The Spectrum of Chloroplast DNA Mutation Changes when Cells are Grown in Low Light

Transcription

1 Proceedings of The National Conference On Undergraduate Research (NCUR) 2006 The University of North Carolina at Asheville Asheville, North Carolina April 6-8, 2006 The Spectrum of Chloroplast DNA Mutation Changes when Cells are Grown in Low Light Ngoc Nguyen Department of Plant Biology Michigan State University Ronald E. McNair Post-Baccalaureate Achievement Program Summer Research Opportunity Program 2005 Faculty Advisor: Barbara B. Sears Abstract The current study tested the hypothesis that oxygen radicals produced by photosynthesis contribute significantly to mutations that occur spontaneously in chloroplast DNA. The type and frequency of spectinomycin resistant mutants of Chlamydomonas reinhardtii that arise in a low light regime were compared to previously characterized mutations when cells were grown in constant high light. PCR and DNA sequencing enabled the characterization of mutations that occur in the 16S rrna gene. The overall mutation frequencies are similar under the two growth regimes, although the types of base substitutions may be different. A novel base substitution and a recurring 12-bp deletion were observed. Keywords: Spontaneous mutation, oxidative DNA damage, Chlamydomonas reinhardtii, spectinomycin resistance 1. Introduction Chloroplasts are frequently exposed to reactive oxygen due to the splitting of water from photosystem II during the process of photosynthesis. Reactive oxygen results when the absorbed light energy exceeds the capacity of photosynthetic energy consumption. Reactive oxygen can cause damage to DNA 1. The major type of DNA lesion that is caused is the conversion of guanine to 8-oxoguanine (8-oxoG) 2. 8-oxoG has ambivalent base-pairing properties in which it can pair effectively with both A and C during DNA synthesis. Consequently, base substitution can readily occur. The systems of mutt, mutm, and muty exist in E. coli and in Saccharomyces cerevisiae, which acts as a paradigm for eukaryotes, to protect against 8-oxoG 3. The mutt + gene product hydrolyzes 8-oxodGTP to prevent its use as a substrate by DNA polymerase III 2. The mutt strain lacks an active MutT protein, and therefore is a strong, specific mutator that shows a 10,000-fold enhancement of A/T C/G transversions resulting from misincorporation of 8-oxodGTP opposite template A. When Chlamydomonas reinhardtiii cells were grown in continuous light, a higher frequency of transversion from A C was observed than any other type of base substitution in the chloroplast DNA 4. It was suggested that the functional homolog of the MutT gene product present in the chloroplast may be insufficient to handle oxidative damage that occurs spontaneously from the uninterrupted activity of photosynthesis. The investigation of GuhaMajumdar and Sears (2005) examined mutations occurring at a particular site in the 16S rrna gene, which are known to confer resistance to spectinomycin. Those base substitution mutations also result in the loss of an Aat II cut site at position Previous research led to a hypothesis that less reactive oxygen will be produced under low light intensity, therefore, less DNA damage would be expected. Hence, the frequency and the types of mutations would be different under low and high intensities of light. The purpose of our study is to determine the rate and to characterize the type

2 of spontaneous mutations that are resistant to the antibiotic spectinomycin when cells are grown in low light, and compare those data to previously characterized spectinomycin resistant mutations, which were isolated in high light. 2. Materials and Methods 2.1 strains and media The CC125 strain of Chlamydomonas reinhardtii, which was obtained from the Chlamydomonas Genetics Center at Duke University (Durham, NC, USA), was used for all experiments. Cells are grown in tris-acetate phosphate (TAP) media 5. TAP media can be in liquid or solid form. For isolation of spectinomycin resistant mutants, TAP medium was mixed with 100 ug/ml spectinomycin dihydrochloride (Sigma Chemical Co., MO, USA). 2.2 testing for pre-existing mutation to spectinomycin resistance and isolation of new mutation Cells were grown in low light in test tubes with 5 ml TAP liquid on a rotary shaker at a speed of ~200 rpm. Two 0.5ml aliquots were plated on TAP media with spectinomycin antibiotic to test for pre-existing mutations. The cells were transferred to a larger volume of medium to grow to mid-log phase. 1 ml of cells sample was taking out of the total volume, and using a compound microscope and a hemacytometer to calculate cell densities 6. Some samples of CC125 strain showed clusters of cells, and some mostly were single cells. For the samples with mostly clusters of cells, we counted both cluster of cells and single cells. A ratio of the cluster of cells and single cells were calculated by dividing the single cells to cluster cells, and multiply that ratio to the number of single cells that were observed. The volume of cells was obtained sterilely from measuring with graduated cylinders. Once the total volume was recorded, 100-fold concentration was achieved by centrifugation in a Sorvall centrifuge at 6000xg for 10 minutes. The supernatant was discarded and the pellet was suspended with TAP medium. An aliquot of the cell samples was used for dilution plating to determine cell viability. The remaining volumes of the concentrated CC125 cells were then plated as 0.5 ml aliquots on TAP medium + spectinomycin (100 ug/ml). New mutant which arises on TAP + spectinomycin medium were transferred to fresh TAP + spectinomycin to verify the existence of the mutation. 2.3 DNA extraction The process of extracting DNA was done according to the adopted method 7.The newly isolated mutants were grown in a test tube with 5 ml liquid TAP on a rotary shaker for 1-3 days. 1.5 ml from 5 ml test tube was transferred to a microfuge tube, and centrifuged. The supernatant was discarded, and the pellet was suspended with 0.5 ml 1X TEN buffer (1M Tris, 0.5M EDTA and 5M NaCl) by vortexing. The centrifugation was repeated and the cells was were suspended in 150 µl of sterile water and 300 µl of SDS-EB buffer (10% SDS, 5M NaCl, 0.5M EDTA and 1M Tris- HCl). The cells were with an equal volume of Phenol: chloroform (24:1). The aqueous phase was transferred to a fresh microfuge tube and 300 µl of chloroform was used for a second extraction. The aqueous phase was removed and chilled on ice for 30 min. Two volume of pure ethanol was added and the tubes were centrifuged for 10 min. 70% ethanol was added to the DNA pellet to wash it, followed by centrifugation for another 8 min. The pellet was air-dried, and then dissolved with 40 µl of distilled water. 2.4 PCR amplification The extracted DNA was used for PCR amplification. The 16S F1 (5 - CCGCACAAGCGGTGGATT 3 ) and 16S R2 (5 CCGGAATCGCTAGTAATCGCC 3 ) were the primers used as the forward and reverse primers respectively. 1 µl of the DNA solution was added to 200 µmoles of each deoxynucleotide, 2.5 units of Red Taq polymerase (Sigma Chemical Co., MO, USA), 10 pmoles of each primer and 1 X PCR reaction buffer (Sigma Chemical Co., MO, USA) in a 25ul end volume. The PCR was performed with a thermalcycler (Model PTC-200; MJ Research). Conditions were as follows: initial deturnation at 95 o C for 2 min and 85 o C for 5 min, followed by 30 cycles of denaturation at 94 o C for 40 sec, annealing at 48 o C for 30 sec, and an extension at 72 o C for 30 sec. The final extension was done for 10 min at 72 o C. The PCR process required about 2 hours to go through 30 cycles. PCR products were analyzed on a 1.5% agarose gel. 2229

3 2.5 restriction digestion and gel electrophoresis Samples of PCR products were digested by the addition of 0.5 µl of Aat II enzyme (New England Biolabs, Beverly, MA, USA) with one hour incubation at 37 o C. The digested products were analyzed along side a 123 bp DNA ladder (Invitrogen Life Technologies, USA) by electrophoresis on a 2.0% agarose gel. 2.0 grams of low EEO electrophoresis grade agarose (U.S. Biochemicals, USA) was melted in 100 ml of 1X TBE+ ethidium bromide to use as a gel. The gel was photographed using the Bio-Rad gel documentation system and the image was displayed using the Quantity One software (Bio-Rad, Hercules, CA, USA). 2.6 PCR purification and DNA sequencing The PCR products that have a change in mobility or loss of Aat II cut site were purified for DNA sequence. A subset of PCR products were purified using Qiaquick PCR purification kit and its protocol (Qiagen, CA, USA). The purified PCR products were submitted to the Michigan State University Genomic Technology Support Facility for DNA sequencing using the 16S F3 (5 CGCGAAGAACCTTACCAGGG 3 ). The DNASTAR program (Madison, WI, USA) was used to align and analyze the data. The DNA sequences from spectinomycin resistant mutants were aligned with the wild type sequence to determine the exact base(s) substitution or deletion that had occurred. 2.7 calculation of mutation rate To calculate the rate of spontaneous mutation, base substitution, and 12-base deletion of spectinomycin-resistant mutants, the following formula was used: The number of spectinomycin-resistant mutants (1) Total number of viable cells plated 3. Data Analysis and Results 3.1 frequencies of spectinomycin resistant mutants in the 16S rrna gene Eight billion Chlamydomonas reinhardtii cells were plated on spectinomycin medium from a total of seven experiments to isolate new spectinomycin-resistant mutants under low light growth condition. Only twenty-three colonies of spectinomycin-resistant mutants were obtained. In several cases, the colonies did not appear until 8-12 weeks after plating. An estimation of the rate of 2.85x10-9 for spontaneous mutations occur on the chloroplast 16S rrna gene was obtained by using the mutation rate formula, after adjusting for the fact that the low light growth regime resulted in clusters of cells rather than single cells. The twenty-three spectinomycin-resistant mutants were analyzed by PCR amplification, followed by restriction digestion with the Aat II restriction enzyme. Eight of the twenty three spectinomycin-resistant mutants have lost the Aat II cut site, and one spectinomycin-resistant mutant had a change in mobility of one of the fragments. Hence, loss of the Aat II cut site occurred more frequently together with spectinomycin resistance than did a change in mobility (Table 1). The other fourteen spectinomycin-resistant mutants could have been chloroplast mutations, but were not located in the site of interest to the study. Table 1. frequency of spontaneous mutation in the chloroplast DNA of Chlamydomonas reinhardtii 2230

4 3.2 comparison of the rate at which spectinomycin resistant mutants occur when cells were grown in low and high light Eight spectinomycin-resistant mutants with loss of the Aat II cut site from low light were compared to the sixty-four spectinomycin resistant mutants with loss of the Aat II cut site isolated from cells grown in high light. In the high light regime, a total of eighty-billion cells were plated on spectinomycin medium 4. As shown in Table 2 many more mutants were isolated in high light compared to low light (64 vs. 8), but when expressed as a ratio to the number of viable cells plated, the frequency showed that spontaneous base substitution occurred at a very similar rate of 8-10x10-10 regardless of the light intensities. Table 2. comparison of overall mutation frequency of cells grown in low and high light regimes 3.3 analysis of base substitution at Aat II cut site on the 16S rrna when cells were grown in low light Figure 1. Base substitutions that result in spectinomycin resistant Figure 1. DNA sequence of wild type and low light spectinomycin resistant (llsr) mutants that have altered base composition at the Aat II cut site in the 16S rrna gene. A novel mutation was found in llsr10. DNA sequencing was performed on all eight spectinomycin resistant mutants that have lost the Aat II cut site to determine the exact nature of the changes. Figure 1 shows the sites of mutation that occurred within the Aat II cut site at position on the 16S rrna when cells were grown in low light. Even though Figure 1 shows an alignment of the wild type with six base substitution mutations, we actually isolated eight base substitution mutations. The two mutations, llsr18 and llsr1-6, that were unlisted have similar base changed to llsr21 (C T) and llsr2-1 (A G) respectively. The eight spectinomycin resistant mutants showed a change in three bases of the Aat II 2231

5 cut site at position 1123, 1124, and 1125 (Fig. 1). Among the three different positions observed, base substitutions occurred more frequently at position 1123 than any of the other two positions (Table 3). Seven of the mutations with base changes at the position 1123 to 1125 have been reported previously by others; however, one of the low light spectinomycin resistant mutants (llsr10) is completely novel. At base position 1123 of the 16S rrna, the base substitution mutation was a transversion showing a base alteration of the wild type from A T (Fig. 1). These DNA sequence data combined with the previous data of GuhaMajumdar and Sears (2005) show that spectinomycin resistance can result from any of the three possible base substitutions that can occur at each of the three bases at positions of the 16S rrna. Table 3. the position in the Aat II cut site that have base alteration 3.4 ratio of transversion to transition mutations in low and high light Transversion and transition mutations were observed under both conditions of varying light intensity (Table 4. When cells were grown in high light, 64 spectinomycin resistant mutants have base substitutions at the Aat II cut site. 51 mutants had transversion mutations, whereas only 13 mutants were due to transition mutations 4 (Table 4), showing a 4:1 ratio of transversion to transition. When cells were grown in low light, 8 spectinomycin resistant mutants have base substitutions at the Aat II cut site: 4 mutants contained transversion mutation, and 4 mutants had transition mutations (Table 4). The data show a 1:1 ratio of transversion to transition. This comparison has led us to believe that the rate of transversion mutation is reduced when cells are grown in a low light regime. Table 4. comparison of the different types of base substitution under low and high light conditions

6 3.5 analysis of 12-base deletion Figure 2. DNA sequence aligment of wild-type and two independently isolated spectinomycin resistant mutants Figure 2. DNA sequence alignment of wild type and spectinomycin resistant mutants that each has a deletion of 12 bases at position on the 16S rrna. A deletion mutation of the same twelve bases conferring resistance to spectinomycin at the position on the 16S rrna gene, has been independently isolated twice (Fig. 2). This piece of information is suggesting that either the deletion must be very precise to confer spectinomycin resistance, or particular sequences bordering the deletion make that 12-bp segment extremely prone to deletion. 4. Conclusion The purpose of this study was to determine the rate and characterize the types of spontaneous mutations that result in resistance to spectinomycin on chloroplast 16S rrna gene when cells are grown in low light, and compared to previously identified spectinomycin resistance mutations isolated when cells were grown in high light. It was believed from a previous study in the Sears lab that oxygen radicals resulting from uninterrupted activity of photosynthesis could cause more damage to the DNA than the repair systems could handle 4. Hence, if light intensities are reduced, fewer DNA lesions will occur. We hypothesized that the rate and types of mutations that result in resistance to spectinomycin will be different when cells are grown under low and high light conditions. The observations and data allow suggested several conclusions from the study. The overall rates of spontaneous mutations occurring at an Aat II cut site on the 16S rrna gene of Chlamydomonas reinhardtii are very similar when cells were grown in low and high light conditions. Two types of spontaneous mutations were observed conferring resistance to spectinomycin on the 16S rrna: base substitution and a 12-base deletion. Base substitution occurred at three positions within the Aat II cut site ( ), however, mutations occurred most frequently at position A novel base mutation (llsr10) was found at the position The base substitution showed a transversion mutation changing the base A T. In addition, in the high light condition, transversion occurred more frequently than transition with a ratio of 4:1 4 (Table 4). In low light, however, mutations occurred at 1:1 ratio of transversion to transition (Table 4). This showed that the rate of transversion mutations is reduced in low light conditions, and support the hypothesis that the reactive oxygen by product of photosynthesis is mutagenic when cells are growing rapidly under high light. 5. Reference 1. Nield Jon, Redding, Redding Kevin, Hippler Michael (2004) Remodeling of Ligh-Harvesting Protein Complexes in Chlamydomonas in Response to Environmental Changes. Eukaryotic Cell, pp Fowler RG, White SJ, Koyama C, Moore SC, Dunn RL, Schaaper RM (2003) Interactions among the Escherichia coli mutt, mutm, and muty damage prevention pathways. DNA Repair 2: Boiteux S, Gellon L, Guibort N (2002) Repair of 8-oxoguanine in Saccharomyces cerevisiae: interplay of DNA repair and replication mechanisms. Free Radic boil Med 32: GuhaMajumdar M. and Sears B. (2005) Chloroplast DNA base substitutions: an experimental assessment. Mol Gen Genomics 273:

7 5. Harris EH, Burkhart BD, Gillham NW, Boynton JE (1989) Antibiotic resistance mutations in the chloroplast 16S and 23S rrna genes of Chlamydomonas reinhardtii: correlation of genetic and physical maps of the chloroplast genome. Genetics 123: Harris EH (1989) The Chlamydomonas sourcebook. A comprehensive guide to biology and laboratory use. Academic Press, San Diego. 7. Rochaix JD, Mayfield S, Goldschmidt-Clermont M, Erickson J (1988) Molecular biology of Chlamydomonas. In: Shaw CH (ed) Plant molecular biology: a practical approach. IRL Press, Oxford, pp