Pyrosequencing. Alix Groom

Transcription

1 Pyrosequencing Alix Groom

2 Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites bases sequenced per assay 2ug DNA analyse 3 assays/regions of interest 24 or 96 samples/assays run at a time

3 Workflow DNA extraction Bisulphite modification PCR Single strand template generation Pyrosequencing

4 Bisulphite modification GGTCAGTGAC/ m CG C m C Bisulphite conversion U m C GGTUAGTGAU/ m CG U m C PCR amplification T C GGTTAGTGAT/CG Pyrosequencing analysis C m C l l l l l l l l l l l l l G T C T A G T G A T C A G

5 Polymerase chain reaction Target sequence F I I I I I I primer annealing I I I I I I R I I I I I I extension I I I I I I copies of target sequence

6 Single strand generation Capture PCR product with streptavidin beads Biotin labelled PCR product Release single stranded DNA Denature PCR product Anneal sequencing primer

7 Pyrosequencing chemistry 3 Polymerase T A G T A G G 5 DNA polymerase ATP sulfurylase Luciferase Apyrase DNA (n) + dntp Polymerase DNA (n+1) + PPi 5 A T C A T 3 APS Luciferin Light Luciferase Sulfurylase ATP Light Time APS + PPi ATP Nucleotide sequence - G T A G G dntp Apyrase dndp + dnmp + phosphate ATP Apyrase ADP + AMP + phosphate G T G A Nucleotide added G

8 Pyrosequencing timeline Bisulphite modification PCR Single strand template generation Pyrosequencing Day 1 Day 2 Day 3 Day 3 sample preparation 15min-1hr PCR set up 30min-1hr sample prep 30min-1hr Pyrosequencing run 10min-1.5hr DNA-reagent incubation 3hrs PCR cycles 1.5hr Day 2 column purification 30min-1hr agarose gel 1hr

9 Pyrosequencing applications Gene specific methylation analysis identified target loci through gene expression studies literature search methylation arrays etc Global methylation analysis methylation of repetitive elements LUMA

10 Case study Illumina 27K/450K top hit verify Pyrosequencing VeraCode Sequenom Check no SNPs in probe which DNA strand CpG site is measured

11 Case study identify within/

12 Case study genomatix Gene2Promoter software identify within/

13 Case study genomatix Gene2Promoter software identify within/

14 Case study genomatix Gene2Promoter software identify within/

15 Case study genomatix Gene2Promoter software identify within/

16 Case study CpG Island UCSC Genome Bioinformatics CpG Island explorer identify within/

17 Case study CpG Island UCSC Genome Bioinformatics identify within/

18 Case study CpG Island UCSC Genome Bioinformatics identify within/

19 Case study CpG Island UCSC Genome Bioinformatics identify within/

20 Case study CpG Island UCSC Genome Bioinformatics identify within/

21 Case study sequence capture UCSC Genome Bioinformatics identify within/ Chr10: bp downstream bp upstream

22 Case study sequence capture UCSC Genome Bioinformatics Chr10: identify within/

23 Case study sequence capture UCSC Genome Bioinformatics identify within/

24 Case study sequence capture UCSC Genome Bioinformatics identify within/

25 Case study sequence capture UCSC Genome Bioinformatics identify within/

26 Case study sequence capture UCSC Genome Bioinformatics identify within/ CpG Shelf CpG Shore CpG Island

27 Case study transcription factor binding module TFBM defined 2+ TFBS in defined order and orientation identify within/ HNF1 GATA HNF1 GATA TTGTACTAACGATATGCCATGCTA TTGTACTAACGATATGCCATGCTA UCSC TFBS single binding factor information JASPAR TRANSFAC TRANSCompel Genomatix ModelInspector

28 Case study transcription factor binding module Genomatix identify within/

29 Case study transcription factor binding module Genomatix identify within/

30 Case study transcription factor binding module Genomatix identify within/

31 Case study transcription factor binding module Genomatix identify within/

32 Case study transcription factor binding module identify within/

33 Case study If analysing specific CpG can capture adjacent CpGs identify within/ Do you want to analyse CpG Shore CpG Shelf CpG Open Sea

34 Case study PSQ design software Paste in bisulphite modified sequence of interest flanked by ~300bp Select target CpG Maximum amplicon length ~600bp

35 Case study PSQ design software Ensure primers do not cover SNPs or CpGs forward primer sequencing primer reverse primer

36 Case study PyroMark CpG assays 84, 000+ predesigned assays 30,000+ human assays 30,000+ mouse assays 24,000+ rat assays

37 Pyrosequencing checks Level of methylation, accuracy within ~ 5% exclude assays with <5% or >95% methylation No preferential amplification of unmethylated or methylated DNA White HE, Clinical Chemistry 52: , 2006 Bisulphite conversion is completed

38 Pyrosequencing run Run time dependent on sequence length, 10min-1.5hr

39 Pyrosequencing analysis

40 Pyrosequencing analysis Samples run in duplicate are within 5% 0% and 100% controls are comparable between plates inter/intraplate replicates are comparable negative DNA control no signal

41 Pyrosequencing summary high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites genotyping

42 References Helen E. White, Clinical Chemistry 52: (2006) Quantitative Analysis of SRNPN Gene Methylation by Pyrosequencing as a Diagnostic Test for Prader Willi Syndrome and Angelman Syndrome UCSC Genome Bioinformatics Genomatix

43 Pyrosequencing Alix Groom