Supporting Text. Methods

Size: px
Start display at page:

Download "Supporting Text. Methods"

Transcription

1 Supporting Text Methods PCR Amplification and Sequencing of amoa. Each reaction mixture contained 12.5 µl of MasterAmp PCR premix F (Epicentre Technologies, Madison, WI), 0.5 µm of each primer (Qiagen, Valencia, CA), 2.5 units of AmpliTaq DNA polymerase LD (Applied Biosystems), and 0.25 µl of template DNA. Amplification was performed in a total volume of 25 µl in 0.2-ml reaction tubes with a DNA Engine thermal cycler (MJ Research, Cambridge, MA). All PCR was performed in triplicate. PCR products were cloned by using the TOPO TA Cloning Kit (Invitrogen), following the manufacturer s protocol. Quantitative PCR. The first-round PCR was performed in the same volumes, tubes, and PCR cycler as the first-round PCR for terminal restriction fragment length polymorphism (T-RFLP) analysis. The second-round PCR was performed in 20-µl volumes in Hard- Shell ThinWall 96-Well Microplates (MJ Research) by using Ultra Clear Caps (MJ Research) and the DNA Engine Option 2 System (MJ Research). The melting curve analysis performed after each PCR showed a clear single peak at 90 C corresponding to the 491-bp amoa fragment. The size of this fragment was verified by means of agarose gel electrophoresis. Anomalies (due to contamination, primer dimer, false priming, etc.) were not evident in the negative first-derivative plots, as indicated by the lack of additional peaks. However, to avoid any possible primer dimer interference, the temperature at which the fluorescence was read during each cycle was adjusted to 86 C, a temperature above the melting point of the primer dimers. The amount of initial template DNA was estimated by determining the threshold cycle (Ct), the number of PCR cycles required for the fluorescence to exceed a threshold value higher than the background fluorescence. We assumed a threshold value of 25 times the background fluorescence (which we defined as the mean fluorescence values of the first three to eight PCR cycles).

2 2. Rotthauwe, J., Witzel, K. & Liesack, W. (1997) Appl. Environ. Microbiol. 63,

3 PCR Efficiency Controls. A defined amount of plasmid DNA (puc-plasmid, Invitrogen) was mixed with the same volume of soil DNA that was used for the regular real-time PCR. An 200-bp-long region of the plasmid was then amplified by using the primers M13F and M13R under the same PCR conditions described for the amplification of the amoa target (Table 1). Because the amount of the control gene was constant in all samples, any difference in Ct values was a direct measure of the different amplification efficiencies of the soil samples. We corrected for differences in PCR efficiencies by subtracting the Ct of the spiked control gene from the Ct of the target gene for each soil sample, as described by Meijerinck et al. (1). All control PCRs were performed in triplicate. 1. Meijerink, J., Mandigers, C., van de Locht, L., Tonnissen, E., Goodsaid, F. & Raemaekers, J. (2001) J. Mol. Diagn. 3,

4 Table 1. Primer description and thermal profiles for PCR amplification of amoa Primer Round of nested Thermal Molecular Sequence (5'-3') pair* PCR profile analysis A189 (1) GGNGACTGGGACTTCTGG 94 C, 30 s C, 30 s amoa-2r 1 CCCCTCKGSAAAGCCTTCTTC 72 C, 45 s (2) 30 cycles T-RFLP amoa-1f 94 C, 60 s GGGGTTTCTACTGGTGGT (2) 55 C, 90 s 2 72 C, 90 s amoa-2r CCCCTCKGSAAAGCCTTCTTC 18 cycles A189 GGNGACTGGGACTTCTGG 94 C, 45 s 56 C, 90 s 1 amoa-2r CCCCTCKGSAAAGCCTTCTTC 72 C, 180 s 13 cycles amoa-1f GGGGTTTCTACTGGTGGT 94 C, 45 s 55 C, 30 s Real-time PCR amoa-2r CCCCTCKGSAAAGCCTTCTTC 2 (Real-time PCR) 72 C, 180 s Plate read at 83 C 30 cycles Melting curve *Primers in bold represent the 5'-primer. All PCR profiles started with an initial denaturation at 94 C for 3 min and ended with a final elongation step at 72 C for 10 min, prior to holding the temperature at 4 C. Annealing temperature was decreased 0.5 C after each cycle until it reached 52 C. Primer labeled with 5-carboxyfluorescein. Melting curve analysis: C, 0.2 C per read, 1-s hold, final elongation step at 72 C for 10 min, prior to holding the temperature at 10 C. Control reactions with the primers M13F (5'-GTAAAACGACGGCCAG-3') and M13R (5'-CAGGAAACAGCTATGAC-3') were performed with identical thermal profiles. 1. Holmes, A. J., Costello, A., Lidstrom, M. E. & Murrell, J. C. (1995) FEMS Microbiol. Lett. 132,

5 2. Rotthauwe, J., Witzel, K. & Liesack, W. (1997) Appl. Environ. Microbiol. 63,

6 Table 2. Split-plot analysis of variance for the proportion of ammonia-oxidizing bacteria clade JR1 in the Jasper Ridge Global Change Experiment Source df Sum of Mean F P squares square Main plot comparisons C H C H Error (plot{h C}) Subplot comparisons N ** N C N H ** N C H Error (N plot{h C}) W W N W C W H ** W H C Error (W plot{h C}) N W C N W H * N W H C Error (N W plot{h C}) Two missing data points (for plots 47 and 123) were deleted. Split-plot ANOVA was performed by using the general linear model (GLM) in the SAS statistical package (SAS Institute, Cary, NC). *, P < 0.05; **, P < 0.01; N, nitrogen; H, heat; W, water; C, CO 2.

7 Table 3. Split-plot analysis of variance for the abundance of amoa genes in the Jasper Ridge Global Change Experiment Source df Sum of Mean F P squares square Main plot comparisons C * H C H Error (plot{h C}) Subplot comparisons N N C N H N C H Error (N plot{h C}) W W N W C * W H **** W H C Error (W plot{h C}) N W C N W H N W H C Error (N W plot{h C}) Two missing data points (for plots 47 and 123) were deleted. Split-plot ANOVA was performed by using the general linear model (GLM) in the SAS statistical package (SAS Institute, Cary, NC). *, P < 0.05; ****, P < ; N, nitrogen; H, heat; W, water; C, CO 2.

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

TB Green Premix Ex Taq II (Tli RNaseH Plus)

TB Green Premix Ex Taq II (Tli RNaseH Plus) Cat. # RR820A For Research Use TB Green Premix Ex Taq II (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AGY1013N. See section IV.

More information

SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk

SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. AK9104. See section IV.

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

PlantDirect TM Multiplex PCR System

PlantDirect TM Multiplex PCR System PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates.

3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates. 3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates. version 0217 250 reactions in 20 μl Cat. # 2000-250S 2500 reactions

More information

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)

More information

SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus

SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Cat. # RR82LR For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. A1901A. See section

More information

TB Green Premix Ex Taq (Tli RNaseH Plus)

TB Green Premix Ex Taq (Tli RNaseH Plus) Cat. # RR420A For Research Use TB Green Premix Ex Taq (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AK8101. See section V. Storage.

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

PRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases

More information

Multiplex PCR Assay Kit Ver.2

Multiplex PCR Assay Kit Ver.2 Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex

More information

Application Note Detecting low copy numbers. Introduction. Methods A08-005B

Application Note Detecting low copy numbers. Introduction. Methods A08-005B Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

Quantitative Real time PCR. Only for teaching purposes - not for reproduction or sale

Quantitative Real time PCR. Only for teaching purposes - not for reproduction or sale Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP

More information

GreenMasterMix (2X) b i o s c i e n c e. G E N A X X O N b i o s c i e n c e. High ROX (500nM)

GreenMasterMix (2X) b i o s c i e n c e. G E N A X X O N b i o s c i e n c e. High ROX (500nM) G:\products\productflyer\pcr\polymerasen\hotstart\manu_m3052_green_en.docx GreenMasterMix (2) High RO (500nM) qpcr master mix with fluorescence dye and passive reference dye Contact & Technical support

More information

Cat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da

Cat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

TECHNICAL BULLETIN. SYBR Green JumpStart Taq ReadyMix without MgCl 2. Catalog Number S5193 Storage Temperature 20 C

TECHNICAL BULLETIN. SYBR Green JumpStart Taq ReadyMix without MgCl 2. Catalog Number S5193 Storage Temperature 20 C SYBR Green JumpStart Taq ReadyMix without MgCl 2 Catalog Number S5193 Storage Temperature 20 C TECHNICAL BULLETIN Product Description SYBR Green JumpStart Taq ReadyMix without MgCl 2 combines JumpStart

More information

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION 1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...

More information

SOP: SYBR Green-based real-time RT-PCR

SOP: SYBR Green-based real-time RT-PCR SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong

More information

Quantitative Real time PCR. Only for teaching purposes - not for reproduction or sale

Quantitative Real time PCR. Only for teaching purposes - not for reproduction or sale Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP

More information

PrimeSTAR Max DNA Polymerase

PrimeSTAR Max DNA Polymerase Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.

More information

Detection of Biological Threat Agents by Real-Time PCR - Comparison of Assay

Detection of Biological Threat Agents by Real-Time PCR - Comparison of Assay Detection of Biological Threat Agents by Real-Time PCR - Comparison of Assay Performance on the Idaho Technology, Inc. R.A.P.I.D., the Roche LightCycler, and the Cepheid Smart Cycler Supplemental Data

More information

Only for teaching purposes - not for reproduction or sale

Only for teaching purposes - not for reproduction or sale PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP in real time PCR Relative

More information

Executive Summary. clinical supply services

Executive Summary. clinical supply services clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive

More information

Cat. # RR391A. For Research Use. Probe qpcr Mix. Product Manual. v201610da

Cat. # RR391A. For Research Use. Probe qpcr Mix. Product Manual. v201610da Cat. # RR391A For Research Use Probe qpcr Mix Product Manual Table of Contents I. Introduction... 3 II. Principle... 3 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5

More information

Factors affecting PCR

Factors affecting PCR Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the

More information

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Table of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...

Table of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation... Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems

More information

Amplicon Sequencing Template Preparation

Amplicon Sequencing Template Preparation Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

MightyAmp Genotyping Kit

MightyAmp Genotyping Kit For Research Use MightyAmp Genotyping Kit Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Storage... 3 IV. Primer Design... 3 V. Protocol... 4 VI. 3'-A Overhang of PCR

More information

Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR

Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR WHITE PAPER Platinum II Taq Hot-Start DNA Polymerase Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR Abstract The advances in thermal cycler technology permit a substantial increase in

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

THUNDERBIRD SYBR qpcr Mix

THUNDERBIRD SYBR qpcr Mix Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]

More information

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v201712da_2

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v201712da_2 Cat. # R100A For Research Use EpiScope MSP Kit Product Manual Table of Contents I. Description... 3 II. MSP Principle... 3 III. Components... 4 IV. Storage... 4 V. Materials Required but not Provided...

More information

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture... Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.

More information

CT = control s = sample

CT = control s = sample PANFLAVIVIRUS RT-qPCR Trainer: Dr. Cristina Domingo Assistants: Pranav Patel/Ravish Paliwal 1. Thaw all reagents except the Enzyme Mix (keep at -20 C) 2. Prepare maser mix for the RT-qPCR assay (NO DNA

More information

High Resolution Melting Protocol

High Resolution Melting Protocol Precipio, Inc. High Resolution Melting Protocol High Resolution Melting of ICE COLD-PCR Products Table of Contents High Resolution Melting of the ICE COLD-PCR products 2 Mutation Confirmation of HRM Positive

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.

PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. PCR CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. General Outline of the Lecture I. Background II. Basic Principles III. Detection and Analysis of PCR Products IV. Common Applications

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

Hy-Fy High Fidelity Mix (x2)

Hy-Fy High Fidelity Mix (x2) Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,

More information

Mastermix 16S Complete, DNA-free

Mastermix 16S Complete, DNA-free Mastermix 16S Complete, DNA-free For the PCR detection and identification of bacteria using universal 16S rdna primers For research use only Cat. No. S-020-0100 Cat. No. S-020-0250 Cat. No. S-020-1000

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v1103da

Cat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v1103da Cat. # R100A For Research Use EpiScope MSP Kit Product Manual Table of Contents I. Description... 3 II. Principle of MSP... 3 III. Kit Components... 4 IV. Materials Required but not Provided... 4 V. Storage...

More information

PRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda

More information

BENG 183 Trey Ideker (the details )

BENG 183 Trey Ideker (the details ) BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and

More information

Comparison of ExoSAP-IT and ExoSAP-IT Express reagents to alternative PCR cleanup methods

Comparison of ExoSAP-IT and ExoSAP-IT Express reagents to alternative PCR cleanup methods WHITE PAPER ExoSAP-IT PCR cleanup reagents Comparison of ExoSAP-IT and ExoSAP-IT Express reagents to alternative PCR cleanup methods Abstract Here we present superior workflow advantages of enzymatic PCR

More information

Genomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes

Genomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes Supplementary information Methods DNA and RNA extraction Genomic DNA was extracted from to ml of blood collected in EDTA blood collection tubes using the Gentra Puregene Blood kit (Qiagen, California,

More information

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,

More information

EpiQuik Quantitative PCR Fast Kit Base Catalog # P-1029

EpiQuik Quantitative PCR Fast Kit Base Catalog # P-1029 EpiQuik Quantitative PCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Quantitative PCR Fast Kit is designed for quantitative real time analysis of DNA samples

More information

mirna QPCR Master Mix

mirna QPCR Master Mix mirna QPCR Master Mix Instruction Manual Catalog #600583 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 600583-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement

More information

Thermal cycler amplification robustness: a comparison of several models

Thermal cycler amplification robustness: a comparison of several models APPLICATION NOTE Thermal cyclers Thermal cycler amplification robustness: a comparison of several models Introduction The ability of a thermal cycler to amplify difficult targets is a critical factor for

More information

FAQs: PCR Polymerases from Takara Bio

FAQs: PCR Polymerases from Takara Bio FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly

More information

A Recommended Procedure for Real-Time Quantitative TaqMan PCR for Roundup Ready Canola RT73 Monsanto Biotechnology Regulatory Sciences

A Recommended Procedure for Real-Time Quantitative TaqMan PCR for Roundup Ready Canola RT73 Monsanto Biotechnology Regulatory Sciences Page 1 of 7 Overview Purpose & Scope This procedure describes an event-specific real-time TaqMan PCR method for determination of the relative content of Roundup Ready canola RT73 (hereafter referred to

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

A highly specific anti-5-methylcytosine monoclonal antibody for defined, reproducible results.

A highly specific anti-5-methylcytosine monoclonal antibody for defined, reproducible results. INSTRUCTION MANUAL Methylated-DNA IP Kit Catalog No. D5101 Highlights Methylated DNA enrichment for large-scale DNA methylation analysis. A highly specific anti-5-methylcytosine monoclonal antibody for

More information

mirna QPCR Master Mix

mirna QPCR Master Mix mirna QPCR Master Mix Instruction Manual Catalog #600583 Revision D.0 For Research Use Only. Not for use in diagnostic procedures. 600583-12 LIMITED PRODUCT WARRANTY This warranty limits our liability

More information

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Perform an HRM Methylation Study

Perform an HRM Methylation Study Quick Reference Card Perform an HRM Methylation Study This quick reference card provides brief procedures for performing an HRM methylation study using MeltDoctor HRM Master Mix and High Resolution Melting

More information

GenScript TissueDirect TM Multiplex PCR System

GenScript TissueDirect TM Multiplex PCR System GenScript TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Version 20040908 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2

More information

Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA.

Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA. Methylamp MS-qPCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Automated Protocol for Extract-N-Amp Plant PCR Kits Using the Tecan Freedom EVO 150 Workstation

Automated Protocol for Extract-N-Amp Plant PCR Kits Using the Tecan Freedom EVO 150 Workstation Automated Protocol for Extract-N-Amp Plant PCR Kits Using the Tecan Freedom EVO 150 Workstation Extract-N-Amp Plant Product Codes XNAR and XNAPR Automation Guide 2 I. Description 2 II. Product Components

More information

SuperReal PreMix Plus (SYBR Green)

SuperReal PreMix Plus (SYBR Green) SuperReal PreMix Plus (SYBR Green) For fast, quantitative, real-time PCR using SYBR Green www.tiangen.com/en QP120627 SuperReal PreMix Plus (SYBR Green) Cat. no. FP205 Kit Contents Contents 2 SuperReal

More information

Ultra-Sensitive BRAF Mutation Detection Kit. User Manual

Ultra-Sensitive BRAF Mutation Detection Kit. User Manual Ultra-Sensitive BRAF Mutation Detection Kit User Manual Catalog Number: BRAF0001-20 BRAF0001-50 Size: 20 tests/kit 50 tests/kit Intended Use: For Research Use Only Doc. No.: Revision: 100-BRAF0001 Rev.

More information

Brilliant II SYBR Green QPCR Master Mix

Brilliant II SYBR Green QPCR Master Mix Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions

Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION

MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION ICBAA2017-30 MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION Mohd Shahrul Nizwanshah Karim and Siti Nor Akmar Abdullah Laboratory

More information

SYBR Advantage qpcr Premix User Manual

SYBR Advantage qpcr Premix User Manual SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General

More information

AmpliTaq 360 DNA Polymerase

AmpliTaq 360 DNA Polymerase Product Bulletin AmpliTaq 360 AmpliTaq 360 360 Coverage for a Full Range of Targets AmpliTaq 360 Benefits Optimized for the broadest range of targets (

More information

Taq + dntps #EZ U

Taq + dntps #EZ U #EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +

More information

Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application

Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1

More information

amplification High Resolution Melt Parameter Considerations for Optimal Data Resolution tech note 6009

amplification High Resolution Melt Parameter Considerations for Optimal Data Resolution tech note 6009 amplification tech note 6009 High Resolution Melt Parameter Considerations for Optimal Data Resolution Carl Fisher, Ray Meng, Francisco Bizouarn, and Rachel Scott Gene Expression Division, Bio-Rad Laboratories,

More information

CENTER FOR CELL & GENE THERAPY VECTOR DEVELOPMENT LABORATORY, 10 TH FLOOR, ALKEK BUILDING ONE BAYLOR PLAZA, HOUSTON, TEXAS 77030

CENTER FOR CELL & GENE THERAPY VECTOR DEVELOPMENT LABORATORY, 10 TH FLOOR, ALKEK BUILDING ONE BAYLOR PLAZA, HOUSTON, TEXAS 77030 1. Purpose 1.1. The purpose of this protocol is to detect host cell DNA contamination in purified viral vector preparations. 1.2. This procedure is routinely performed in the Vector Development Laboratory

More information

User Manual. Version 5. Published February Catalog No. K1021 ~

User Manual. Version 5. Published February Catalog No. K1021 ~ GeneFishing TM DEG Premix Kit User Manual Version 5 Published February 2005 Catalog No. K1021 ~ 1026 Table of Contents 1. Notices to Customers 1.1 Product Warranty and Liability------------------------------------

More information

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the

More information

Guidelines for Developing Robust and Reliable PCR Assays

Guidelines for Developing Robust and Reliable PCR Assays Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay

More information

OsHV-1 detection and quantification by Real Time Polymerase Chain Reaction

OsHV-1 detection and quantification by Real Time Polymerase Chain Reaction European Union Reference Laboratory for Molluscs Diseases OsHV-1 detection and quantification by Real Time Polymerase Chain Reaction CONTENTS 1. SCOPE...2 2. REFERENCES...2 3. EQUIPMENT AND ENVIRONMENTAL

More information

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version

More information

Critical Factors For Successful Real-Time RT-PCR

Critical Factors For Successful Real-Time RT-PCR Critical Factors For Successful Real-Time RT-PCR Andreas Missel, PhD Senior Scientist R&D Dept. Modification/Amplification QIAGEN Annealing Specific product High yield High sensitivity Nonspecific product

More information

DETERMINATION OF THE Rh FACTOR BY PCR

DETERMINATION OF THE Rh FACTOR BY PCR DETERMINATION OF THE Rh FACTOR BY PCR Ref.: PCR2 1. EXPERIMENT OBJECTIVE The aim of this experiment is to introduce students to the principles and practice of the Polymerase Chain Reaction (PCR) by studying

More information

SYBR Advantage qpcr Premix. User Manual

SYBR Advantage qpcr Premix. User Manual User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company

More information

Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions

Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger

More information

Rapid amplification of cdna ends (RACE)

Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE

More information