Traceability of Animals and Products of Animals from stable to table and back
|
|
- Stanley Eaton
- 6 years ago
- Views:
Transcription
1 Overview on food-chain surveillance of Carpathian Euro-region Establishment and introduction of European Food-chain Parliament Hungary, Visegrád, of November 2008 Traceability of Animals and Products of Animals from stable to table and back Prof. Dr.Gottfried Brem Veterinary University Vienna
2 A pressing question: where did my dinner meat come from? =??? The solution: 100% traceable food origins by applying DNA Genotyping Resulting in - substantially reduced health concerns - significantly more reliable product quality 2
3 Applications of DNA Genotyping and analyses Important for Food Security DNA-based identification / traceability (of animals and meat products) DNA analyses of disease resistance / susceptibility genes (Scrapie, BSE) Important for Animal Breeding and Production DNA/RNA/antigene analyses for epidemic eradication (BVDV) DNA analyses of hereditary defects and breeding traits DNA analyses for future phamacogenetic applications 3
4 The first and most important step: Collection of samples for DNA Genotyping Essential Questions: Storage? Can you store your samples at room temperature for years without deterioration? Handling? Is there still the need of a veterinarian? Do you still collect blood samples? Identification of the sample? Is there a manual step necessary? Hand writing always readable? How many mistakes can you accept? Transport and refrigeration? Can you mail your samples without refrigeration? Data transfer? Have you ever had problems or errors (wrong transfer of hand writing)? Cost? Is your sample collection method economical 4 even for large sample volumes?
5 Blood Samples Hair Root Samples Milk Samples Disadvantages of conventional collected samples: - Collection of blood requires a veterinarian - Cooling of samples required (even during transportation) - Additional sticker with number and barcode has to be fixed on the container and the data transferred manually (high risk of sample confusion and errors) - Collection takes some minutes. - Collection is expensive - Conventional sampling results in many mistakes 5
6 Our Vision und Mission: Genotyping of all cattle within the European Community The situation: > 100 million cattle in the EU > 27 countries > 300,000 farms Separate sampling is: - too complicated - too error prone - too time-consuming and inefficient - too expensive The solution: An Innovative Genetic Sample Collection and Conservation System 6
7 Today: Conventional Ear-tagging : visual (and electronic) identification No Sampling Standard ear tag Future: TypiFix -System (TFS ) TFS Ear-tagging: visual (and electronic) identification + Sampling Punchpoint Tissue sample Drying materials 7
8 A modified ear tag - an additional sample container makes the difference Common ear tag New! contains a granulate for preservation Male tag part Female tag part Sample container All parts are laser engraved with identical numbers and barcodes 8
9 TypiFix TM -System sample collection ear tags Standard ear tag -without sampling of tissue TypiFix -System with sampling of tissue conical metal punch cuts ear tissue conical plug predefined breaking point After the sampling process, the plug resides in the sample container and seals it hermetically. 9
10 Perforation process Standard ear tag TypiFix ear tag Spike perforation - torn, inflamed edges with splits TFS clean-cut incision smooth, healed edges 10
11 Typical failure rates (No-tissue sample inside the sample container; untrained operator): < 0.5 % [sheep] < 0.1 % [pigs] < 0.1 % [bovine] 11
12 Secure and efficient storage system Arrival Placing TFS containers in the storage strips Simple archiving - Placement on storage strips without special order - Long-term storage at room temperature Secure sample scanning - Fast - Error-free Fast sample retrieval AGROBIOGEN Sample Administration Scanning the ID-numbers Sample number: TGD Thüringen 182 The selected sample can be identified as follows: Entry of the selected sample Shelf storage at room temperature Rack number of the selected sample Rack Tray Strip Position Tray number of the selected sample Strip number of the selected sample Position of the selected sample on the storage strip 12
13 High Through Put- Extraction of Ear Tissue Samples out of the Sample Containers Capacity: 1 million/year 13
14 Changing meat production and revolutionizing animal IDs: the TypiFix -System Tissue sampling and conservation: - Quick and secure sampling Animal producers can sample without veterinarians (no blood) - Pre-identified sample No confusion possible All parts are pre labeled with the same number and barcode No errors or test failures during the analysis or genotyping process Data Transfer by scanners - Sealed and preserved sample No deterioration of or loss of samples during transportation Storage at room temperature for years Easy to transport (no cooling necessary) - Very economical (no additional work) 14
15 TypiFix - the link between animal and lab Typifix TM -System Cattle Global meat supply chain 15
16 Absolute confidence Consumer protection and information throughout the food chain: Complete traceability of meat products. The System enables 100% verifiable control of animal and meat origin during every stage or process in the production or consumption (e.g. farms, breeding centers, stockyards, feedlots, processing plants, butcher shops, restaurants, dinner tables). Advantages for Breeding Societies: optimization of breeding programs, screening for hereditary defects, genetic merit evaluation, parentage and/or lineage control. Advantages for public authorities: traceability of livestock and meat products (including 100% verifiable border control) - a powerful instrument for prevention of and detection of subsidy fraud. 16
17 DNA Isolation Nexttec Advantages Conventional Preparation steps technology Nexttec 1 Prepare samples 5 min. 5 min. 2 Add lysis buffers 1 min. 1 min. 3 Incubate to lyse several hours till overnight Add binding buffer 11 min. 4 min. 5 Add ethanol, mix 1 min. 6 Apply sample to column, discard flow-through 2 min. 7 Add wash buffer 1 2 min. 8 Add wash buffer 2 2 min. 9 Centrifuge column 4 min. 10 Add elution buffer, incubate, 3 min. 1 min. centrifuge min. 5 min. (only 20%) Steps not necessary using Nexttec Technology! Using nexttec Technology 96 Well Technology, 1 Technician can Isolate more than 1 Million DNA Samples Without Robotics or Automation! 17
18 Preservation of the DNA with the TypiFix system TypiFix samples from pigs: sampling in March 2003 Storage 18 months at RT Sample processing (DNA isolation) October 2004 Electrophoretic separation of DNA in 1% agarose gel high molecular DNA (approx. 20 kb) 1-40 = 5 µl DNA from TypiFix samples (storage 18 months) DNA isolation with nexttec clean columns (total volume of DNA = 120 µl) M = DNA Marker ( kb)
19 Proof of DNA-Microsatellites in cooked meat Vienese escalope Wiener Schnitzel (veal) DNA-Microsatellites-proof (5 Marker in 5plex-PCR) Extraktion of DNA Fried beef and onions Zwiebelrostbraten Sausage Frankfurter
20 Minced Meat (>50 Animals/Batch) Qualified Sampling method Traceability possible
21 Comparison of DNA Profiles (Microsatellite Analyses ETH03 ETH225 BM1824 Minced meat Carcass Cattle Comparison Meat = Animal = Minced meat Comparison
22 Probe Comparison of DNA-Profiles Minced meat - Animal - Meatsample TGLA227 1 TGLA227 2 BM BM TGLA53 1 TGLA53 2 ETH10 1 ETH10 2 SPS115 1 SPS115 2 TGLA122 1 TGLA122 2 Hackfleischprobe Tier 01/03/16-L-R-Hip-70.04A Fleisch 01/03/15-L-R-HIP-37.35B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.27A Fleisch 01/03/15-L-R-HIP-37.09B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.29A Fleisch 01/03/15-L-R-HIP-37.07B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.33A Fleisch 01/03/15-L-R-HIP-37.15B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.25A Fleisch 01/03/15-L-R-HIP-37.23B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.30A Fleisch 01/03/15-L-R-HIP-37.33B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.25A Fleisch 01/03/15-L-R-HIP-37.23B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.06A Fleisch 01/03/15-L-R-HIP-37.16B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.27A Fleisch 01/03/15-L-R-HIP-37.09B Kontrolltier ETH03 1 ETH03 2 ETH225 1 ETH225 2 BM BM Batches of minced meat, 40 animals each 80 samples of minced meat could be allocated specifically to animals
23 Digitale DNA-Signature C -> T CC 10 TT 01 CT 11 GTCAGTGGGGTGGCTGAGCTGACAGAGGGGAGGGAGCCCATCTAAGGAAAGATACCAGAA GACTCAAGAAGAGTGTGAGGTGAAGAGGTGGACCAGAGCCCTGGAGCTGCTCAGTCTCTG CATCAAGCCAGGTCTCAAGCCAGAGACAGTGTCAGATTTCCCAATTGGGAGATCCCATAA ATTCTTCCTCTTTTGCTTAAGTTACATCGAGTTAGTTTTCTGTCACTTACAATCTAATGG A -> G AA 10 GG 01 AG 11 C/T ACTGGTTTGTTTGCCCAAACCCAGACCCCAGGCTCTGAGGATCTTCACGGGCCCTATTTA ATCATTTCATTAATAGTTGTTTATTTTATCTGTAAAGATCTTCAAAGAAGAGCATCTAAC TCACCAGCCACAGAGCCCCAGAAGGTCACCCTTCATCACCCTTCAAAGTAGCCGCACATC TGGCGCTGGGATTAGTGACATTTGGTGCAGCATCATGAATGAATTCACAGGTTTAGTGAT GCTGTCTTGCTGTCTGTTTTCTCTTAAGTGAATCATTTAGGGCCAAGATCATGAAATAAT CTTTAGAAAGGCAATTGCCTAGCTTGAGGGGAAAGCCCACTAAACTTCTTTCACTCTTTT A -> T AA 10 TT 01 AT 11 C -> A CC 10 AA 01 CA 11 Individual 1 : CT AA TT CA : Individual 2 : TT AA AT CA : Individual 3 : CT GG AT CA :
24 Detection of fragment length of DNA-Microsatellites or single point mutations (SNPs) DNA PCR analyses Evaluation Multiplex-PCR Simultaneous amplification of several markers in one reaction -saves time -saves costs -reduces mistakes TFS samples Fluorescence detection in automated sequence analyses Using sophisticated technology 1 SNP can be analysed for less than 5 cent 24
25 25
26 Traceability of meat by genetic fingerprints/dna Signatures Meat production and Quality Control (Slaughter-house) Sample identification for traceability Genetic Fingerprints Animal identification and sample collection With ear tag Farm Without ear tag 26
27 brand name breeding meat organizations first sample (Typi-Fix ) second sample preparation of DNA DNA-based individual typing genotyping and elektrophoresis individual-specific pattern coverage comparison in meat production for traceability information Identity Control Sample-number Test-number Results results 27
28 Benefits Farm to Fork Safety all the Way Conventional Ear Tags 1.Consumer protection Animal Identification Collection of samples Preservation of samples Archiving of samples Extraction of samples DNA isolation Analyses of samples 2. Animal care TypiFix 3. Animal breeding TypiFix -System Traceability and Verification BVDV, Scrapie, BSE, Pharmacogenetics Analyses for genetic and breeding purposes 28
29 Cost of establishing a traceability system in cattle based on DNA sampling using ear tags and DNA analytic in the whole Carpathian Euro-region 1O EURO per animal to start a pilot project, 2 years Per Kilogramm sold meat Incl. Ear tags for tissue sampling + DNA-Isolation + DNA-Analytic + DNA-Data base of all cattle Running Cost: 0,03 /kg meat sold (cattle)
Section 4 - Guidelines for DNA Technology. Version October, 2017
Section 4 - Guidelines for DNA Technology Section 4 DNA Technology Table of Contents Overview 1 Molecular genetics... 4 1.1 Introduction... 4 1.2 Current and potential uses of DNA technologies... 4 1.2.1
More informationEluted DNA is high quality and inhibitor-free making it ideal for PCR and genotyping.
INSTRUCTION MANUAL ZR DNA-Card Extraction Kit Catalog No. D6040 Highlights Get the DNA out! Simple and efficient procedure for the purification of DNA from samples collected onto Guthrie, FTA, and other
More informationAnnex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D PL 13372 01 00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 22.05.2014 to 25.03.2017
More informationby nexttec TM 1 -Step
Protocol DNA Isolation from Tissue & Cells by nexttec TM 1 -Step - nexttec cleancolumns - Cat. No. 10N.010 Cat. No. 10N.050 Cat. No. 10N.250 Version 1.0 For research only Principle nexttec 1 -Step is the
More informationfrance, genetic selection & technology-driven innovation
france, genetic selection & technology-driven innovation THE KEY FIGURE: Already over 750 000 genotyping tests completed for genomic selection purposes The genomic selection revolution is underway The
More informationGenPlex HID Training Class I
Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications
More informationMolecular Markers CRITFC Genetics Workshop December 9, 2014
Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating
More informationThe French bovine identification and traceability system, updated with the technology of RFID. Louise MARGUIN
The French bovine identification and traceability system, updated with the technology of RFID Louise MARGUIN Contents French individual identification and traceability: The tags The passport The record
More informationFor Research Use Only Ver
INSTRUCTION MANUAL ZR Plant RNA MiniPrep Catalog No. R2024 Highlights Quick, 10 minute isolation of inhibitor-free total RNA (~50 µg) from a wide variety of plant samples using ultra-high density BashingBeads
More informationA handheld system for DNA test based on Lab on chip technologies. Marco Bianchessi
A handheld system for DNA test based on Lab on chip technologies Marco Bianchessi History 2 Mid 90s: Lab on chip introduction From niche to high-volumes products What is needed: 3 Miniaturization 75 000
More informationReliaPrep FFPE gdna Miniprep System
TECHNICAL MANUAL ReliaPrep FFPE gdna Miniprep System Instructions for Use of Products A2351 and A2352 Revised 12/15 TM352 ReliaPrep FFPE gdna Miniprep System All technical literature is available at: www.promega.com/protocols/
More informationAnimal identification, animal breeding and International trade The future EU legislation on Zootechnics
Animal identification, animal breeding and International trade The future EU legislation on Zootechnics ICAR, May 2014 Berlin, 20-23 May 2014 Sergio PAVON European Commission DG Health and Consumer Protection
More informationDetailed Training programme Day 1
Detailed Training programme Day 1 Module Title of Module Training Objective / Subjects Method of Name of Responsible No. Covered Training Tutor before 12h00 12h00 13h30 Lunch Arrival of participants Module
More informationAutomated genomic DNA purification of marine organisms on the epmotion 5075 VAC from Eppendorf
APPLICATION NOTE No. 281 I April 2013 Automated genomic DNA purification of marine organisms on the epmotion 5075 VAC from Eppendorf Cécile Ribout 1, Christophe Carpentieri 2 1 UMR IMBE, SCBM, Marseille,
More informationUsing Genetics for Species Identification
Using Genetics for Species Identification John Hyde NOAA Southwest Fisheries Science Center La Jolla, California USA December 6, 2013 2 Important Point to Consider Not all specimens need to be genetically
More informationPresto Mini gdna Bacteria Kit
Instruction Manual Ver. 02.10.17 For Research Use Only Presto Mini gdna Bacteria Kit Advantages GBB004 (4 Preparation Sample Kit) GBB100/101 (100 Preparation Kit) GBB300/301 (300 Preparation Kit) Sample:
More informationDescription...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...
QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2
More informationiq-check Campylobacter Catalog #:
iq-check Campylobacter Catalog #: 357-8135 User Guide Test for the real-time PCR detection of Campylobacter jejuni, Campylobacter coli and Campylobacter lari in food and environmental samples TABLE OF
More informationMagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack
Bioneer s magnetic nanobead-based solution for DNA/RNA extraction and purification 20150910 Ver.1(EN) MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Fast, easy separation - Just
More informationFurther Reading - DNA
Further Reading - DNA DNA BACKGROUND What is DNA? DNA (short for deoxyribonucleic acid ) is a complex molecule found in the cells of all living things. The blueprint for life, DNA contains all the information
More informationFigure 1: E. Coli lysate transfer using liquid handling automation
Figure 1: E. Coli lysate transfer using liquid handling automation Figure 1 - E. coli lysate transfer using liquid handling automation. Following the manufacturer s procedures, a 96-well plate miniprep
More informationTotal RNA and DNA Purification
Total RNA and DNA Purification User Manual NucleoSpin RNA/DNA Buffer Set October 2008/ Rev. 05 MACHEREY-NAGEL MN Total RNA / DNA Purification from Tissue / Plant Protocol-at-a-glance (Rev. 05) 1 Homogenize
More informationCarcass Traits Association with GH/AluI Gene Polymorphism in Indonesian Aceh Cattle
Carcass Traits Association with GH/AluI Gene Polymorphism in Indonesian Aceh Cattle Eka Meutia Sari¹,*, Ronny Rachman Noor 2, Cece Sumantri 2 & Endang Tri Margawati 3 ¹ Department of Animal Production,
More informationBIO NEWS. Food Diagnostics Special. Genomic DNA from food and feed for GMO detection / quantification and animal species differentiation
BIO NEWS Food Diagnostics Special Genomic DNA from food and feed for GMO detection / quantification and animal species differentiation NucleoSpin Food NucleoSpin Food Purification of genomic DNA from food
More informationGeneaid DNA Isolation Kit (Yeast)
Geneaid DNA Isolation Kit (Yeast) GEY100, GEY300 Advantages Sample: up to 2 10 8 yeast and other fungus species Yield: high yield, high quality DNA (A260/A280 = 1.8-2.0) Format: scalable DNA precipitation
More informationNote: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology
Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content
More informationAnimal identification and traceability in the European Union and international trade
Animal identification and traceability in the European Union and international trade S. Pavón Directorate General for Health and Consumers, European Commission, Brussels, Belgium Summary International
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationFFPE DNA Extraction kit
FFPE DNA Extraction kit Instruction Manual FFPE DNA Extraction kit Cat. No. C20000030, Format 50 rxns Version 1 / 14.08.13 Content Introduction 4 Overview of FFPE DNA extraction workflow 4 Kit contents
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationMD60002 MD MD62002
MagSi-DNA saliva Art.No. MD60002 MD61002 - MD62002 Product Manual Version 1.0 22/01/2015 Table of Contents 1. General Information...3 1.1 Intended Use...3 1.2 Kit specifications...3 1.3 Basic principle...3
More informationBLUP and Genomic Selection
BLUP and Genomic Selection Alison Van Eenennaam Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis, USA alvaneenennaam@ucdavis.edu http://animalscience.ucdavis.edu/animalbiotech/
More informationDevelopments in the Genetic Improvement of a Large Commercial Population in the New Zealand Sheep Industry
Developments in the Genetic Improvement of a Large Commercial Population in the New Zealand Sheep Industry G B Nicoll Landcorp Farming Ltd Rotorua, New Zealand Landcorp Farming Ltd State Owned Enterprise.
More informationRNA and DNA purification
RNA and DNA purification User manual NucleoSpin RNA / DNA Buffer Set January 2018 / Rev. 10 www.mn-net.com Protocol-at-a-glance (Rev. 10) 1 Homogenize sample NucleoSpin RNA / mirna / RNA Blood / RNA Plant,
More informationAnimal Identification: What Does It Mean To The Cattle Industry?
Animal Identification: What Does It Mean To The Cattle Industry? Emmit L. Rawls Professor Agricultural Economics Tammy L. McKinley Extension Assistant Agricultural Economics The Need Enhanced disease control
More informationUser manual MACHEREY-NAGEL. NucleoSpin RNA/ DNA buffer set. April 2005/Rev. 02
Total RNA and DNA Purification User manual NucleoSpin RNA/ DNA buffer set April 2005/Rev. 02 MACHEREY-NAGEL MN MN Protocol at a glance (Rev. 02) Total RNA/DNA Purification from Tissue/Plant Mini NucleoSpin
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationE.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps
E.Z.N.A. MicroElute Genomic DNA Kit D3096-00 5 preps D3096-01 50 preps D3096-02 200 preps December 2013 E.Z.N.A. MicroElute Genomic DNA Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3
More informationGenome Reagent Kits v2 Quick Reference Cards
Chromium Genome Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Genome Library Kit & Gel Bead Kit v2, 16 rxns PN-120258 Chromium Genome Chip Kit v2, 48 rxns PN-120257 Chromium i7 Multiplex
More informationSpecifications. Kit Specifications. Alcohol Precipitation: Up to 100 ml Column Purification: Up to 5 ml Column Binding Capacity 25 µg
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com BAC DNA MiniPrep Kit Product # 18050 Product Insert The BAC DNA
More informationAnimal Identification System in Latvia
Agricultural Data Centre State institution under supervision of the Ministry of Agriculture www.ldc.gov.lv Administration and maintenance of national livestock database Ivans Vorslovs, director Aleksandrs
More informationHiPer Gel Extraction Teaching Kit (Column Based)
HiPer Gel Extraction Teaching Kit (Column Based) Product Code: HTBM010 Number of experiments that can be performed: 10 Duration of Experiment Agarose Gel Electrophoresis: 1 hour Protocol: 1 hour Agarose
More informationHiPer Yeast Genomic DNA Extraction Teaching Kit
HiPer Yeast Genomic DNA Extraction Teaching Kit Product Code: HTBM013 Number of experiments that can be performed: 10 Duration of Experiment: 3 days Day 1: Revival of Host Day 2: Inoculation of culture
More informationcelldatasci.com/rnastorm RNAstorm RNA Isolation Kit for FFPE Tissue Samples Sample Kit (20 extractions)
celldatasci.com/rnastorm info@celldatasci.com RNAstorm RNA Isolation Kit for FFPE Tissue Samples Sample Kit (20 extractions) Support: Email: support@celldatasci.com Phone: 650.285.2376 (option 2) Toll-free:
More informationMolekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien
Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change
More informationHigh-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As
More informationLaboratory Procedure June 2003 HEALTH PRODUCTS AND FOOD BRANCH OTTAWA
Government of Canada Gouvernement du Canada Laboratory Procedure MFLP-28 June 2003 HEALTH PRODUCTS AND FOOD BRANCH OTTAWA THE QUALICON BAX SYSTEM METHOD FOR THE DETECTION OF LISTERIA MONOCYTOGENES IN A
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications
More informationQuality Feeds for Sustainable Livestock Production
Quality Feeds for Sustainable Livestock Production Mark Robbins, Richard Dewhurst and Judith Webb Quality for consumers 42 Quality for animals 43 Quality for the environment 43 Science and breeding for
More informationWhat could the pig sector learn from the cattle sector. Nordic breeding evaluation in dairy cattle
What could the pig sector learn from the cattle sector. Nordic breeding evaluation in dairy cattle Gert Pedersen Aamand Nordic Cattle Genetic Evaluation 25 February 2016 Seminar/Workshop on Genomic selection
More informationProcessing and packaging of meat and poultry. Your partner for plant engineering and construction.
PLanning PRODUcTION implementation Processing and packaging of meat and poultry Your partner for plant engineering and construction www.emf.de Our comprehensive range of services: Planning of food processing
More informationFrequently Asked Questions
Frequently Asked Questions CytoScan Assay and CytoScan 750K Array Equipment requirements 1. What is the CytoScan Assay? The CytoScan Assay, along with the CytoScan 750K Arrays, the GeneChip Command Console
More informationTIANamp Marine Animals DNA Kit
TIANamp Marine Animals DNA Kit For isolation of genomic DNA from marine animal tissues www.tiangen.com/en DP121221 TIANamp Marine Animals DNA Kit (Spin Column) Cat. no. DP324 Kit Contents Contents DP324-02
More informationFundamentals of Genomic Selection
Fundamentals of Genomic Selection Jack Dekkers Animal Breeding & Genetics Department of Animal Science Iowa State University Past and Current Selection Strategies selection Black box of Genes Quantitative
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationKEY CONCEPTS AND PROCESS SKILLS. 1. Blood types can be used as evidence about identity and about family relationships.
Evidence from DNA 40- to 1 2 50-minute sessions 69 M O D E L I N G ACTIVITY OVERVIEW SUMMARY Students learn how DNA fingerprinting is done by performing a simulation of the process used to generate different
More informationAnimal Identification, animal breeding and international trade- the new EU Regulation on Zootechnics. Sergio Pavón
Animal Identification, animal breeding and international trade- the new EU Regulation on Zootechnics Sergio Pavón ICAR/Interbull Conference 19-23 May 2014; Berlin, Germany 1. Bovine identification and
More informationUNDERSTANDING & USING GENEMAX FOCUS TM
UNDERSTANDING & USING GENEMAX FOCUS TM GeneMax Focus is a genomic test created through collaboration between Angus Genetics Inc. (AGI), Certified Angus Beef (CAB) and Zoetis to help inform commercial Angus
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationLow cost and non-toxic genomic DNA extraction for use in molecular marker studies.
Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and
More informationExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!
ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen - Automated Protein Synthesis/Purification System ExiProgen
More informationApplied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems
PRODUCT BROCHURE Real-Time PCR Systems Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems Real Fast. Real Versatile. Real Value. Real choices from the leader in real-time PCR. The latest
More informationIsolation of Viral RNA, Viral DNA and Bacterial DNA from Animal Samples
Application Note Isolation of Viral RNA, Viral DNA and Bacterial DNA from Animal Samples Denis Flüge, Lillian Krüger, Sandy Leifholz and Holger Engel R&D Department, QIAGEN GmbH, QIAGEN Straße 1, Hilden,
More informationfoodproof Magnetic Preparation Kit I
For food testing purposes FOR IN VITRO USE ONLY foodproof Magnetic Preparation Kit I Version 1, August 2012 Application manual for the automated isolation of Gram-negative bacterial DNA from enrichment
More informationProtocol for DNA extraction from FFPE Samples
25, ave Georges Lemaître - B-6041 Gosselies (Belgique) Tel : +32 (0)71 37 85 27 - Fax : +32 (0)71 34 78 79 Protocol for DNA extraction from FFPE Samples Step 1. Paraffin Removal 1 Equilibrate a heat block
More informationOne platform, endless possibilities
One platform, endless possibilities The Agilent 2100 Bioanalyzer is an indispensable tool for food chemists and biologists. Now you can have a multi-purpose platform that streamlines your workflows from
More informationRevolutionizing genetics in the cattle industry. Extensive toolset. Proven technology. Collaborative approach.
Revolutionizing genetics in the cattle industry. Extensive toolset. Proven technology. Collaborative approach. Breed success. Join the revolution. Beef cattle with improved meat quality. Exceptional tenderness.
More informationRISK OF SCRAPIE FOR ROMANIAN TURCANA SHEEP OF PRION PROTEIN GENOTYPE ARQ/ARQ
Romanian Biotechnological Letters Vol. 18, No.3, 2013 Copyright 2013 University of Bucharest Printed in Romania. All rights reserved ORIGINAL PAPER RISK OF SCRAPIE FOR ROMANIAN TURCANA SHEEP OF PRION PROTEIN
More informationTaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0
Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationChapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting
More informationLesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.
More informationSite-directed mutagenesis of proteins
IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction
More informationGenomic selection +Sexed semen +Precision farming = New deal for dairy farmers?
Genomic selection +Sexed semen +Precision farming = New deal for dairy farmers? Laurent Journaux General secretary of France Génétique Elevage SIA souvenir Introduction After a long period of stability
More informationXpedition Soil/Fecal DNA MiniPrep Catalog No. D6202
INSTRUCTION MANUAL Xpedition Soil/Fecal DNA MiniPrep Catalog No. D6202 Highlights Take the Lab to the Field with state of the art Xpedition Sample Prep and DNA Preservation Technologies. For efficient
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationImproving Genetics in the Suckler Herd by Noirin McHugh & Mark McGee
Section 4 23 by Noirin McHugh & Mark McGee Introduction Carefully identifying better animals and breeding them with other superior animals will gradually improve the genetics of a herd. Enhanced genetics
More informationBiotechnology Explorer
Biotechnology Explorer Fish DNA Barcoding Kit Planning Guide explorer.bio-rad.com Catalog #166-5100EDU, Fish DNA Barcoding Kit Catalog #166-5115EDU, DNA Barcoding Sequencing Module Note: This document
More informationAutomated DNA extraction: Integration of the chemagic Magnetic Separation Module I with the Perkin Elmer MultiProbe II Liquid Handler
Automated DNA extraction: Integration of the chemagic Magnetic Separation Module I with the Perkin Elmer MultiProbe II Liquid Handler Technology Assessment Report December 2008 Revised April 2009 www.eurogentest.org
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationApplications Note 161 March 2010
Applications Note 161 March 2010 High throughput DNA isolation using the MACHEREY-NAGEL NucleoSpin 96 Blood kit on the epmotion 5075 from Eppendorf Henning Risch 1, Thomas Zinn 1, Daniel Wehrhahn 2 1 MACHEREY-NAGEL
More informationProceedings, The Range Beef Cow Symposium XXIV November 17, 18 and 19, 2015, Loveland, Colorado HOW TO USE COMMERCIALLY AVAILABLE GENOMIC PREDICTIONS
Proceedings, The Range Beef Cow Symposium XXIV November 17, 18 and 19, 2015, Loveland, Colorado HOW TO USE COMMERCIALLY AVAILABLE GENOMIC PREDICTIONS M.G. Gonda Department of Animal Science South Dakota
More informationEureka Genotyping Assay
Quick Reference Card Eureka Genotyping Assay This quick reference card is intended for experienced users. For detailed instruction, please refer to the Eureka Genotyping Workflow User Guide (P/N 703400
More informationMicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology
Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables
More informationProtocol. Nexterion Slide A+ MPX 16. DNA-application
Seite: 1/12 1 Introduction...2 2 Storage and handling...3 3 General precautions...3 4 Reagents required...3 5 Equipment required...4 6 Array printing...4 7 Printing guidelines...5 8 DNA immobilization...6
More informationYeaStar Genomic DNA Kit Catalog No. D2002
Instructions YeaStar Genomic DNA Kit Catalog No. D2002 Table of Contents General Information...... 1 Package Contents Ordering Information General Description...... 2 Protocol I.......... 2 Protocol II.
More informationBASELINE SURVEY: MARKET AGENT SURVEY MANUAL
DEVELOPMENT AND APPLICATION OF DECISION SUPPORT TOOLS TO CONSERVE AND SUSTAINABLY USE GENETIC DIVERSITY IN INDIGENOUS LIVESTOCK & WILD RELATIVES BASELINE SURVEY: MARKET AGENT SURVEY MANUAL Collaborating
More informationVerotoxigenic Escherichia coli O26 (VTEC) foodborne outbreak in Romania incriminated foods and test results
Verotoxigenic Escherichia coli O26 (VTEC) foodborne outbreak in Romania incriminated foods and test results INSTITUTE OF HYGIENE AND VETERINARY PUBLIC HEALTH (IHVPH) BUCHAREST NRL E. COLI ROMANIA DR. CIUPESCU
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More informationEmpowering genotyping by sequencing in animal applications - the power of partnering.
Empowering genotyping by sequencing in animal applications - the power of partnering. Round 1: About cats, dogs and cattle Wim van Haeringen, PhD Content Company Introduction Background including market
More informationMaxwell RSC Blood DNA Kit
TECHNICAL MANUAL Maxwell RSC Blood DNA Kit Instructions for Use of Product AS1400 Caution: Handle cartridges with care; seal edges may be sharp. Revised 1/15 TM419 Maxwell RSC Blood DNA Kit All technical
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More information3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com E.coli O157:H7 End-Point PCR Kit Product# EP41300 Product Insert
More informationTECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
More informationReliaPrep gdna Tissue Miniprep System
TECHNICAL MANUAL ReliaPrep gdna Tissue Miniprep System Instruc ons for Use of Products A2050, A2051 and A2052 Revised 8/13 TM345 ReliaPrep gdna Tissue Miniprep System All technical literature is available
More informationRegents Biology REVIEW 5: GENETICS
Period Date REVIEW 5: GENETICS 1. Chromosomes: a. Humans have chromosomes, or homologous pairs. Homologous: b. Chromosome pairs carry genes for the same traits. Most organisms have two copies of the gene
More information