CODIS. Sir Alec Jeffreys. minisatellites

Size: px

Start display at page:

Download "CODIS. Sir Alec Jeffreys. minisatellites"

Erica Sims
6 years ago
Views:

1 CODIS Sir Alec Jeffreys minisatellites

2 CODIS - Repetitive DNA Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member genes (e.g. hemoglobin, immunoglobulin)

3 CODIS - Repetitive DNA Satellite DNA Unit - Repeat - Location - Examples bp depending on species times. Generally heterochromatic. Centromeric DNA, telomeric DNA. There are at least 10 distinct human types of satellite DNA. A single type may be more than 1% of the genome (equivalent to 3 entire E. coli genomes).

4 CODIS - Repetitive DNA Human satellite DNA is prone to be multimeric or hierarchical in structure. Human α satellite DNA (centromeric) is typically 171 bp long present as dimers (342 bp) or up to 16 mers (2736 bp) as the repeating units. Generally less length variation than minisatellites or microsatellites.

5 CODIS - Repetitive DNA Human β satellite DNA is present as 30,000-60,000 copies of a 68 bp monomer (2,040,000-4,080,000 bp) on the metacentric chromosome 9 and the acrocentric chromosomes 13, 14, 15, 21, and 22. It is a pericentromeric repeat in humans.

6 CODIS - Repetitive DNA Examples of Satellites from Drosophila virilus. Satellite Primary Copies per Percent of Sequence genome genome I ACAAACT % II ATAAACT % III ACAAATT % 41%

7 CODIS - Repetitive DNA Minisatellite DNA Unit bp (average about 20). Repeat - Location - Examples - Generally times ( bp long). Generally euchromatic. DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG

8 CODIS - Repetitive DNA Microsatellite DNA Unit bp (most 2). Repeat - on the order of times. Location - Generally euchromatic. Examples - Most useful marker for population level studies. This example is from a water snake......tccagacaaggtggtgtgtgtgtgtgtgtg TGTGTGTGTGTGTTTCTCCAGTGAGATTTA...

9 CODIS - Repetitive DNA Other repetitive elements include Transposable elements - Sequences that have the ability to move around within and between genomes. Most eukaryotes have them while prokaryotes have a different class of mobile elements. LINES, SINES and other retrosequences - Mobile sequences that copy themselves within genomes via an RNA intermediate. High copy number genes - Examples include ribosomal genes and histone genes. Multifamily member genes - Examples include hemoglobin and immunoglobulin genes.

10 CODIS - the database In 1990 the FBI established a pilot project. In 1994 CODIS (Combined DNA Index System) was established. In 1998 it was fully operational. In 2007 it contained more than records. Records contain specimen numbers and DNA profiles but nothing else.

11 CODIS - the markers From wikipedia (28/11/08).

12 DNA databases go too far

13 CODIS and probabilities Juries get confused by numbers.

14 CODIS and LCN In the U.S., to my knowledge, LCN is used only for intelligence and not for evidence.

15 what are your relatives up to? CSI hasn t picked up on this theme yet.

16 AFIS and CODIS are Biometrics Both AFIS and CODIS are examples of biometrics. In today s environment, such methods are becoming increasingly used. Other biometric methods include, Ear shape-structure Facial recognition Hand thermograms Digital voice signatures Gait Hand geometry Iris scans Retinal scans

17 NCBI Science is based on the production and the exchange of knowledge

18 NCBI Science is based on the production and the exchange of knowledge Strong need for places were data could be freely available to verify results to facilitate the progress of research

19 NCBI Science is based on the production and the exchange of knowledge Strong need for places were data could be freely available to verify results to facilitate the progress of research Submission to databases is mandatory prior to article publication sequences (GenBank, EMBL, DDBJ, SWISSPROT) gene expression (Gene Expression Omnibus, Array Express)

20 NCBI Welcome-Trust Sanger Institute The Institute of Genome Research (TIGR) Celera The Craig Venter Institute Genome sequencing center of Washington University at Saint Louis The Broad Institute in Cambridge Mass. Riken Institute in Japan

3I03 - Eukaryotic Genetics Repetitive DNA

3I03 - Eukaryotic Genetics Repetitive DNA Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member