Whole Genome Sequencing for sourcing Bovine Tuberculosis herd breakdowns in New Zealand

Transcription

1 Whole Genome Sequencing for sourcing Bovine Tuberculosis herd breakdowns in New Zealand Marian Price-Carter Geoffrey de Lisle and Desmond Collins Rollerston Range Possum 011 Rollerston Range Cow 011 Rollerston Range Cow Strain # Source Year Host REA # and Type VNTR type Rollerston R. 011 possum 19 A1 A4/0 A (15)5(10) 8 Rollerston R. 011 cow 19 A1 A4/0 A (15)5(10) 1 Rollerston R. 011 pig 19 A1 A4/0 A (15)5(10) 19 Whataroa 1985 possum 19 A1 A4/0 A (15)5(10) 11 Mackenzie C deer 19 A1 A4/0 A (15)5(10) 1 Taramakau 010 cow 99 A17 A4/0 A (15)5(10) 5 Whataroa 004 cow 19 A1 A4/0 A (15)5(10) 3 Otaki 007 pig 19 A1 A4/0 A (15)5 6 Whataroa possum 1985 North Island pig 007 same REA different VNTR Mackenzie country deer 1988 Taramakau cow 010 same VNTR different REA Whataroa cow

2 Whole Genome Sequencing for sourcing Bovine Tuberculosis herd breakdowns in New Zealand Marian Price-Carter Geoffrey de Lisle and Desmond Collins Introduction Current typing system Results of pilot WGS study Whataroa possum 1985 Rollerston Range Possum 011 Rollerston Range Cow 011 Rollerston Range Cow Mackenzie country deer Next steps Taramakau cow 010 same VNTR different REA 1 Whataroa cow North Island pig 007 same REA different VNTR 3

3 Acknowledgement AgResearch Isolate Culture Gary Yates Maree Joyce Bioinformatics Rudiger Brauning IT Kisan Kisan Dave Scammel M bovis Conference VI organisers TB Free NZ (formerly the AHB) Funding Advice on Isolate Selection Paul Livingstone Jane Sinclair (ADM) Mark Neil (ADM) New Zealand Genomics Ltd. Genome Sequencing Jenny Schackelford Patrick Biggs Lorraine Berry University of Glasgow Data filtering and Phylogeny Rowland Kao Roman Biek Hannah Trewby

4 Herd Testing (Bovigam ELISA) M. bovis culture Geoff de Lisle Strain typing method development Paul Livingstone Des Collins Vaccine development Bryce Buddle

5 Controlling bovine TB is vital to maintaining the production and reputation of dairy, beef and deer exports, worth around $14 billion a year to NZ Control efforts are hampered by wildlife reservoirs mainly the Australian brush tail possum There are six regions in NZ where wildlife carry bovine TB

6

7

8 Veterinary Microbiology 150(011) VNTR region DR region (exploited in spoligotyping) TCGGCTAGCCGAGCAGGGCGTCGACGAATGCGGCGGGTTCGAAAGGCGCCAGGTCATCGGGGCCT TCACCAAGCCCGACCAGCTTCACCGGCACCCCAAGTTCCTGTTGAACGCGGAACACAATGCCGCC CTTGGCCGTTCCGTCCAGTTTGGTGAGCACCGCGCCGCTGATGTCGACGACCTCGGCGAACACTC TGGCCTGCGCCAACCCGTTCTGTCCGATCGTGGCATCGAGCACCAGCAACACCTCGTCAACGGAC GCTCGCCGAGTCACCACGCGCTTGACCTTGTCCAGCTCGTCCATCAGGCCAACCTTGGTGTGCAG CCGCCCGGCTGTATCGATGAGCACGACGTCTGCGCCGGCGGCGATGCCCTTGTCGACGGCGTCGA ACGCCACCGATGCCGGGTCGGCGCCTTCGGGCCCGCGAACCACCGCTGCGCCAACCCGCGCCGCC CAGGTCTGTAGCTGATCGGCGGCGGCCGCACGGAAGGTGTCAGC CCGTGGCGATCGCAAGCGCGGCGCAGCCGCGCGCAGCGGGTCGCCACCATCAGACC CCGTGGCGATCGCAAGCGCGGCGCAGCCGCGCGCAGCGGGTCGCCACCATCAGACC CCGTGGCGATCGCAAGCGCGGCGCAGCCGCGCGCAGCGGGTCGCCACCATCAAACC CCGTGGCGATCGCAAGCGCGGCGCAGCCGCGCGCAGCGGGTCGCCACCATCAAACC CCGTGGCGATCGCAAGCGCGGCGCAGCCGCGCGCAGCGGGTCGCCACCATCAAACC CCGTGGCGATCGCAAGCGCGGCGCAGCCGCGCGCAGCGGGTCGCCACC TCGGCTAGCCGAGCAGGGCGTCGACGAATGCGGCGGGTTCGAAAGGCGCCAGGTCATCGGGGCCT TCACCAAGCCCGACCAGCTTCACCGGCACCCCAAGTTCCTGTTGAACGCGGAACACAATGCGCCC TTGGGAGCTTCACCGGCACCCCAAGTTCCTGTTGAACGCGGAACACAATGCCGCCCTTGGAGGCT TGACAGCTAGTCGAACTTCTCCTTGTCATGGGAACTCGAGGGCGGTGCCTACAGCGGAAGGATGC TGGTGAGTTCAGCGCTCCTGCTGTTGATGACGGCGGGTCTAGTTCA

9 This VNTR/DR method is now accredited and is currently used routinely for distinguishing NZ isolates of M. bovis Isolate type information is stored in a NZ M. bovis VNTR database (>750 entries) and compared to information in the NZ M. bovis REA database (>3,800 entries)

10

11 Mycobacterial relationships are well suited for analysis by WGS

12 Other WGS studies presented at M. bovis Conference VI Routine whole genome sequencing of bovine tuberculosis; what WGS of btb can do for you Noel Smith, AHVLA, UK Wildlife/cattle interface using WGS Rowland Kao, University of Glasgow, UK Phylogenetic Understanding of the Relationship between M bovis genotypes in Great Britain Using WGS Stefan Berg, Nunez-Garcia, J., Dale, J., Ellis, R., Smith, N. AHVLA, UK Using WGS genotyping to inform bovine TB investigations S. Robbe-Austerman, T. Stuber, P. Camp, J., Ellis, R., Smith, N. NVSL USDA

13 Single Nucleotide Polymorphism (SNP) UK 1997 cattle Reference genome A 011 possum Rollerston Range A8 011 cattle Rollerston Range A5 004 cattle Whataroa A deer Mackenzie country ATGTTGCCAGAGCAGGA ATGGTGCCAGAGCAGGA ATGGTGCCAGAGCAGGA ATGTTGCCAGAGCACGA ATGTTGCCAGAGCACGA

14

15 Local Competitive Rates Lots of advice on experimental design and sample quality Quality checks on samples Quality checks on libraries prepared from samples Quality checks on resulting sequencing data

16 Data processing Python scripts for Data trimming Dynamictrim software Mapping - Burrows Wheeler Aligner (BWA) software aligned to Genebank M. bovis reference AF1/97 Identification of SNPs and other variants- SAM Tools and Variant Call Format software Filtering erroneous data Iterative evaluation of filter parameters Scripts developed by Rudiger Brauning

17 SNP Filtering Each detected SNP must be carefully characterised Erroneous SNPs disregarded Is it in a region where there is good quality data? Do all the reads have the base change? Are there lots of other SNPs nearby?

18

19 Rollerston Range-a new area of wildlife infection Des Collins, Paul Livingstone, Jane Sinclair, Mark Neil

20 Strain # Source Year Host REA # and Type VNTR type Rollerston R. 011 possum 19 A1 A4/0 A (15)5(10) 8 Rollerston R. 011 cow 19 A1 A4/0 A (15)5(10) 1 Rollerston R. 011 pig 19 A1 A4/0 A (15)5(10) 19 Whataroa 1985 possum 19 A1 A4/0 A (15)5(10) 11 Mackenzie C deer 19 A1 A4/0 A (15)5(10) 1 Taramakau 010 cow 99 A17 A4/0 A (15)5(10) 5 Whataroa 004 cow 19 A1 A4/0 A (15)5(10) 3 Otaki 007 pig 19 A1 A4/0 A (15)5 6 Selected isolates were very similar when analysed with our current methods

21 Single Nucleotide Polymorphism (SNP) Distance Map 0 Rollerston Rangepossum 011 Rollerston Range cow Rollerston Range pig 011 Whataroa possum Mackenzie country deer North Island pig 007 same REA different VNTR Taramakau cow 010 same VNTR different REA Whataroa cow Key = isolate # = # SNPs

22 Single Nucleotide Polymorphism (SNP) Distance Map 0 Rollerston Rangepossum 011 Rollerston Range cow Rollerston Range Whataroa possum pig Mackenzie country deer North Island pig 007 same REA different VNTR Taramakau cow 010 same VNTR different REA Whataroa cow Key = isolate # = # SNPs = subset checked by Sanger sequencing

23 3 SNP lineages reflect and add resolution to distinctions via REA and VNTR Algidus Rollerston possum Range possum Algidus Rollerstoncow Range011 Mt Rollerston Oakden Range pig Whataroa possum pig cow 011 Mackenzie country deer North Island pig 007 North Island Otaki pig 007 same REA different VNTR Taramakau cow 010 cow 010 same VNTR different REA same VNTR different REA Whataroa cow 004 1Whataroa cow same REA different VNTR North and South Island Isolates are distinguished by numerous SNPs Outbreak isolates are distinguished by only a small number of SNPs Outbreak isolates have accumulated a unique set of SNPs

24 SNP lineages reflect and add resolution to distinctions via REA and VNTR Rollerston Algidus possum Range possum Algidus Rollerston cow Range011 Mt Rollerston Oakden Range pig Whataroa possum pig cow 011 Mackenzie country deer deer Possible explanations: North Island pig 007 North Island Otaki pig 007 same REA different VNTR Taramakau cow 010 cow 010 same VNTR different REA same VNTR different REA Whataroa cow 004 1Whataroa cow same REA different VNTR The West Coast or other source has not yet been sampled The Rollerston Range type has resided undetected in Central The Canterbury Algidus for type a considerable has resided undetected amount of time in Central Canterbury for a considerable amount of time

25 Waikato Outbreak Investigation Very similar VNTR and REA type Strain # Source Year Host REA # and Type VNTR type 1 Patetonga 011 cow 161 B A5/3 C (10)3(1) Patetonga 007 cow 161 B A5/3 C (10)3(1)5 7 0 Patetonga 004 cow 151 B A5 C (10)3(1) Patetonga 1997 ferret 151 B A5 C (10)4(1) Hatepe 011 possum 115 B1 A5 C (10)3(1) Te Aroha 1994 cow 115 B1 A5 C (10)3(1) W13 Hatepe possum 011 (115) 1 W14 Te Aroha cow 1994 (115) 14 7 W1 Patetonga cow 011 (161) 1 3 Patetonga cow 007 (161) 16 W W15 Patetonga ferret 1997 (151) W0 Patetonga cow 004 (151) 0

26 Phylogenetic Relationship of different M. bovis Families by WGS AN5 0 Patetonga cow Patetonga ferret 1997 Waikato Outbreak Investigation 1 Patetonga cow Patetonga cow 007 Rollerston Range possum 011 Rollerston Range Outbreak Investigation 1 Rollerston Range pig Rollerston Range cow SNPs shared by AN5 and Rollerston Range Outbreak isolates

27 In Conclusion WGS data has already added clarity to unresolved situations involving NZ M. bovis infections The more precise sourcing of M. bovis outbreaks will enable more directed and efficient control Much needs to be worked out before it can used as a routine typing method

28 Current Studies: Relatedness of different families of M. bovis Define SNP lineages of important families Determine significance of changes in REA/VNTR Deletions Optimal filtering (60 genomes from recent breakdowns NZGL) Estimation of NZ bovine TB cycle mutation rates of different types in different regions (315 genomes Welcome Trust Sanger and Glasgow)

29 Current Studies: Relatedness of different families of M. bovis Define SNP lineages of important families Determine significance of changes in REA/VNTR Deletions Optimal filtering (60 genomes from recent breakdowns NZGL) Welcome Trust- Sanger- Julian Parkhill and James Wood (18 genomes) Welcome Trust- Glasgow- Rowland Kao Joseph Crisp (95 genomes) Estimation of NZ bovine TB cycle molecular clocks mutation rate of different types mutation rate in different regions (315 genomes Welcome Trust Sanger and Glasgow)

30 Best results with this technique will require effective collaboration between lab scientists and epidemiologists Paul Livingstone and ADMs at TB Free NZ Development of NZ WGS typing system Josephine Bryant, Simon Harris, James Wood and Julian Parkhill Wellcome Trust Sanger Molecular Clock estimates of New Zealand bovine TB cycles Rowland Kao and Joseph Crisp Wellcome Trust Glasgow Molecular Clock estimates of New Zealand bovine TB cycles Dan Thompkins, Bryce Buddle and Nigel French Molecular Clock and Wairarapa genomes -shedders Vs spreaders project Noel Smith Molecular evolution of M. Pinnipedii

31 Acknowledgement AgResearch Isolate Culture Gary Yates Maree Joyce Richard Green Bioinformatics Rudiger Brauning IT Kisan Kisan Dave Scammel M bovis conference VI organisers TB Free NZ (formerly the AHB) Funding Advice on Isolate Selection Paul Livingstone Jane Sinclair (ADM) Mark Neil (ADM) New Zealand Genomics Ltd. Genome Sequencing Jenny Schackelford Patrick Biggs Lorraine Berry You University of Glasgow Data filtering and Phylogeny Rowland Kao Joseph Crisp Roman Biek Hannah Trewby