MATCHMAKER LexA Two-Hybrid System

Transcription

1 MATCHMAKER LexA Two-Hybrid System Catalog # K and MATCHMAKER LexA Libraries User Manual (PT3040-1) See the Yeast Protocols Handbook (PT3024-1) for supporting protocols that are not included in this User Manual. See list of components (section II.A) for storage conditions. FOR RESEARCH USE ONLY (PR67300)

2 Table of Contents I. Introduction 4 II. Product Information 14 A. List of Components 14 B. Yeast Strain Phenotype Verification 17 C. Premade MATCHMAKER LexA Library Information 18 III. Proper Use of Controls and Selection Media 21 IV. Overview: Testing for a Protein-Protein Interaction 24 V. Overview: LexA Two-Hybrid Library Screening 29 VI. LexA Two-Hybrid Library Transformation and Screening Protocols 34 A. General Information 34 B. Yeast Transformation Protocols 38 C. Plating Transformation Mixtures 41 D. Calculating Cotransformation Efficiency and Number of Clones Amplified 42 E. Screening Library Cotransformants for Two-Hybrid Interactions 42 VII. Analysis and Verification of Putative Positive Clones 45 A. Sorting Colonies to Eliminate Duplicates 45 B. Eliminating False-Positive Clones 47 C. Using Yeast Mating to Eliminate False Positives 48 D. Rescuing AD/Library Plasmids via Transformation of E. coli KC8 52 E. [Optional] Additional Two-Hybrid Tests to Verify Positive Interactions 54 F. Other Methods to Verify Positive Interactions 54 VIII. Troubleshooting Guide 56 IX. References 60 X. Related Products 64 Appendix A: Plasmid Maps & MCS 65 Appendix B: Library Titering 68 Appendix C: Library Amplification 70 Appendix D: Media and Solution Formulations 71 Appendix E: Published LexA Two-Hybrid Results 75 page Protocol # PT Technical Service TEL: or CLON 2 Version # PR67300 FAX: or

3 Table of Contents continued CLONTECH Laboratories, Inc. List of Tables Table I. List of Abbreviations 4 Table II. Genotypes of Yeast Host Strains 15 Table III. Description of Plasmids 16 Table IV. Phenotype Testing of the Yeast Host Strains 17 Table V. Control Transformations for LexA Two-Hybrid Assays 22 Table VI. Guide to Yeast Transformation Protocols 36 Table VII. Comparison of Two-Hybrid Library Transformation Methods 37 Table VIII. Recommended Set-up for a LexA Library Transformation 37 Table IX. Controls and Selection Media for Library Screening 44 Table X. Yeast Matings to Eliminate False Positives 51 List of Figures Figure 1. Schematic diagram of the MATCHMAKER LexA Two-Hybrid System 7 Figure 2. Using the MATCHMAKER LexA Two-Hybrid System to test for an interaction between two known proteins 11 Figure 3. Using the MATCHMAKER LexA Two-Hybrid System to screen an AD fusion library for proteins that interact with a bait protein 12 Figure 4. Flow chart for using the MATCHMAKER LexA Two-Hybrid System to test for an interaction between two known proteins 25 Figure 5. Flow chart for using the MATCHMAKER LexA Two-Hybrid System to screen an AD fusion library 30 Figure 6. Strategies for analyzing and verifying putative positive clones from a LexA two-hybrid library screening 46 Figure 7. Using yeast mating to eliminate false positives that arise in a LexA two-hybrid library screening 49 Figure 8. plexa plasmid map and MCS sequence 64 Figure 9. pb42ad plasmid map and MCS sequence 65 Figure 10. p8op-lacz plasmid map 66 TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

4 I. Introduction TABLE I. LIST OF ABBREVIATIONS Two-Hybrid Terminology AD fusion library A cdna (or genomic) library constructed in an [or AD library] AD vector such that the proteins encoded by the inserts are fused to the AD AD/library plasmid Plasmid encoding a fusion of the AD and a library insert AD/library protein A hybrid comprised of the AD fused to a protein encoded by a library insert AD/protein Y A hybrid comprised of the AD fused to a known, previously cloned protein (Y) AD vector Plasmid encoding the activation domain (AD) DNA-BD vector Plasmid encoding the LexA protein (including the DNA-BD) DNA-BD/protein X A hybrid comprised of the LexA protein fused to a known, previously cloned protein (X) DNA-BD/target plasmid Plasmid encoding the DNA-BD/target protein [or bait plasmid] DNA-BD/target protein A hybrid comprised of the DNA-BD fused with the [or bait protein] target protein Yeast Phenotypes His, or Leu, Requires histidine (His), or leucine (Leu), or or Trp, or Ura tryptophan (Trp), or uracil (Ura) in the medium to grow; is auxotrophic for one (or more) of these specific nutrients. LacZ + Expresses the lacz reporter gene; is positive for β-galactosidase activity Leu + Expresses the LEU2 reporter gene; does not require Leu in the medium to grow Miscellaneous EGY48[p8op-lacZ] Yeast strain EGY48 transformed with the autonomously replicating plasmid p8op-lacz SD medium Minimal synthetic dropout medium (with glucose) SD induction medium SD medium containing galactose (and raffinose) [or SD/Gal/Raf] as the carbon source; used to induce expression of AD fusion proteins encoded in pb42ad YPH CLONTECH s Yeast Protocols Handbook UM (Product-specific) User Manual page Protocol # PT Technical Service TEL: or CLON 4 Version # PR67300 FAX: or

5 I. Introduction continued The MATCHMAKER LexA Two-Hybrid System is a LexA-based interaction trap for detecting specific protein-protein interactions in yeast (Gyuris et al., 1993; reviewed in Golemis et al., 1996; and Mendelsohn & Brent, 1994). Like other yeast two-hybrid systems, the LexA System can be used either to test for interaction between two previously cloned proteins (Figure 2) or to screen a library for a gene encoding a novel protein that interacts with a known target (bait) protein (Figure 3). For general reviews on yeast two-hybrid systems (including GAL4-based systems), see Bartel et al., 1993a, 1993b; Chien et al., 1991; Fields & Song, 1989; Fields & Sternglanz, 1994; Luban & Goff, 1995; Fritz & Green, 1992; and Guarente, For some published examples of successful twohybrid library screenings using the LexA system, see Appendix E. Both the LexA- and GAL4-based two-hybrid systems utilize a powerful growth selection the conditional expression of a nutritional reporter gene to search large numbers of yeast transformed with a specially constructed fusion library for interacting proteins. When a positive clone is identified, the two-hybrid system provides immediate access to the gene encoding the interacting protein of interest. Site-directed mutagenesis or deletion analysis, combined with additional two-hybrid assays, can then be used to pinpoint the interacting domains. Purified target proteins or antibodies to the protein of interest are not required to obtain a result with the two-hybrid system. However, purified proteins or antibodies may subsequently be used to confirm a two-hybrid result, as discussed in Section VII.F. The MATCHMAKER LexA Two-Hybrid System provides all of the biological materials required to carry out a two-hybrid assay or library screening in yeast, except for the cdnas encoding the proteins of interest or an activation domain (AD) fusion library. (See Section II.A for a complete list of System components.) The plasmids and yeast host strains provided are described in Tables II and III (Section II). Proper use of the control plasmids and selection media is discussed in Section III. Vector maps, MCS sequences, and additional plasmid information are in Appendix A. The MATCHMAKER LexA Two-Hybrid System may be used with premade MATCHMAKER LexA Libraries, or with any other library cloned into an AD fusion vector carrying the yeast TRP1 transformation marker for selection in Trp yeast. Conversely, MATCHMAKER LexA Libraries may be used with the MATCHMAKER LexA Two-Hybrid System or any other two-hybrid system that uses TRP1 to select for the AD vector. The accompanying CLONTECH Yeast Protocols Handbook (YPH; PT3024-1) contains support protocols not provided in this User Manual. Principle of the two-hybrid assay The yeast two-hybrid assay is based on the fact that many eukaryotic transacting transcriptional regulators are composed of physically separable, functionally independent domains. Such regulators often contain a DNA-binding domain TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

6 I. Introduction continued (DNA-BD) that binds to a specific promoter sequence and an activation domain (AD) that directs the RNA polymerase II complex to transcribe the gene downstream of the DNA-binding site (Keegan et al., 1986; Hope & Struhl, 1986; Ma & Ptashne, 1987). Both domains are required to activate a gene and, normally (as in the case of the native yeast GAL4 protein), the two domains are part of the same protein. If physically separated by recombinant DNA technology and expressed in the same host cell, the DNA-BD and AD peptides do not directly interact with each other and thus cannot activate the responsive genes (Ma & Ptashne, 1988; Brent & Ptashne, 1985). However, if the DNA-BD and AD can be brought into close physical proximity in the promoter region, the transcriptional activation function will be restored. In principle, any AD can be paired with any DNA-BD to activate transcription, with the DNA-BD providing the gene specificity (Brent & Ptashne, 1985). In the MATCHMAKER LexA Two-Hybrid System, the DNA-BD is provided by the entire prokaryotic LexA protein, which normally functions as a repressor of SOS genes in E. coli when it binds to LexA operators (Ebina et al., 1983). (With the promoters used in the two-hybrid system, the LexA protein does not act as a repressor.) The AD is an 88-residue acidic E. coli peptide (B42) that activates transcription in yeast (Ma & Ptashne, 1987). Two different cloning vectors are used to generate fusions of these domains to genes encoding proteins that potentially interact with each other, and the recombinant hybrid proteins are coexpressed in yeast. An interaction between a target protein (fused to the DNA- BD) and a library-encoded protein (fused to the AD) creates a novel transcriptional activator with binding affinity for LexA operators (Gyuris et al., 1993; Figure 1). This factor then activates reporter genes having upstream LexA operators and this makes the protein-protein interaction phenotypically detectable. If the two hybrid proteins do not interact with each other, the reporter genes will not be transcibed. See Figure 3 for a schematic overview of using the LexA System to screen an AD fusion library. Inducible expression of fusion proteins from the AD cloning vector Unlike GAL4-based two-hybrid systems, the LexA system does not utilize the GAL4 DNA-BD nor GAL4 binding sequences in the reporter cassette. This makes it possible (in the LexA system) to use the inducible yeast GAL1 promoter for expression of fusion proteins in host strains that are wild-type for GAL4 and GAL80 functions. (See the YPH, Chapter II, for further information on the yeast promoters used in the MATCHMAKER Systems, and Heslot & Gaillardin, 1992, for an excellent review of yeast gene regulation.) In the LexA System, the GAL1 promoter in pb42ad is used to drive expression of cloned or library-encoded proteins fused to the B42 AD. Transformants containing the AD fusion plasmids must be grown in medium containing galactose (and raffinose) as the carbon source when you wish to induce expression of the fusion protein; otherwise, such transformants are grown in glucose-containing medium to keep expression repressed. Inducible expression means there is less opportunity for the foreign page Protocol # PT Technical Service TEL: or CLON 6 Version # PR67300 FAX: or

7 I. Introduction continued A The DNA-BD/protein X (bait) hybrid binds to the LexA operators but cannot activate transcription without the activation domain (AD). Bait protein DNA-BD LexA operators minimal promoter lacz (or LEU2) reporter gene B In the absence of bait protein, the AD/library fusion protein cannot bind to thelexa operators and thus does not activate transcription. AD Library protein LexA operators minimal promoter lacz (or LEU2) reporter gene C Interaction between the bait and library proteins in vivo activates transcription of the reporter gene. Bait protein DNA-BD LexA operators AD Library protein minimal promoter transcription lacz (or LEU2) reporter gene Figure 1. Schematic diagram of the MATCHMAKER LexA Two-Hybrid System. The DNA-BD is the entire LexA protein, including the LexA DNA-binding domain and the dimerization domain. The two reporter genes are separate constructs: lacz is located on the p8op-lacz reporter plasmid, and LEU2 is integrated in the EGY48 genome. AD is an 88-residue acidic peptide with transciptional activation function. fusion proteins to have a toxic effect on the yeast host and thus be eliminated from the pool of potentially interacting proteins. After library transformation, cells are first plated on minimal synthetic dropout (SD) noninduction medium that selects for both the bait and the AD/library plasmids, but not for the two-hybrid interaction directly (Figure 3). This step, TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

8 I. Introduction continued which is analogous to library amplification, maximizes plasmid copy number in each cell. The amplification of plasmids results in increased fusion protein expression levels when the library cotransformants are plated on SD induction medium. This, in turn, improves the chances of detecting AD fusion proteins that interact only weakly or transiently with the bait. The B42 AD used in the LexA System and LexA Libraries is a weak transcriptional activator (relative to the GAL4 AD), but its expression is generally less deleterious to the host cell. Thus, the use of the B42 AD (rather than the GAL4 AD) improves the growth properties of yeast transformants and may allow the detection of a broader spectrum of positive clones (Roger Brent, pers. comm.). Any potential loss of sensitivity due to the weakness of the B42 AD is compensated by the extremely high level of reporter gene expression in this system (discussed below). Reporter gene constructs used in the LexA System The LexA System uses two different reporter genes (LEU2 and lacz) under the control of multiple LexA operators. Although you have the option of using only the LEU2 reporter, most researchers will want to use both. The promoters differ in the sequences flanking the LexA operators; this sequence dissimilarity helps to eliminate some false positives and to confirm the positive two-hybrid interaction. (For a discussion of false positives, see Section VII.B; for further information on the promoter constructs, see the YPH, Chapter II; for general information on yeast promoters, see Heslot & Gaillardin, 1992.) The integrated LEU2 nutritional reporter gene allows the otherwise Leu auxotrophic host cell EGY48 to grow on SD induction medium lacking Leu when transformed with plasmids encoding interacting hybrid proteins. When lacz transcription is activated in EGY48[p8op-lacZ], the cells produce β-galactosidase, whose activity can be monitored using a number of different assays (YPH, Chapter VI). Assaying liquid cultures for enzyme activity yields quantitative data that permits comparison of the relative strength of the two-hybrid interactions observed among several positive clones. The LEU2 reporter gene is preceded by six copies of the LexA operator, and the LacZ gene is preceded by eight copies. Each LexA operator can bind two LexA (i.e., DNA-BD) proteins. The multiple LexA operators contribute to the sensitivity and discrimination of the two-hybrid assay (discussed below). β-galactosidase activity resulting from lacz reporter activation has been shown to correlate in many cases with the level of binding affinity determined using biochemical methods, thus permitting the discrimination of high-, intermediate-, and low-affinity interactions (Estojak et al., 1995). However, β-galactosidase activity cannot be directly converted to binding coefficients (ibid). Sensitivity of the two-hybrid assay is determined by several factors Yeast two-hybrid systems are a sensitive method for detecting relatively weak and transient protein-protein interactions. Such interactions may not be biochemically detectable, but may be critical for the proper functioning of complex page Protocol # PT Technical Service TEL: or CLON 8 Version # PR67300 FAX: or

9 I. Introduction continued biological systems (Guarente, 1993; Estojak et al., 1995). The sensitivity and discrimination of the two-hybrid assay means that it can be used to pinpoint single amino acid residues critical for specific protein-protein interactions and to evaluate protein variants for the relative strength of their interactions (Yang, M. et al., 1995). Protein-protein interactions with a K d as low as ~10 6 M have been detected using the LexA System (Golemis et al., 1996). The sensitivity of the MATCHMAKER LexA Two-Hybrid System is attributable to several factors, some of which are common to two-hybrid assays in general, while others are specific to the LexA System: (1) Many-fold amplification of positive signals in vivo. Because the two-hybrid assay is performed in vivo, the proteins are more likely to be in their native conformations, which may lead to increased sensitivity and accuracy of detection. Furthermore, the sensitivity of detection is greatly increased by the three levels of amplification occurring in vivo (i.e., transcriptional, translational and enzymatic). (Plasmid copy number is discussed below.) (2) High expression levels of the fusion proteins. Obtaining a signal in the twohybrid system depends on the equilibrium association of an interacting protein with the bait (Golemis et al., 1996). In two-hybrid systems, the interacting proteins are present at relatively high concentrations in the yeast nucleus, due to the high copy number of the expression plasmids and, in some cases, the strong promoters driving fusion protein expression. In the LexA System, the DNA-BD/target fusion protein is expressed at high levels from the strong ADH1 yeast promoter in plexa; AD fusion proteins are also expressed at high levels upon induction of the GAL1 promoter. (3) Reporter gene expression levels. The construction of the promoter used to drive expression of the reporter genes is critical not only for the regulation, but also for the sensitivity and background of this transcription-based assay. In the MATCHMAKER LexA System, both the lacz and LEU2 reporters are under control of multiple LexA operators. This allows several DNA-BD/bait hybrid proteins to bind to each promoter and effectively amplifies the intensity of even weak signals (Golemis et al., 1996). The location of the lacz reporter gene on an autonomously replicating, highcopy-number plasmid means there are many copies of this reporter gene in each cell. The library preamplification step described above ensures that the reporter plasmid will have reached its maximum copy number before the cotransformants are plated on the Leu SD induction/selection medium. Thus, in the LexA system, it is possible to assay β-galactosidase acitivity directly on the culture plate by including X-gal in the medium. However, in some cases, such as high background of false positives, the reporter plasmid may be integrated into the EGY48 genome to create a reporter strain with only one copy of the lacz reporter gene per cell (see the Troubleshooting Guide, Section VIII.B). (4) Nature and sensitivity of the reporter detection system. The use of a nutritional reporter gene that can allow a single positive transformant out of several million TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

10 I. Introduction continued to grow on a selection plate is an elegant and sensitive detection system. Furthermore, in the LexA system, the LEU2 reporter gene is under absolute control of the LexA operators; there is no leaky constitutive expression. The β-galactosidase encoded by the lacz reporter can be detected using a variety of assays which differ in their relative levels of sensitivity (see the YPH, Chapter VI.A). Analysis of putative positive clones Two-hybrid library screening using the MATCHMAKER LexA System typically results in many positive colonies and may result in a population preference for clones exhibiting strong activation of the LEU2 reporter (Estojak et al., 1995). To more quickly find the few clones having weak or transient two-hybrid interactions, or to find interacting proteins encoded by rare messages, it is helpful to eliminate positive colonies bearing the same AD library plasmid. We provide two rapid insert-screening procedures in the accompanying YPH, one based on PCR amplification and the other on yeast colony hybridization. After the clones have been sorted into groups, a representative of each unique type is then analyzed for false-positive interactions. Screening for expression of the lacz reporter, which has a different promoter from the LEU2 reporter, eliminates many of the false positives that arise in a typical two-hybrid library screening. Nevertheless, a significant proportion of the positive candidates may be false positives, that is, contain AD/library proteins that activate both reporter genes whether or not the specific DNA-BD/target protein is present (Bartel et al., 1993a). To eliminate these false positives, the candidate AD/library plasmids are subsequently tested for reporter gene activation with various bait constructs or the parental plexa plasmid via cotransformation or yeast mating, as described in Sections VII.B & C. Truly positive AD/library plasmids activate both reporter genes only when the original bait plasmid is also present. Yeast mating significantly reduces the time and the number of transformations required to demonstrate specificity of the interaction when many clones are being analyzed (Figures 6 & 7). After sequencing the positive clones, most researchers choose to confirm the protein-protein interactions using independent, biochemical methods, for example, affinity chromatography and/or an immunoassay (Section VII.F; Fields & Sternglanz, 1994). Troubleshooting Overall, the many advantages of the MATCHMAKER LexA Two-Hybrid Assay make this a very attractive system; however, there are potential drawbacks associated with any yeast two-hybrid system. For example, some test proteins may have intrinsic DNA-binding and/or transcriptional activating properties, and deletion of certain portions of the test proteins may be required to eliminate the unwanted activity, as discussed in the Troubleshooting Guide (Section VIII.A) and in Bartel et al. (1993b). Furthermore, complications might arise if the hybrid proteins are not stably expressed in or localized to the yeast nucleus. In some page Protocol # PT Technical Service TEL: or CLON 10 Version # PR67300 FAX: or

11 I. Introduction continued CLONTECH Laboratories, Inc. URA3 LexA op DNA-BD Protein X P GAL1 AD Protein Y p8op-lacz lacz plexa pb42ad HIS3 TRP1 Transform EGY48 with p8op-lacz to create EGY48[p8op-lacZ] Cotransform EGY48[p8op-lacZ] with fusion plasmids Plate culture on SD/ His/ Trp/ Ura to select for all cotransformants Replica-plate colonies to the following media to screen for expression of LEU2. Include X-gal in the medium if you wish to simultaneously assay for lacz expression. (Alternatively, perform colony-lift β-galactosidase assay.) Expected result if two hybrid proteins interact: Expected result if two hybrid proteins do not interact: (a) SD/ His / Trp/ Ura + X-Gal + BU salts White colonies White colonies (b) SD/ His/ Leu/ Trp/ Ura + X-Gal + BU salts No growth No growth (c) SD/Gal/Raf/ His/ Trp/ Ura + X-Gal + BU salts Blue colonies White colonies (d) SD/Gal/Raf/ His/ Leu/ Trp/ Ura + X-Gal + BU salts Blue colonies No growth Figure 2. Using the MATCHMAKER LexA Two-Hybrid System to test for an interaction between two known proteins. Expression of the AD/protein Y fusion is induced in galactosecontaining medium. TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

12 I. Introduction continued URA3 LexA op LexA Bait gene P GAL1 AD Library insert p8op-lacz lacz plexa pb42ad HIS3 TRP1 Transform EGY48 with p8op-lacz to create EGY48[p8op-lacZ] Cotransform EGY48[p8op-lacZ] with bait and library plasmids Plate culture on SD/ Ura/ Trp/ His to amplify yeast cotransformants (Nearly confluent growth) Scrape colonies and plate at high density on Leu SD induction medium to screen for expression of LEU2. Include X-gal in the medium if you wish to simultaneoulsy assay for lacz expression. Colony growth and blue color indicates interaction between the two hybrid proteins White colonies are one class of false positives, likely due to nonspecific activation of the LEU2 reporter only Figure 3. Using the MATCHMAKER LexA Two-Hybrid System to screen an AD fusion library for proteins that interact with a bait protein. page Protocol # PT Technical Service TEL: or CLON 12 Version # PR67300 FAX: or

13 I. Introduction continued cases, the DNA-BD or AD fusion moiety may occlude the normal site of interaction or may impair the proper folding of the hybrid protein, and thus interfere with the ability of the test proteins to interact (van Aelst et al., 1992). In such cases, the protein-protein interaction may not be detectable in a LexA twohybrid system, but may be detectable using a GAL4-based system. Conversely, there may be examples of protein-protein interactions that are detectable in the LexA two-hybrid system but not in a GAL4-based system. The LexA two-hybrid system has been successfully used to identify many different types of protein-protein interactions, including yeast, plant, Drosophila, and mammalian proteins (Appendix E). However, the conditions in yeast cells may not provide the proper folding or post-translational modifications (such as glycosylation) required for interactions of some mammalian proteins. (Such protein-protein interactions may not be detectable using any type of yeast twohybrid assay.) Conversely, the detection of a specific interaction between mammalian proteins in this heterologous assay system does not necessarily indicate that there is a corresponding interaction in the proteins native environment (Fields & Sternglanz, 1994). To verify that such a protein-protein interaction occurs in native cells, we recommend using the Mammalian MATCHMAKER Two-Hybrid Assay Kit (#K1602-1). Alternatively, the positive clones can be used to generate antibodies for use in coimmunoprecipitation studies, or proteins for further biochemical analysis. TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

14 II. Product Information A. List of Components MATCHMAKER LexA Libraries Note: Store libraries and yeast strain at 70 C. 2 x 1.0 ml Plasmid library culture Supplied as liquid bacterial cultures (in LB broth + 25% glycerol). Please see the Product Analysis Certificate (PAC) for the vector and bacterial host strain used, and other lot-specific information. Upon receipt, divide the library cultures into working aliquots (~100 µl each) and store at 70 C. Avoid multiple freeze/thaw cycles. 0.5 ml Saccharomyces cerevisiae EGY48[p8op-lacZ] host strain that has been transformed with the reporter plasmid p8op-lacz; carries LEU2 and lacz under the control of LexA operators. (See Table II for the genotype of EGY48.) Supplied as saturated culture in SD/ Ura medium/25% glycerol. MATCHMAKER LexA Two-Hybrid System (#K1609-1) Enough of each plasmid is provided for ~20 small-scale transformations. Note: Store all yeast strains and E. coli at 70 C. Store sequencing primers and plasmid DNA at 20 C. 50 µl plexa (0.1 µg/µl) 10.2-kb cloning vector; used to generate fusions of the target protein with the LexA protein 50 µl pb42ad (0.1 µg/µl) 6.45-kb cloning vector; used to generate fusions of a known protein (or a collection of library-encoded proteins) with the B42 AD 50 µl plexa-53 (0.1 µg/µl) 11.1-kb positive control plasmid; encodes LexA/murine p53 fusion protein in plexa 50 µl pb42ad-t (0.1 µg/µl) 8.5-kb positive control plasmid; encodes an AD/SV40 large T-antigen fusion protein in pb42ad 50 µl p8op-lacz (0.1 µg/µl) 10.6-kb reporter plasmid; encodes a lacz gene under the control of LexA operators 50 µl plexa-pos (0.1 µg/µl) 13.5-kb positive control plasmid; encodes and expresses a LexA/ GAL4 AD fusion protein page Protocol # PT Technical Service TEL: or CLON 14 Version # PR67300 FAX: or

15 II. Product Information continued 50 µl plexa-lam (0.1 µg/µl) 10.6-kb false-positive detection plasmid; encodes a LexA/human lamin C fusion protein in plexa 0.5 ml Saccharomyces cerevisiae EGY48, reporter host strain; carries a wild-type LEU2 gene under the control of LexA operators. Genotype in Table II. Supplied as saturated culture in YPD medium/25% glycerol. 0.5 ml Saccharomyces cerevisiae YM4271, mating partner for EGY48. Genotype in Table II. Supplied as saturated culture in YPD medium/25% glycerol. 0.5 ml E. coli strain KC8 (in 25% glycerol) Genotype: hsdr, leub600, trpc9830, pyrf::tn5, hisb463, lac X74, stra, galu, K Note: KC8 is kanamycin resistant 20 µl pb42ad sequencing primer (0.05 A 260 units), for sequencing toward the junction of the AD and the cloned candidate interacting protein. The pb42ad sequencing primer binding site is located 38 bp from the 5' end of the MCS. 5' CCAGCCTCTTGCTGAGTGGAGATG 3' (24-mer) 20 µl plexa sequencing primer (0.05 A 260 unit), for sequencing toward the junction of the LexA protein and cloned target protein. The plexa sequencing primer binding site is located 41 bp from the 5' end of the MCS. 5' CGTCAGCAGAGCTTCACCATTG 3' (22-mer) TABLE II. GENOTYPES OF YEAST HOST STRAINS Transformation Strain Genotype a Reporter(s) Markers b References EGY48 c MATα, his3, trp1, ura3, LEU2 his3, trp1, Estojak et al., 1995 LexA op(x6) -LEU2 ura3 YM4271 MATa, ura3-52, his3-200, his3, trp1 Liu et al., 1993 lys2-801, ade2-101, ade5, trp1-901, leu2-3, 112, tyr1-501, gal4-512, gal80-538, ade5::hisg a The his3, leu2, and trp1 mutations are deletions. b Genes used as selection markers in this system. c The UAS of the LEU2 promoter was replaced (by recombination) with 6 copies of the LexA operator sequence, resulting in LEU2 gene expression controlled by LexA protein. Each operator sequence can be bound by a dimer of LexA proteins. Thus, a total of 12 copies of the LexA monomer can bind to the recombinant LEU2 promoter (Ebina et al., 1983; Estojak et al., 1995). TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

16 II. Product Information continued TABLE III. DESCRIPTION OF PLASMIDS Size Hind III Original name Vector Description (kb) Fragments (kb) & References a Cloning vectors plexa LexA (1 202), , 4.8, 0.2 peg202 HIS3, Amp r Gyuris et al., 1993 pb42ad acidic activator B42, , 2.1, pjg4-5 TRP1, Amp r, 0.6, 0.35 Gyuris et al., 1993 HA epitope tag Control plasmids plexa-pos LexA/GAL4 fusion gene, , 4.5, 3.0 psh17-4 HIS3, Amp r Golemis et al., 1994 plexa-53 murine p53 (72 390) in plexa , 5.2, 0.2 Iwabuchi et al., 1993 HIS3, Amp r pb42ad-t SV40 large T-antigen (87 708) , 2.1, 1.0, Li & Fields, 1993; in pb42ad, TRP1, Amp r 0.9, 0.6, 0.5 Chien et al., 1991 plexa-lam Human lamin C (66 230) , 4.3, 0.9, Bartel et al., 1993a in plexa, HIS3, Amp r 0.2 Reporter plasmid p8op-lacz lacz under control of , 2.1, 1.9 psh18-34 lexa op(x8), URA3, Amp r Golemis et al., 1994; Estojak et al., 1995 a plexa-53, pb42ad-t, and plexa-lam are derivatives of the plasmids described in the indicated references; plasmids were modified at CLONTECH. Additional vector information, restriction maps, and multiple cloning site (MCS) sequences are in Appendix A. page Protocol # PT Technical Service TEL: or CLON 16 Version # PR67300 FAX: or

17 II. Product Information continued B. Yeast Strain Phenotype Verification Verify the phenotypes of the yeast strains provided before you use them in a transformation or mating experiment. 1. Yeast strains are provided as stocks in medium with 25% glycerol and can be stored indefinitely at 70 C. 2. From the frozen glycerol stock, make a fresh working stock plate of each strain you plan to use. (For more details, see the YPH, Chapter III.) For additional information on yeast, we recommend Guthrie & Fink s (1991) Guide to Yeast Genetics and Molecular Biology (#V2010-1). Propagate additional cultures only from isolated colonies on this plate. Note: Colonies of strain YM4271 may appear slightly pink because of the ade2-101 mutation and grow to >2 mm in diameter. However, small white colonies will form at a rate of 1 2% due to spontaneous mutations that eliminate mitochondrial function. Avoid these white colonies when inoculating cultures. 3. Test the strains for the following nutritional requirements: tryptophan (Trp), leucine (Leu), histidine (His), and uracil (Ura). a. Using a sterile loop or toothpick, streak 3 4 colonies from the working stock onto separate, appropriately prepared SD plates (Table IV). For information on preparing minimal SD selection media, see Appendix D of this UM and Appendix C of the YPH. b. Incubate plates at 30 C for 4 6 days for the phenotype to appear; yeast strains grow slower on SD selection medium than on YPD. c. Compare your results with those shown in Table IV. Proceed only if the strain has the expected phenotype. 4. Use colonies from the verified working stock plate to inoculate liquid cultures for preparing competent cells (Section VI.B). 5. Seal the verified working stock plate with Parafilm and store at 4 C. TABLE IV. PHENOTYPE TESTING OF THE YEAST HOST STRAINS Medium Strain SD/ Trp SD/ Leu SD/ His SD/ Ura YPD EGY48 + EGY48[p8op-lacZ] a + + YM a Strain EGY48 transformed with the reporter plasmid p8op-lacz, which carries a wild-type URA3. TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

18 II. Product Information continued Note on auxotrophic phenotypes: EGY48 and YM42712 are deficient for HIS, LEU, TRP and URA (i.e., they are His, Leu, Trp, Ura ) and cannot grow on minimal medium lacking one of those nutrients unless the corresponding functional genes are introduced by transformation or mating. Note on mating types: EGY48 (MATα) can mate with YM4271 (MATa). C. Premade MATCHMAKER LexA Library Information MATCHMAKER LexA cdna libraries are prepared using a modified Gubler & Hoffman procedure (1983). Unless stated otherwise on the PAC, the following information applies to the premade library you have purchased from CLONTECH. Directional cloning cdna libraries are directionally cloned. First-strand cdna synthesis is primed with Xho I-oligo(dT) 18 primers. After second-strand synthesis, the double-stranded (ds) cdna is blunt-ended by sequential treatment with Klenow fragment DNA polymerase I, Mung Bean (or S1) exonuclease, and again Klenow. EcoR I adaptors are ligated to both ends of the blunt-ended ds cdna. The adaptors contain a pre-existing EcoR I sticky end and a phosphorylated blunt end for efficient ligation to the blunt-ended cdna (see the PAC for the adaptor sequence used). The adaptor-ligated ds cdna is digested with Xho I, which leaves each cdna molecule with one EcoR I overhang and one Xho I overhang. (Methylated dctp is included in the firststrand cdna synthesis to protect the cdna from internal Xho I digestion.) Size fractionation The adaptor-ligated ds cdna is size-fractionated to remove unincorporated primers, unligated adaptors, and adaptor dimers; this process also removes low-molecular weight (i.e., <400 bp) incomplete cdnas.the sizefractionated cdna is ligated to EcoR I/Xho I-digested plasmid. Compared to our 5'-STRETCH PLUS TM libraries, all of our MATCHMAKER Libraries have smaller average insert sizes, which may be an advantage in a twohybrid library screening. For example, truncated proteins or peptide fragments may be less likely to have problems localizing to the nucleus, or to localize to other organelles (Fritz & Green, 1992; Fields & Sternglanz, 1994). Library amplification Unless otherwise stated on the PAC, all libraries are amplified once in their E. coli host. Amplified libraries are faithful copies of the unamplified libraries. If the library was not constructed at CLONTECH, or if it was constructed using a rare poly A + RNA source, the library may be reamplified before the titer drops below a stable level. Reamplified libraries undergo the same rigorous quality control as once-amplified libraries. page Protocol # PT Technical Service TEL: or CLON 18 Version # PR67300 FAX: or

19 II. Product Information continued Important Note: After receipt, you must amplify the MATCHMAKER Library before you use it in a library screening (see Section V.A.I and Appendix C). Library Quality Control Data The following information is provided on the PAC. These data were obtained at the time of library construction. 1. Number of independent clones The number of independent clones is estimated before amplification. Most libraries are guaranteed to have at least 1 x 10 6 independent clones and are representative of the genomic DNA or mrna population complexity. 2. Library titer Library titer is determined after amplification and must be >10 8 cfu/ml. 3. Insert size Insert size distribution is determined by PCR amplification using insert screening primers designed for use with MATCHMAKER LexA Libraries. 4. Sequence representation Sequence representation is evaluated by colony hybridization using a gene-specific probe. Mammalian libraries are screened with a human β-actin probe, which cross-reacts with all mammalian β-actin cdna. All Human MATCHMAKER LexA cdna Libraries must show a minimum β-actin frequency of 0.10%, and all other mammalian MATCHMAKER LexA cdna Libraries must show a minimum β-actin frequency of 0.05%. Nonmammalian libraries are screened with a ubiquitously expressed species-specific probe. Note: The frequency of β-actin positive clones varies among libraries made with RNA from different tissues and species. A frequency of >0.10% in a human cdna library suggests a reasonably high probability of finding a rare transcript (Hagen et al., 1988). For nonhuman mammalian cdna libraries, a frequency of 0.05% suggests a reasonably high probability of finding a rare message in those libraries (CLONTECH observations, unpublished). 5. PCR-based sequence screening a. Human cdna libraries A representative sample of the total plasmid library (containing up to 10 7 cfu) is used as a template in a PCR reaction with human β-actin PCR primers. (These primers amplify a 1.1-kb fragment located at the 5' end of the gene.) A sample of the library may also be used as a template for PCR amplification of G3PDH and transferrin receptor cdna fragments. TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

20 II. Product Information continued b. Other (nonhuman) mammalian cdna libraries A representative sample of the total plasmid library (containing up to 10 7 cfu) is used as a template in a PCR reaction with β-actin PCR primers. Species-specific PCR primers are used for Mouse and Rat MATCHMAKER LexA Libraries; human primers are used for other nonhuman mammalian libraries. Mouse and rat libraries may also be used as templates in PCR reactions using species-specific G3PDH primers. c. Nonmammalian cdna Libraries A representative sample of the total library lysate (containing up to 10 7 cfu) is used as a template in a PCR reaction using the appropriate species-specific primers for a ubiquitously expressed gene. d. Screening for yeast sequences MATCHMAKER LexA cdna Libraries are not prepared using yeast trna; therefore, they are not expected to contain any yeast sequences (unless they are a yeast library). Nevertheless, all MATCHMAKER LexA cdna Libraries are screened with PCR primers specific for the yeast 5S rrna gene to ensure that they are negative for this yeast-specific sequence. page Protocol # PT Technical Service TEL: or CLON 20 Version # PR67300 FAX: or

21 III. Proper Use of Controls and Selection Media CLONTECH Laboratories, Inc. To familiarize yourself with the procedures and expected results of a two-hybrid assay, perform all of the control transformations shown in Table V using the small-scale yeast transformation protocol (Section VI.B) and select for transformants as described in Section C below. Assay the transformants for β-galactosidase activity using the in vivo whole-plate assay or the colony-lift filter assay (YPH, Chapter VI). These controls will also verify the transformation markers of the single plasmids and confirm that the two-hybrid assay is working properly. When you test your DNA-BD/bait construct for activation activity, perform twohybrid experiments or library screening, or perform transformations to eliminate false positives, you need only perform a subset of the controls, as indicated in the footnotes to Table V and in the relevant sections. At a minimum, you should always include a positive and negative control for the β-galactosidase assay (Line 1 and Line 4 or 6) and a positive control for a two-hybrid interaction (Line 9). These provide a standard of comparison for the test transformants. A. Control Plasmids provided with the MATCHMAKER LexA Two-Hybrid System (see Table III for plasmid descriptions) Note: If you have purchased a MATCHMAKER LexA Library (and not the LexA System), we recommend that you use your own equivalent control plasmids. 1. plexa-pos encodes a fusion of the DNA-BD (i.e., LexA) with the GAL4 AD, and provides a positive control for the β-galactosidase assay. This plasmid activates transcription of a lacz reporter gene, such as that in EGY48[p8op-lacZ], under control of LexA operators. 2. plexa-53 and pb42ad-t are DNA-BD and AD fusion plasmids, respectively, that provide a positive control for interacting proteins (murine p53 and SV40 large T-antigen; Li & Fields, 1993; Iwabuchi et al, 1993). 3. plexa-lam encodes a fusion of the DNA-BD with human lamin C and provides a control for a fortuitous interaction between an unrelated protein (i.e., lamin C) and either the AD/T-antigen control or your AD/ library plasmid. Lamin C has been reported not to form complexes nor to interact with most other proteins (Bartel et al., 1993b; S. Fields, pers. comm.; Ye & Worman, 1993). B. Save selected transformants for use as reference strains Pick a representative colony from each of the control transformations shown on lines 2, 3, 9, and 11 of Table V and streak each onto the appropriate SD medium (not induction medium; see Section C below). After colonies have grown, seal plates with Parafilm and store at 4 C. Restreak fresh plates at 3 4-week intervals. These transformants are useful as reference strains when you wish to check a new batch of SD selection medium, or when you perform colony-lift or liquid β-galactosidase assays.le VI. CONTROL TRANSFORMATIONS FOR A TWO-HYBRID ASSAY TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

22 III. Proper Use of Controls and Selection Media continued TABLE V. CONTROL TRANSFORMATIONS FOR LexA TWO-HYBRID ASSAYS Expected Expt. # Plasmid 1 Plasmid 2 SD Selection LacZ Pheno. (DNA-BD) (AD) Medium a (colony color) 1 b,c plexa-pos His/ Ura blue d 2 plexa His/ Ura white 3 pb42ad Trp/ Ura white 4 b plexa pb42ad His/ Trp/ Ura white 5 plexa-53 His/ Ura white 6 b plexa-53 pb42ad His/ Trp/ Ura white 7 pb42ad-t Trp/ Ura white 8 b plexa pb42ad-t His/ Trp/ Ura white 9 b,c plexa-53 pb42ad-t His/ Trp/ Ura blue d 10 plexa-lam His/ Ura white 11 b plexa-lam pb42ad-t His/ Trp/ Ura white a Containing galactose and raffinose as the carbon source. b Important controls to include when testing for interaction between two known proteins and when performing transformations to eliminate false positives. c Recommended controls when performing an AD library transformation. d Blue colonies are also expected to grow on SD medium lacking Leu due to activation of the LEU2 reporter. C. Selection media for the control transformations Each plasmid used in the LexA system carries a nutritional marker for selection of yeast transformants plated on SD minimal medium lacking that specific nutrient (Tables III & V).The DNA-BD and AD cloning plasmids and the reporter plasmid all have different nutritional markers, so they can be independently selected. The selection medium you choose for the control transformations depends on: which plasmids you are using; whether you are selecting for one, two, or three plasmids; whether you are selecting for colonies in which two hybrid proteins are interacting; and whether you want the AD/fusion protein to be expressed or not. See Appendix D of this User Manual for a summary of the types of SD selection media that may be required when working with the LexA system. For detailed information on preparing the media, see Appendix D of the Yeast Protocols Handbook. Alternatively, yeast media can be purchased from CLONTECH (see Section X). For comparison, plate the control transformation mixtures (Table V) on three types of SD media: 1) His (for selection of the DNA-BD plasmid); 2) Trp (for selection of the AD plasmid); and 3) His/ Trp (for selection of page Protocol # PT Technical Service TEL: or CLON 22 Version # PR67300 FAX: or

23 III. Proper Use of Controls and Selection Media continued both plasmids). Additionally, in the LexA System, if plasmids are to be tested for their ability to activate the lacz reporter, the transformants must be grown on SD lacking Ura to keep selective pressure on the extrachromosomal reporter plasmid (p8op-lacz). Because AD/fusion protein expression is under the control of the intact GAL1 promoter in pb42ad, transformants must be grown on SD medium containing galactose when you wish to test for reporter gene activation resulting from a possible two-hybrid interaction. Furthermore, the GAL1 promoter of pb42ad is very sensitive to repression by glucose, so the galactose used in the induction medium must be highly purified and contain <0.01% glucose. (Raffinose is included in SD/Gal/Raf medium as an aid to growth.) Colonies growing on the indicated selection medium may be lifted onto filters and assayed for β-galactosidase using the colony-lift assay (see the YPH, Chapter VI.C, for the procedure and this UM, Section IV.D.4, for system-specific notes). Alternatively, X-gal can be added directly to the medium if you wish to perform the in vivo, whole-plate assay (see the YPH, Chapter VI.B, for the procedure and this UM, Section IV.D.1 3, for systemspecific notes). The use of SD induction medium lacking Leu to select for growth of colonies harboring interacting hybrid proteins is discussed further in the protocol overviews (Sections IV.D and V.D). TEL: or CLON Technical Service Protocol # PT page FAX: or Version # PR

24 IV. Overview: Testing for a Protein-Protein Interaction The following is an overview of using the LexA Two-Hybrid System to test for an Interaction between two previously cloned proteins (see Figures 2 and 4). Where needed, reference is made to specific subprotocols in this User Manual (UM) or in the Yeast Protocols Handbook (YPH). (See Figures 2 and 4.) Be sure to read Section II.B (Yeast Strain Phenotype Verification) and Section III (Proper Use of Controls and Selection Media) before you begin working with yeast. A. Construct two fusion genes using standard techniques. A brief outline of the protocol is given below (for more detailed information, see Sambrook et al., 1989). The gene for one of the test proteins (X) is fused to the DNA-BD in the plexa vector and the gene for the other protein (Y) is fused to the AD in the pb42ad vector (referred to as the DNA-BD/protein X and AD/protein Y constructs, respectively). The orientation and reading frame of each fusion must be maintained so that hybrid proteins will be expressed. A fusion gene can easily be generated if compatible restriction sites are present in the test (or target) gene and the corresponding vector. If not, the gene fragment can be generated by PCR with useful restriction sites incorporated into the primers (Scharf, 1990). Often a restriction site at the end of the gene of interest can be changed into a different site or put into a different reading frame by using a PCR primer which incorporates the desired restriction site at the desired place. For this application, either vector can be used for making the hybrid with either of the known proteins unless one has an activation or DNAbinding activity that would interfere with the proper functioning of the twohybrid system. 1. Purify the gene fragment, whether generated by PCR or cut out of a plasmid, using any standard method. 2. Digest the DNA-BD or AD vector with the appropriate restriction enzyme(s), treat with phosphatase, and purify. 3. Ligate the appropriate vector and insert. Transform ligation mixtures into E. coli. Note: We recommend the Ligation Express TM Kit (#K1049-1) for rapid and efficient ligation of plasmid vectors to inserts. 4. Identify insert-containing plasmids by restriction analysis. 5. Check the orientation and reading frame by sequencing across the junction between the genes encoding the DNA-BD and protein X or between the genes encoding the AD and protein Y. Two sequencing primers are included in the kit for this purpose (See Section II.A and Appendix A). page Protocol # PT Technical Service TEL: or CLON 24 Version # PR67300 FAX: or