Chapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics

Transcription

1 Chpter 9 Mpping nd chrcterizing whole genomes Structurl Genomics Functionl genomics

2 How mny genes hs humn?

3 5,500 27,000

4 Interprettion of genomic informtion: high throughput technologies re used to get ides out gene (or genomic) function.

5 Structurl nd functionl genomics: hierrchicl representtion

6 Structurl Genomics. The nlysis of the physicl structure of genomes.

7 Mpping Genomes Cytogenetic nd Genetic mps were very helpful for sequencing genomes. Cytogenetic mps re estlished y correlting chromosoml lndmrks with phenotyps. The correltion with the loction of cloned DNA cn result in high resolution mps.

8 Chromosome pinting y in situ hyridistion using differentlelled proes.

9 Genetische Krten A = rote Blüte, B = hohe Pflnze A B A B X F1: A B

10 Genetische Krten 1: die Phänotypen der Allele der Gene A und B werden etrchtet A prentl: A B X B 90 rekominnt: A B 10 Die Gene A und B sind mit 10 cm gekoppelt, Anlyse durch Auswertung der Phänotypen

11 Genetische Krten 2: der Phänotyp der Allele von A und der DNA-Polymorphismus in Position B werden etrchtet A B prentl: A B X Phänotyp DNA in B A/ B/ / 90 / rekominnt: A A/ / B/ B 10 /

12 Genetische Krten 3: die DNA-Polymorphismen in den Positionen A und B werden etrchtet A B prentl: DNA in A DNA in B A B A/ / B/ / X 90 rekominnt: A A/ / / B/ B 10

13 High resolution genetic mps: mking use of meiotic recomintion ) Restriction frgment lenght polymorphism mps (RFLP mps) neutrl DNA sequence vrition is used

14 A proe P detects DNA polymorphism when the genomic DNA is cut y certin restriction enzyme (RE). The pedigree of the dominnt disese phenotype D shows linkge of the D locus to the RFLP locus; only child 8 is recominnt.

15 Otining DNA fingerprint y using VNTR (vrile numer tndem repets) proe. VNTRs re lso clled ministellite DNA. VNTRs consist of vrile numer of repeting unit which is out 15 to 100 p in length. preprtion of the proe

16 In this exmple, Southern lot is used for detection. Now replced y PCR

17 DNA fingerprints re used in forensic medicine. Minute DNA mounts isolted for exmple from lood re used y mplifying specific VNTR sequences with PCR.

18 VNTRs cn e used for genetic mpping. The moleculr mrkers cn e mpped to one nother or to locus with known phenotype.

19 Microstellite Mrkers Microstellites is clss of repetitive DNA tht is sed on di- nd trinucleotide repets tht re highly vrile etween individuls. These simple-sequence length polymorphisms (SSLPs) re lso used for genetic mpping. (VNTRs re lso clssified s SSLPs). 5' Primer 1 (CA) n (GT) n Primer 2 5'

20 Microstellites s moleculr mrkers for mpping.

21 Microstellites s moleculr mrkers for mpping.

22 High resolution genetic mps ) Simple sequence length polymorphisms (SSLPs) RFLP mrkers hve first een used in moleculr mpping projects. They re now replced y mrkers sed on the vrition of short tndem repets. Tndemly repeted Vrile numers of repets, give different size restriction frgments detected on Southern lots Simple sequence length polymorphisms (SSLPs) e.g., TGACGTATGACGTATGACGTATGACGTA muttions give rise to lrge numer of lleles higher proportion of heterozygotes two types in genomics ministellite (VNTRs) microstellite

23 Ministellites sed on vrition of numer of tndem repets (VNTRs) which segregte s lleles in humns, repet unit is nucleotides, for totl of 1-5 k if numer of repets is vrile, Southern lot will show numerous nds sis of DNA fingerprinting nd cn e used in mpping Microstellites sequences dispersed throughout the genome vrile numers of di- or trinucleotide repets detected y PCR There re severl more moleculr mpping techniques existing

24 Physicl Mpping of Genomes

25 Long chromosoml frgments (~ 150 k) cn e cloned into BAC vector nd genomic lirqry cn e estlished.

26 Individul BAC clones re lligned in order to cover whole chromosomes. These BAC contigs re one possile strting mteril for genome sequencing projects. (An exmple from the yest genome is presented in the next figure.) chromosome heterochromtin centromer

27

28 Genome projects After lignement of the BAC clones, ech BAC is sequenced y shotgun sequencing: DNA frgments of 1-2 k re generted, sequenced from oth ends, nd ligned y sequence comprisons. An lterntive is to omitt the BAC clones nd to strt shotgun sequencing directly with the genomic DNA.

29 A cteril genome

30 Aridopsis thlin genome sequence The Aridopsis genome inititive, Nture 408, (2000)

31 Lin et l, Nture 402, (1999)

32 Proportion of predicted genes in functionl ctegories Aout 25,000 genes hve een predicted The Aridopsis genome inititive, Nture 408, (2000)

33 Segmentlly duplicted regions in the Aridopsis genome. The Aridopsis genome inititive, Nture 408, (2000)

34 Functionl genomics Study of expression nd interction of gene products Requires new voculry nd techniques trnscriptome: ll DNA trnscripts my e monitored y use of DNA chips proteome: ll encoded proteins complicted y lterntive splicing interctome: ll interctions etween ll ctegories of molecules detected y two-hyrid system nd relted procedures phenome: phenotype of ech gene knockout

35 Functionl genomics The study of trnscriptionl regultion y using DNA chips The study of proteins y using 2D gels nd mss spectroscopy The study of metolites y using chromtogrphic seprtion nd mss spectroscopy

36 The nlysis of cells, tissues, nd orgnisms cn occur on different levels of gene expression DNA Genome RNA Trnscriptome Protein Proteome Metolite Metolome

37 Trnscriptome nlysis using microrrys (DNA chips)

38 Disply of gene expression ptterns detected y microrrys. Ech row is different gene nd ech column different time point. Red mens ctive; green inctive.

39 Proteome Cterpillr nd utterfly of the sme species Lottspeich, Angewndte Chemie, 1999

40

41 Aridopsis proteins seprted on 2D PAGE; provided y Angelik Görg First Dimension: 3-10 IPG isoelectric focusing SDS PAGE

42 MALDI-TOF nlysis of proteins grting smple + + TOF detector UV or IR lser

43 Lipophilic phse of Aridopsis leves nlysed y GC/MS; ~ 160 metolites cn e distiguished.

44 Metolite profiling y GC/MS. Bse pek intensity GC/MS chromtogrm of the polr frction of lef extrct from the Aridopsis dgd1 mutnt (A). Trget metolites re identified y exct retention times nd their corresponding mss spectr (B) s shown for the co-eluting peks of mlte, -minoutyric cid (GABA), nd n unidentified compound. m/z, Rtio of mss to chrge.

45 Functionl Genomics Scheme showing how the integrtion of results from different technologicl levels of functionl genomics leds to construction of virtul plnt