Direct genotyping of C3435T single nucleotide polymorphism in unamplified human MDR1 gene using a surface plasmon resonance imaging DNA sensor

Transcription

1 Analytical and Bioanalytical Chemistry Electronic Supplementary Material Direct genotyping of C3435T single nucleotide polymorphism in unamplified human MDR1 gene using a surface plasmon resonance imaging DNA sensor Stefano Mariani, Simona Scarano, Maura Carrai, Roberto Barale, Maria Minunni 1

2 Table S1 Synthetic probes and synthetic target analytes sequences; Tm melting temperature at 250 nm concentration obtained by OligoCalc with Thermodynamic Calculations (Kibbe WA (2007) Nucleic Acids Res 35:W43 W46). BIO in 3 of SnpProbe is biotinfunctionalization Probe name Sequence T m C HProbe (Hybridizing Probe) 5' HS-(CH 2 ) 6 -GTCACTGCCTAATGTAAGTCTC 3' 67.1 NProbe (Negative control Probe) 5' HS-(CH 2 ) 6 -GAGGGCGATGCCACCTAC 3' 68.9 HTarget (Hybridizing Target) 5' GAGACTTACATTAGGCAGTGAC SnpProbeC 5 TCACAGGAAGAGATC-BIO SnpProbeT 5 TCACAGGAAGAGATT-BIO SnpProbeA 5 TCACAGGAAGAGATA-BIO

3 Fig. S1 DNA sequencing interferograms of Homozygote CC, TT and Eterozygote CT samples in polymorphic site rs , corresponding to the complementary alleles GG, AA and GA analyzed by DNA sensor. The sequencing was performed before the analysis with DNA sensor for the assay check (control) 3

4 Experimental details Genomic DNA solutions (100 µl) were injected under a RS flow of 6.0 ml/min and, once reached the measuring cell, the flow was lowered to 6.0 µl/min to last the affinity interaction for 30 minutes. SPR signals were sampled and processed after the end of the injection and the subsequent washing with PBS. 100 mm HCl (24 µl/min flow rate for 30 s) was used as regeneration solution (i.e. dsdna hybrids dissociation) after each measurement cycle. Experiments were performed at room controlled temperature (20 C). SPR signals (Reflectivity Variation %, %RV) here reported derived from six independents replicates of the same tested sample. The SPR signal of each replicate is the averaged signal inferred from nine (3x3) circular Regions of Interests (ROIs, 1.8 mm diameter) inscribed in each spot (10 mm diameter) where probes were immobilized (Fig. A2 below). %RVs recorded from the HProbe and NProbe spots were subtracted of the %RVs recorded on blank spots (bare gold, named as B spots in the differential images) during the injections. 4

5 Fig. S2 Signal sampling: A is the entire spot in which the HProbe and NProbe were immobilized while B is one of the nine (3x3) ROIs (Region of interests) from which analytical signals were extracted during interaction between DNA probes and DNA analytes 5

6 Fig. S3 Mark-dose response with synthetic targets HTarget. a) Scheme of hybridization, b) Calibration curve c) Linear range of calibration curve, d) Differential image of hybridizations obtained on specific spots HProbe (H), on NProbe (N) and Blank spots (B), where enlightened spots indicate successful specific hybridization to the 250 nm of HTarget. To estimate the binding efficiency and homogeneity of the immobilized probe (HProbe), standard solutions of the corresponding synthetic target (HTarget) were serially tested within the nm range of concentration (b). The averaged %RSD (%Relative Standard Deviation) sampled from the nine (3x3) ROIs (Regions of interests) of each spot for each signal recorded was 4.9%, meaning that a high homogeneity of the SAM (Selfobtained within each spot. Assembled Monolayer) formed by the probe immobilization was Moreover a good linear dependence up to 50 nm HTarget (Hybridizing Target) (R 2 = 0.994) 6

7 and an experimental detection limit (DL) of 1.0 nm (0.016 ± %RV Reflectivity Variation, (%RV)) were recorded. The %RSD (6 replicates), averaged on all calibration points, resulted 11.5%, confirming the good repeatability of the measurements among concentrations 7

8 Fig. S4 a) Biosensor calibration with unamplified human genomic DNA (GG allele). a) Calibration curve on HProbe and NProbe control spots; b) Linear range of calibration on HProbe (zoomed from a); c) Differential image of hybridizations obtained on specific spots HProbe (H), on NProbe (N) and Blank spots (B), where enlightened spots indicated hybridization to the 2.8 fm unamplified human genomic DNA; d) Evaluation of the unspecific contribution via secondary hybridization with SnpProbeC (grey bar) 8

9 Fig. S5 Illustrative sensorgrams in SNPs discrimination experiments. The fragmented (by ultrasounds) and denatured (by thermal treatment) genomic DNA was injected into the system (2.8 fm). The HProbes (red in figure) first hybridized the fragment (blue) in the region containing the SNP (yellow cross); this event led to a significant recordable analytical signal. After washing with buffer to remove the excess of unbound genomic DNA, SnpProbes (carrying respectively C, T or A in 15 th base) were consequently injected (250nM) to detect the SNPs by evidencing the relative probe whichh binds the hybrid on the surface from the one that did not. Vertical yellow bars defines the time at which signals were sampled. 9

10 In particular in the upper part (a) of the figure was reported the SnpProbeC full match binding to the region containing the SNPs (GG). This resulted in a detectable signal after the washing of the surface with buffer. Differently, in the sensorgrams displayed in the lower part (b), no positive signal from the interaction with the SnpProbeA was recorded since this latter was washed off by the buffer in the case of mismatching sequences. The yellow bars in the sensorgrams show the time at which the signal has been sampled. By analyzing different biosensor responses with the relative DProbes (C, T and A) the specific SNPs could be identified for the three genotyped samples (GG, GA and AA) 10

11 Table S2 Reflectivity Variation % (%RV) recorded during hybridization/no hybridization of SnpProbes with the different genotyped samples Samples SnpProbes SnpProbeC (%RV) SnpProbeT (%RV) SnpProbeA (%RV) SNP Homozygote GG ± ± ± Differentiated Heterozygote GA ± ± ± Differentiated Homozygote AA ± ± ± Differentiated Fig. S6 Averaged sensorgram (n=6) of HTarget hybridization with HProbe at the first measuring cycle (red line) and after 40 analyses of SNPs (blue line). Sensorgrams are reported with the specific error bars (±SD) displaying the overlapping profile along the whole time window of the analysis 11

12 Fig. S7 SNP discrimination of blind samples (2.8 fm DNA concentration): SPR signals of hybridization of SnpProbes (C, T, A) with homozygote GG and heterozygote GA 12

13 Fig. S8 DNA sequencing interferograms of Homozygote CC and Eterozygote CT of blind samples in polymorphic site C3435T, corresponding to the complementary alleles GG and GA analyzed by DNA sensor. The sequencing was performed after the analysis with DNA sensor to verify the reliability of the response analysis 13

14 Fig. S9 Comparison between allele discrimination obtained on genotyped and blind samples for homozygote GG, and heterozygote GA with the relative full matching SnpProbes (C, T) displaying the overlapping of results. By statistical analysis of dataa (Student's t-tests, 6 repetitions for each averaged signal, significance level p = 5%) we can infer that the two corresponding series of data (genotyped samples and blind samples, carrying the same SNP) were not significantly different, showing the reproducibility of the assay in the analysis of samples from different blood lymphocytes samples 14