) No inductions were detected when treated with 2-part RNA oligos

39 RNA triggers solved, what about the nuclease? Cas9 solutions from IDT 39

40 IDT Cas9 expression plasmid minimal vector Minimal vector (7.3 kb) Origin of replication Ampicillin resistance No selection marker Deliver Cas9 expression plasmid, followed by delivery of 2-part RNA Improvements in editing, other plasmid associated problems remain

41 CRISPR grna + Cas9 as ribonucleoprotein complex Simple, fast, and robust delivery Complex grna & Cas9 protein Deliver directly to cells using lipofection or electroporation Cas9 RNP = preferred method Protection of RNA reduced risk of degradation Higher editing compared to plasmid delivery No DNA present no integration events Tight control of Cas9 (on/off, nothing present in the cell that can make more) Reduced risk of mosaicism in animal embryo studies

42 S. p. Cas9 Nuclease 3NLS Recombinant Cas9 nuclease 1X N-terminal nuclear localization sequence (NLS) 2X C-terminal NLS Available in 100 µg and 500 µg amounts

43 Alt-R CRISPR-Cas9 System products from IDT Description Formats Alt-R CRISPR crrna Tubes: 2, 10 nmol; Plates: 2 nmol Alt-R CRISPR tracrrna 5, 20, 100 nmol Alt-R HPRT Positive Control Kits 2 nmol: human, rat and mouse Alt-R HPRT Positive Control crrna 2 nmol: human, rat and mouse Alt-R Negative Control crrna 3 sequence options Alt-R HPRT PCR Primer Mix 2 nmol each: human, rat and mouse Alt-R S.p. Cas9 Expression Plasmid Minimal plasmid (7 kb) Alt-R S.p. Cas9 3NLS nuclease 100 and 500 µg

44 Join the conversation.

Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing

Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA

More information

CRISPR Ribonucleoprotein (RNP) User Manual

CRISPR Ribonucleoprotein (RNP) User Manual CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised

More information

Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events

Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered

More information

Getting started with CRISPR: A review of gene knockout and homology-directed repair

Getting started with CRISPR: A review of gene knockout and homology-directed repair Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background

More information

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

CRISPR/Cas9 Genome Editing: Transfection Methods

CRISPR/Cas9 Genome Editing: Transfection Methods CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the

More information

Alt-R CRISPR-Cas9 system:

Alt-R CRISPR-Cas9 system: Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research

More information

Applications of Cas9 nickases for genome engineering

Applications of Cas9 nickases for genome engineering application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,

More information

Alt-R CRISPR-Cas9 System:

Alt-R CRISPR-Cas9 System: genome editing user guide Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complex into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use

More information

Alt-R CRISPR-Cas9 System:

Alt-R CRISPR-Cas9 System: Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complexes into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use Only Version 4 genome editing

More information

Optimizing CRISPR ribonucleoprotein components for precision genome editing

Optimizing CRISPR ribonucleoprotein components for precision genome editing Optimizing CRISPR ribonucleoprotein components for precision genome editing Justin Barr Sr. Product Manager, Integrated DNA Technologies VIB CRISPR User Meeting 18 September 2018 1 Agenda Overview of CRISPR-Cas9

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection

More information

Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit)

Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein

More information

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)

More information

jetcrispr RNP transfection reagent PROTOCOL

jetcrispr RNP transfection reagent PROTOCOL jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been

More information

Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments

Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Adam Clore, PhD Manager, Synthetic Biology Design Integrated DNA technology Typical CRISPR timeline in Mammalian cell lines Design

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:

More information

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein

More information

CRISPR 101: Optimizing Your Gene Editing Experiments

CRISPR 101: Optimizing Your Gene Editing Experiments CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Alt-R CRISPR-Cpf1 System:

Alt-R CRISPR-Cpf1 System: user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

LabBOOK VIROMER CRISPR. for RNP delivery

LabBOOK VIROMER CRISPR. for RNP delivery LabBOOK VIROMER CRISPR for RNP delivery General information Technology Viromer are polymer-based transfection reagents featuring a viral mechanism of membrane fusion. They do form transfection complexes

More information

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3

More information

Genome editing. Knock-ins

Genome editing. Knock-ins Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in

More information

CRISPR/Cas9 Gene Editing

CRISPR/Cas9 Gene Editing CRISPR/Cas9 Gene Editing Fragment Analyzer Automated CE System Identify single-cell mutations and determine mutation frequency. Mutation analysis by capillary electrophoresis provides significant benefits

More information

Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System)

Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) BACKGROUND This protocol describes how to transfect

More information

Electroporation of human induced pluripotent stem (ips) cells

Electroporation of human induced pluripotent stem (ips) cells Electroporation of human induced pluripotent stem (ips) cells Ribonucleoprotein delivery using the Alt-R CRISPR-Cas9 System and the NEPA21 Electroporator Contributed by Nepa Gene, Chiba, Japan (info@nepagene.jp)

More information

EnGen sgrna Synthesis Kit, S. pyogenes

EnGen sgrna Synthesis Kit, S. pyogenes RNA ENZYMES & GENE ANALYSIS EnGen sgrna Synthesis Kit, S. pyogenes Instruction Manual NEB #E3322S 20 reactions Version 2.0 7/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research

More information

Homology-directed repair with Dharmacon Edit-R CRISPR-Cas9 reagents and single-stranded DNA oligos

Homology-directed repair with Dharmacon Edit-R CRISPR-Cas9 reagents and single-stranded DNA oligos APPLICATION NOTE Homology-directed repair with Dharmacon Edit-R CRISPR- reagents and single-stranded DNA oligos John A. Schiel, Eldon Chou, Maren Mayer, Emily M. Anderson, and Anja van Brabant Smith Horizon

More information

A Guide to CRISPR/Cas9

A Guide to CRISPR/Cas9 Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse

More information

Accurate Nucleic Acid Analysis is Critical to Successful Sequencing. Steve Siembieda VP Commercialization November 10, 2016

Accurate Nucleic Acid Analysis is Critical to Successful Sequencing. Steve Siembieda VP Commercialization November 10, 2016 Accurate Nucleic Acid Analysis is Critical to Successful Sequencing Steve Siembieda VP Commercialization November 10, 2016 1 Advanced Analytical Privately-held instrumentation company, established in 1998

More information

TECHNICAL BULLETIN. FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli

TECHNICAL BULLETIN. FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli Catalog Number FNCAS9PROT Storage Temperature 20 C TECHNICAL BULLETIN Product Description FnCas9 protein is a recombinant

More information

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research

More information

Development of High Quality CRISPR/Cas9 Agents

Development of High Quality CRISPR/Cas9 Agents Development of High Quality CRISPR/Cas9 Agents TIDES May 7 th, 2018 Terence Ta editasmedicine.com 1 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled

More information

EnGen Mutation Detection Kit

EnGen Mutation Detection Kit DNA MODIFYING ENZYMES EnGen Mutation Detection Kit Instruction Manual NEB #E3321S 25 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.

More information

Genome Engineering with ZFNs, TALENs and CRISPR/Cas9

Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Designer Endonucleases ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR/Cas9 (clustered regularly interspaced

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

New Plant Breeding Technologies

New Plant Breeding Technologies New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

TECHNICAL MANUAL. Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in

TECHNICAL MANUAL. Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in Contents 1 Introduction to the CRISPR-Cas9 system for gene engineering...3 CRISPR-Cas: an adaptive immunity defense mechanism in

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Bart Williams, PhD Van Andel Research Center

Bart Williams, PhD Van Andel Research Center A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

CRISPRcraft S.p. Cas9 Nuclease. CRISPRcraft S.p. Cas9 Control Kit

CRISPRcraft S.p. Cas9 Nuclease. CRISPRcraft S.p. Cas9 Control Kit CRISPRcraft S.p. Cas9 Control Kit FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)

More information

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version

More information

NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE

NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products

More information

Introducing Your Students To Gene Editing With CRISPR

Introducing Your Students To Gene Editing With CRISPR Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education!

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Automated Electrophoresis Applications for Synthetic Biology

Automated Electrophoresis Applications for Synthetic Biology Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated

More information

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g.

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. DESIGN OF grnas For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. http://crispr.mit.edu/, https://benchling.com). Assembly of grna transcriptional cassettes

More information

SUREGUIDE CRISPR LIBRARIES

SUREGUIDE CRISPR LIBRARIES SUREGUIDE CRISPR LIBRARIES Fidelity The Agilent Advantage Guide Representation Customization The Agilent Advantage Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be

More information

SureGuide CRISPR Libraries

SureGuide CRISPR Libraries SureGuide CRISPR Libraries Fidelity The Agilent Advantage Guide Representation Customization Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be difficult to achieve.

More information

character design & illustration: ryuji nouguchi Special Edition

character design & illustration: ryuji nouguchi Special Edition character design & illustration: ryuji nouguchi Special Edition Hmm... my sirna experiment worked, and now I want to know more about this gene. Can I completely knock out its expression in cells? Hello

More information

ISU CBC CRISPR Workshop. Michael Collingwood & Mollie Schubert

ISU CBC CRISPR Workshop. Michael Collingwood & Mollie Schubert ISU CBC CRISPR Workshop Michael Collingwood & Mollie Schubert 1 Genome editing (Cas12a) 2 Alt-R CRISPR System complete workflow Design Cut Repair Analyze Cas9/Cas12a + Guide RNA (grna) 3 CRISPR-Cas9 genome

More information

Supplementary Methods pcfd5 cloning protocol

Supplementary Methods pcfd5 cloning protocol Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous

More information

Using CRISPR for genetic alteration

Using CRISPR for genetic alteration Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic

More information

Supplementary Information

Supplementary Information Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.

More information

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

Biotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications

Biotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications Biotechnology DNA technology and its applications Biotechnology and Molecular Biology Concepts: Polymerase chain reaction (PCR) Plasmids and restriction digests Recombinant protein production UV spectrophotometry

More information

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1 Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a

More information

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb

More information

Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products

Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products which one is right for you? CRISPR Workflow abm s Toolbox

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Dharmacon Edit-R CRISPR-Cas9 genome engineering with Cas9 Nuclease mrna and synthetic guide RNAs

Dharmacon Edit-R CRISPR-Cas9 genome engineering with Cas9 Nuclease mrna and synthetic guide RNAs A Horizon Discovery Group Company Dharmacon Edit-R CRISPR-Cas9 genome engineering with Cas9 Nuclease mrna and synthetic guide RNAs Contents 1 Introduction to the CRISPR-Cas9 system for gene editing...3

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

Technical tips Session 4

Technical tips Session 4 Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing

CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing Fei Ann Ran Broad Institute Cambridge, Massachusetts ran@fas.harvard.edu I will provide some background on the CRISPR/Cas9 technology,

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Easi CRISPR for conditional and insertional alleles

Easi CRISPR for conditional and insertional alleles Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome

More information

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University

More information

CRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com

CRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com CRISPR/Cas9 From Yoghurt to Designer Babies Source: nextbigfuture.com OBJECTIVES 1. Relate the functioning of bacterial CRISPR/Cas systems to acquired immunity 2. Describe how CRISPR/Cas9 cuts DNA 3. Explain

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,

More information

Allele-specific locus binding and genome editing by CRISPR at the

Allele-specific locus binding and genome editing by CRISPR at the Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

Genome edi3ng with the CRISPR-Cas9 system

Genome edi3ng with the CRISPR-Cas9 system CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,

More information

Testing Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA

Testing Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA Testing Non-Transgenic CRISPR Technology for Wheat Improvement KALI M BRANDT, HILARY L GUNN, BRETT L BUSCHKE, ADAM HEESACKER, NATHALIA MORET TI, ALEXANDER KARASEV, ROBERT S ZEMETRA 13 TH IWGS - TULLN,

More information

Dig System for Starters

Dig System for Starters Dig System for Starters Content 1. Powerful and Versatile DIG System 2. Labeling Nucleic Acids using the DIG System 3. Critical Hints for PCR Labeling 1 2 3 1. Powerful and Versatile DIG System Powerful

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. Overview SapTrap (Schwartz and Jorgensen,

More information

Supplementary Information

Supplementary Information Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

Large scale genome editing for. Senior Scientist, GenScript

Large scale genome editing for. Senior Scientist, GenScript Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes

More information

Protocols for cell lines using CRISPR/CAS

Protocols for cell lines using CRISPR/CAS Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information