STRR / LTRR FINGERPRINTING PATTERNS

Transcription

1 STRR LTRR Oscillatoriales Phormidium sp. Planktothrix rubescens Planktothrix agardhii STRR / LTRR FINGERPRIING PATTERNS 0 r = Phormidium sp. Limnothrix redekei Planktothrix pseudoagardhii Nostocales STRR LTRR Anabaena spiroides Anabaena planctonica Anabaena circinalis gen I Cylindrospermopsis raciborskii Identification potential Use of repeated sequences specific from the Cyanobacteria genome to reach the identification of most isolates Aphanizomenon gracile gen I Primer Reference Anabaenopsis circularis Anabaena flos-aquae Anabaena sp. Aphanizomenon gracile gen II Anabaena circinalis gen II Aphanizomenon issatschenkoi Aphanizomenon ovalisporum STRR1F 5 - CCCCARTCCCCART -3 Mazel et al STRR3F 5 - CAACAGTCAACAGT -3 Mazel et al LTRR 5 - GTTTTAACTAACAAAAATCCCTATCAGGGA TTGAAAG-3 Masepohl et al Aphanizomenon flos-aquae r = 0.87 Valério et al., Microbiology 155:

2 02 M13 / ERIC FINGERPRIING % Genomic relationship M13 ERIC Isolado Data de isolamento PATTERNS T LMECYA 142 LMECYA 144 LMECYA 91B LMECYA 127 LMECYA 128 LMECYA 13 LMECYA 97 LMECYA 92C LMECYA 110 LMECYA 92A LMECYA 93 LMECYA 92B LMECYA 103 LMECYA 113 LMECYA 3 LMECYA 7 LMECYA 160 LMECYA ND Differentiation potential Use of RADP (Random Amplification of Polymorphic DNA) primers to differentiate cyanobacteria strains r = 0.94 Detection of a toxic strain resident in Montargil reservoir Primer Reference M13 5 -GAGGGTGGCGGTTCT-3 Meyer et al ERIC ERICIR (5 -ATGTAAGCTCCTGGGGATTCAC-3 ) ERIC2 (5 -AAGTAAGTGACTGGGGTGAGCG-3 ) Versalovic et al Montargil Montargil Valério et al., Microbiology 155:

3 02 M13 / ERIC FINGERPRIING % Genomic relationship M13 ERIC Isolado Data de isolamento PATTERNS T LMECYA 142 LMECYA 144 LMECYA 91B LMECYA 127 LMECYA 128 LMECYA 13 LMECYA 97 LMECYA 92C LMECYA 110 LMECYA 92A LMECYA 93 LMECYA 92B LMECYA 103 LMECYA 113 LMECYA 3 LMECYA 7 LMECYA 160 LMECYA ND Temporal relationship = T de novo genomic types Valério et al., Microbiology 155:

4 03 rrna 16S 0.1 Species identification 0.80 Anabaena macrospora AJ Anabaena spiroides AJ Anabaena planctonica LMECYA 177 EU Anabaena planctonica AB Anabaena solitaria AY Anabaena spiroides AJ Anabaena spiroides LMECYA 161 EU Anabaena circinalis LMECYA 17 EU Anabaena circinalis LMECYA 126 EU Anabaena circinalis AF Aphanizomenon flos-aquae LMECYA 125 EU Aphanizomenon flos-aquae LMECYA 77A EU Aphanizomenon flos-aquae AJ Aphanizomenon flos-aquae AJ Aphanizomenon flos-aquae LMECYA 88 EU Aphanizomenon flos-aquae AY Aphanizomenon flos-aquae LMECYA 10 EU Aphanizomenon gracile AJ Aphanizomenon gracile LMECYA 9 EU Aphanizomenon gracile AJ Aphanizomenon gracile LMECYA 64 EU Aphanizomenon gracile LMECYA 40 AY Aphanizomenon gracile LMECYA 148 EU Anabaena cylindrica AJ Anabaena circinalis LMECYA 213 EU Anabaena circinalis 90 AJ Aphanizomenon issatschenkoi AJ Aphanizomenon issatschenkoi LMECYA 31 AY Cylindrospermopsis raciborskii AF Cylindrospermopsis raciborskii LMECYA 134 AY Anabaena flos-aquae AF Anabaena flos-aquae LMECYA 165 EU Anabaena sp. LMECYA 182 EU Anabaenopsis circularis LMECYA 205 EU Anabaenopsis circularis LMECYA 206 EU Anabaenopsis sp. AY Nodularia spumigena DQ Nostoc linckia AB Tolypothrix sp. AB Fischerela muscicola AB Nostochopsis sp. AJ Chlorogloeopsis fritschii AB Stigonema ocellatum AJ Chroococcidiopsis sp. AB Scytonema sp. AB Pseudanabaena sp. AF Planktothrix agardhii AB Planktothrix agardhii LMECYA 153E EU Planktothrix rubescens AB Planktothrix rubescens LMECYA 203 DQ Planktothrix pseudagardhii LMECYA 162 EU Planktothrix pseudagardhii AB Spirulina platensis AY Prochloron sp. X63141 Microcystis aeruginosa LMECYA 81 EU Microcystis aeruginosa LMECYA 2 EU Microcystis aeruginosa LMECYA 110 EU Microcystis aeruginosa LMECYA 2 EU Microcystis aeruginosa LMECYA 8 EU Microcystis aeruginosa LMECYA 136 EU Microcystis ichthyoblabe AB Microcystis aeruginosa LMECYA 170 EU Microcystis aeruginosa Z28699 Microcystis aeruginosa LMECYA 159 EU Microcystis aeruginosa LMECYA 188 EU Microcystis aeruginosa LMECYA 91B EU Microcystis novacekii AB Microcystis aeruginosa LMECYA 151 EU Microcystis wesenbergii AB Microcystis viridis AB Microcystis aeruginosa LMECYA 157 EU Microcystis aeruginosa LMECYA 82 EU Microcystis aeruginosa LMECYA 142 EU Synechocystis sp. LMECYA 68 EU Synechocystis sp. AB Gloeocapsa sp. AB Dermocarpella incrassata AJ Xenococcus sp. AB Pleurocapsa sp. AB Myxosarcina sp. AJ Stanieria cyanosphaera AB Limnothrix redekei LMECYA 145 EU Limnothrix redekei AJ Prochlorothix hollandica AF Phormidium sp. LMECYA 79 EU Phormidium sp. LMECYA 173 EU LeptolyngbyaAB Phormidium sp. LMECYA 214 EU Phormidium sp. AB Synechococcus nidulans LMECYA 156 EU Prochlorococcus marinus NC Synechococcus sp. AY Cyanobium sp. AY Gloeobacter violaceus NC E. coli NC Nostocales Nostocales Oscillatoriales Chroococcales Oscillatoriales Chroococcales 0.1 rpoc1 Anabaena circinalis LMECYA 17 EU Anabaena circinalis LMECYA 126 EU Anabaena circinalis AF Anabaena circinalis gen IA AF Anabaena spiroides LMECYA 161 EU Anabaena spiroides AF Anabaena solitaria AF Anabaena planctonica AB Anabaena planctonica LMECYA 177 EU Aphanizomenon gracile LMECYA 40 EU Aphanizomenon gracile LMECYA 64 EU Aphanizomenon gracile LMECYA 148 EU Anabaena circinalis LMECYA 213 EU Anabaena circinalis AY Aphanizomenon gracile LMECYA 9 EU Aphanizomenon issatschenkoi LMECYA 31 EU Aphanizomenon flos-aquae LMECYA 77A EU Anabaena cylindrica AB Aphanizomenon flos-aquae LMECYA 125EU Aphanizomenon flos-aquae LMECYA 10 EU Aphanizomenon flos-aquae LMECYA 88 EU Anabaena flos-aquae LMECYA 165 EU Anabaena flos-aquae AF Aphanizomenon gracile AF Anabaena sp. LMECYA 182 EU Cylindrospermopsis raciborskii LMECYA 134 EU Cylindrospermopsis raciborskii AF Anabaenopsis circularis LMECYA 205 EU Anabaenopsis circularis LMECYA 206 EU Chlorogloeopsis fritschii AB Fischerella muscicola AB Scytonema sp. AB Chroococcidiopsis sp. AB Tolypothrix sp. AB Nodularia spumigena AY Anabaena variabilis AB Nostoc linckia AB Planktothrix agardhii LMECYA 153E EU Planktothrix agardhii AB Planktothrix agardhii AY Planktothrix rubescens LMECYA 203 EU Spirulina platensis AB Microcystis aeruginosa LMECYA 188 EU Microcystis viridis AY Microcystis aeruginosa LMECYA 91B EU Microcystis aeruginosa LMECYA 2 EU Microcystis aeruginosa LMECYA 8 EU Microcystis aeruginosa LMECYA 157 EU Microcystis aeruginosa LMECYA 110 EU Microcystis aeruginosa LMECYA 170 EU Microcystis aeruginosa AY Microcystis aeruginosa LMECYA 142 EU Microcystis aeruginosa LMECYA 82 EU Microcystis aeruginosa LMECYA 159 EU Microcystis aeruginosa LMECYA 81 EU Microcystis wesenbergii AB Microcystis aeruginosa LMECYA 136 EU Microcystis aeruginosa LMECYA 151 EU Synechocystis sp. LMECYA 68 EU Synechocystis sp. BA Dermocarpa sp. U52341 Xenococcus sp. AB Pleurocapsa sp. AB Stanieria cyanosphaera AB Prochloron sp. Z Phormidium sp. LMECYA 79 EU Phormidium sp. LMECYA 173 EU Leptolyngbya sp. AB Synechococcus sp. AF Phormidium sp. AB Cyanobium sp. AJ Prochlorococcus marinus NC Prochlorothrix hollandica Z11154 Synechococcus elongatus NC Pseudanabaena sp. AB Limnothrix redekei LMECYA 145 EU Gloeobacter violaceus NC Gloeobacter violaceus U52340 E. coli NC S / rpoc1 PHYLOGENIES Nostocales Nostocales Nostocales Oscillatoriales Chroococcales Oscillatoriales Chroococcales Oscillatoriales Valério et al., Microbiology 155:

5 04 Microcystins gene cluster Non-Ribosomal Peptide Synthesis Toxins molecular markers MCY MARKERS Kb Microcystis aeruginosa (Tillet et al. Chem. Biol., 2000) mcy J I H mcy G mcy F mcy E mcy D mcy A mcy B mcy C Planktothrix agardhii (Christiansen et al. J. Bacteriol., 2003) mcy T mcy D mcy E mcy G mcyh mcy A mcy B mcy C mcyj Anabaena circinalis (Rouhiainen et al. Appl. Environ. Microbiol., 2004) mcy H I F mcy E mcy J mcy D mcy G mcy A mcy B mcy C Legend: PS PKS Other functions 300 bp Microcystins Hisbergues et al. Arch. Microbiol., bp 955 bp Mikalsen et al. J. Bacteriol., 2003

6 04 Validation using 124 LMECYA culture collection isolates Toxins molecular markers MCY MARKERS 1 Kb plus LMECYA 123 LMECYA 175 LMECYA 177 LMECYA 31 LMECYA 166 LMECYA 40 LMECYA 64 LMECYA 77A LMECYA 88 LMECYA 89 LMECYA 134 Marau 1 LMECYA 91B LMECYA 137 LMECYA 144 LMECYA 183 LMECYA 145 LMECYA 152 LMECYA 153E LMECYA 153F LMECYA 127 Anabaena circinalis Anabaena planctonica Aphanizomenon issatschenkoi Aphanizomenon gracile Aphanizomenon flos-aquae Cylindrospermopsis raciborskii Microcystis aeruginosa Limnothrix redekei Planktothrix agardhii Microcystis aeruginosa Using only one or two mcy markers: some false positives are obtained 1 Kb plus LMECYA 2 LMECYA 3 LMECYA 7 LMECYA 53 LMECYA 55 LMECYA 56 LMECYA 57 LMECYA 59 LMECYA 87 LMECYA 92A LMECYA 92B LMECYA 92C LMECYA 93 LMECYA 103 LMECYA 106 LMECYA 107 LMECYA 108 LMECYA 110 LMECYA 113 LMECYA 151 LMECYA 159 LMECYA 160 LMECYA 167 LMECYA 170 LMECYA 179 LMECYA 203 M. aeruginosa P. rubescens Using the multiplex PCR for the 3 mcy markers: no false-positives Sensitivity: 92.3% Specificity: 100% Valério et al., 2010 Environ Toxicol. 25(3):

7 04 Application to environmental samples Toxins molecular markers MCY MARKERS Sampling Reservoirs Odivelas Reservoir: positive (3 bands) ELISA: 2.03 g/l Monte Novo Reservoir: negative (1 band) ELISA: negative Odivelas Monte Novo Valério et al., 2010 Environ Toxicol. 25(3):251-60

8 04 Cylindrospermopsin gene cluster Non-Ribosomal Peptide Synthesis Toxins molecular markers CYL MARKERS Cylindrospermopsins Aphanizomenon ovalisporum Shalev-Alon et al. FEMS Microbiol. Lett., 2002 Legend: PS PKS Amidinotransferase 650 bp* 600 bp* 422 bp # 597 bp # * Schembri et al. Environm. Toxicol., 2001 # Fergusson & Saint Environm. Toxicol., 2003 PKS fragment PS fragment Komarek 2013 Cyanoprokaryota 3. Teil/3rd Part: Heterocytous genera

9 04 Toxins molecular markers CYL MARKERS Validation using 120 LMECYA culture collection isolates 2 positive controls: Aphanizomenon ovalisporum Cylindrospermopsis raciborskii 118 non-toxic T T PS gene PKS gene Sensitivity: 100% Specificity: 100% Valério et al., 2005 Harmful Algae. 4(6):

10 05 Effect of light intensity on gene expression Expression levels MCY MARKERS Planktothrix agardhii Microcystis aeruginosa Legend: 4 µmol photons m -2 s µmol photons m -2 s µmol photons m -2 s -1 Light intensities tested had distinct influences on microcystin production and mcya expression levels, presenting considerable differences between P. agardhii and M. aeruginosa. The verified trend concerning the increase of the mcya expression levels prior to the increase in microcystins content per cell need further confirmation, however it could help water management authorities foresee the peaks of toxicity, which would be preceded by a peak in mcya transcripts. Salvador et al., 2016 J Microbiol Methods. 123:4-12

11 06 Using Real-Time PCR to determine cell counts Planktothrix agardhii Real-Time PCR CELL COUS Correlation between Ct values and log cell numbers from serial dilutions of DNA extracts from P. agardhii LMECYA 153B Correlation between optical light microscopy cell count numbers and real-time qpcr estimative cell concentration for a serial tenfold dilutions range between 79,102 and 8 cells / µl of P. agardhii LMECYA 153B Churro et al., 2012 Arch Microbiol. 194(9):

12 06 Real-Time PCR CELL COUS P. agardhii quantification in environmental samples Churro et al., 2012 Arch Microbiol. 194(9):

13 06 2 year monitoring of a reservoir ( ) Real-Time quantification of: - rpoc1 specific for Planktothrix (Churro et al. 2012) Real-Time PCR MONITORING Gene copies nº.ml -1 rpoc1 gene (copies.ml -1 ) Microcystins (ug.l -1 ) 2012 Time 2014 Churro et al., ºCIC

14 06 2 year monitoring of a reservoir ( ) Real-Time quantification of: - mcya for cyanobacteria (Hisbergues et al. 2003) Real-Time PCR MONITORING Gene copies nº.ml -1 mcya gene (copies.ml -1 ) Microcystins (ug.l -1 ) 2012 Time 2014 Churro et al., ºCIC

15 06 2 year monitoring of a reservoir ( ) Real-Time quantification of: - mcya specific for Planktothrix (Briand et al. 2008) Real-Time PCR MONITORING Gene copies nº.ml -1 Spearman correlation coeficient 0.84 mcya gene (copies.ml -1 ) Microcystins (ug.l -1 ) 2012 Time 2014 Churro et al., ºCIC