The coding DNA sequence (cds) of the human GPR143 gene was inserted into
|
|
- Catherine Gordon
- 6 years ago
- Views:
Transcription
1 Supplemental information METHODS Cloning The coding DNA sequence (cds) of the human GPR143 gene was inserted into puc19 plasmid using SalI and KpnI restriction enzymes. The mutations in the two GPR143 sorting signals (L223A-L224A and W329A-E330A) were obtained by sitedirected mutagenesis using polymerase chain reaction (PCR). Mutagenesis primers were designed with the corresponding mismatch flanked by nucleotides at the 3 - and 5 -end. Sequencing of single clones of wild type (wt) and mutant GPR143 was performed by GATC Biotech (Konstanz, Germany). The proper cds were then subcloned into DiscoverX plasmid whose ProLink (PL) tag was attached at the C terminal of GPR143 (PK2 vector, DiscoverX, Birmingham, UK) using NheI and BglII restriction sites. Cell culture and transfection Chinese Hamster Ovary (CHO) -arrestin cells were engineered from DiscoverX (Birmingham, UK) to contain the -galactosidase EA fragment fused to arrestin. Our goal was to introduce in those cells the plasmid containing wt or mutant GPR143 linked to the -galactosidase PL fragment to perform the -arrestin recruitment assay. CHO arrestin cells were cultured at 37 C with 5% CO2 in Dulbecco s modified Eagle medium-f12 (DMEM-F12) containing 10% FCS, 100 U/ml penicillin G and 100 g/ml streptomycin. CHO cells were transfected with jetprime transfection kit (Polyplus Transfection, Darmstadt, Germany) according to the manufacturer s recommendations. Melan-a cells (immortalized murine melanocytes) were grown in a mixture of 80% RPMI-20% DMEM medium supplemented with 10% FCS, 1% sodium
2 pyruvate, 1% glutamate, 5 U/ml penicillin, 5 g/ml streptomycin, 1% non-essential amino acids and 200 nm 12-O-tetradecanoyl phorbol 13-acetate. Immunostaining Transfected CHO cells were cultured on coverslips in a 12 well plate (Sarstedt) and fixed with a cold 1:1 methanol/aceton solution for 20 min at -20 C. Cells were then washed with phosphate-buffered saline (PBS) and blocked 1 h with 1% bovine serum albumin (BSA)/PBS solution. Cells were incubated in the dark 60 min with the first antibody and then 30 min with the secondary antibody, both diluted in 1% BSA/PBS. PBS was used to wash cells in between and after antibody incubations. At last coverslips were mounted using ProLong Gold antifade reagent (Invitrogen, Darmstadt, Germany) and stored in the dark at 4 C. Mouse monoclonal anti-pk/pl antibody (PathHunter DiscoverX, Birmingham, UK), rabbit polyclonal anti-pan Cadherin antibody (Abcam, Cambridge, UK), donkey anti-mouse-alexafluor594 (Jackson Immuno Research, Hamburg, Germany) and donkey anti-rabbit-alexa488 (Jackson Immuno Research, Hamburg, Germany) were used to stain GPR143 and the cells plasma membrane. A Nikon A1 Spectral confocal microscope (Pharmaceutical Institute, University of Bonn, Germany) and the NIS Element Advanced Research software 4.0 were used for image acquisition and analysis. Data analysis Results of -arrestin assay are presented as mean SEM from at least 3 independent experiments performed in triplicates. Data were analyzed using Prism 7.0 (GraphPad Software Inc., San Diego, CA, USA). Differences between means or single values were tested for significance by unpaired t test (Prism). IC50 values were determined by fitting the data to a sigmoidal curve with variable slope (Prism).
3 Calcium mobilization assay CHO -arrestin cells expressing the wt or the mutant GPR143 receptor were seeded in one 175cm 2 flask and cultivated until they reach 80-90% of confluency. The cells were detached with trypsin, transferred to a falcon tube containing medium and placed into a 37 C incubator for 45 min allowing them to recover. Afterward, cells were centrifuged and the pellet resuspended in Hank s Balanced Salt Solution (HBSS; 20 mm HEPES, 13 mm NaCl, 5.5 mm glucose, 5.4 mm KCl, 4.2 mm NaHCO3, 1.25 mm CaCl2, 1 mm MgCl2, 0.8 mm MgSO4, 0.44 mm KH2PO4 and 0.34 mm Na2HPO4, ph 7.4). The calcium sensitive dye was added (Fluo-4 AM, 3 µm diluted in DMSO, Invitrogen) together with Pluronic F-127 (60 µm final concentration), a detergent permeabilizing the cell membrane to permit the dye-uptake from the cells. Cells were incubated 1 h at room temperature in the dark on a rotating wheel. The reagent plate was prepared with the compound dilutions, negative control (HBSS) and positive control (100 µm ATP). Then, the cells were centrifuged at lowest velocity and the pellet was washed three times with buffer (HBSS). The cells were seeded in a 96-well plate with clear flat bottom and incubated under light exclusion for 30 minutes allowing the cells to settle down in the wells. The cell and reagent plates were placed into the microplate reader which measured the fluorescence intensity at a wavelength of 520 nm following excitation at 480 nm. camp accumulation assay CHO -arrestin cells ( cells/well) were seeded in 24-well plates 24 h before performing the assay. Cells are then washed and incubated 2 h at 37 C and 5% CO2 with HBSS. Cells were then incubated 15 min with the phosphodiesterase inhibitor Ro (Hoffmann La Roche, Grenzach, Germany; final concentration 40 M) at 37 C and 5% CO2. To detect the Gi protein signaling pathway, different
4 concentrations of compounds in 5% DMSO/HBSS buffer (final DMSO concentration: 1%) were added and, after a 5 min incubation at 37 C, forskolin (10 µm final concentration) was added in every well. The supernatant was removed after an incubation of 15 mins at 37 C. On the other hand, to detect the Gs protein signaling pathway, different dilutions of compounds in 5% DMSO/HBSS buffer were added to the cells and incubated 15 min at the same conditions described above. The supernatant was then removed and 500 l of hot lysis buffer (90 C; 4 mm EDTA and 0.01% Triton X-100, ph 7.4) were added. After 1 h of mixing on ice, the camp amount in the lysates was determined by competitive radioligand binding experiments l of lysate was incubated with 30 l of [ 3 H]cAMP solution in lysis buffer (final radioligand concentration 3 nm) and 40 l of camp binding protein (50 g/vial). For the camp standard curve, 50 l of different camp concentrations were measured instead of the cell lysate. Total binding was obtained mixing radioligand solution and camp binding protein to lysis buffer, and the background was defined in the absence of binding protein. The mixture was incubated 60 min on ice and then filtered through GF/B glass fiber filters using a Brandel harvester. The filters were then washed with ice-cold Tris buffer (50 mm, ph 7.4), transferred into vials and incubated for 6 h with 2.5 ml of scintillation cocktail (LUMASAFE, Perkin Elmer, Rodgau, Germany). The vials were then counted in liquid scintillation counter (Tricarb 2900TR, Perkin Elmer, Rodgau, Germany). Independent experiments were performed in duplicates. Amounts of camp were calculated by linear regression from a standard curve and normalized to the maximal effect induced by 100 M forskolin (set as 100%). MTT assay Melan-a cells (5000 cells/well) were seeded in a 96-well plate and cultivated
5 overnight in the incubator. The compounds dissolved in DMSO and ethanol were diluted in the medium (80% RPMI-20% DMEM medium), added to the cells and incubated 72 h at 37 C with 10% CO2. The reagent is composed by a tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4- sulfophenyl)-2h-tetrazolium] which needs to be mixed with an electron coupling reagent (phenazine methosulfate). The mixed reagents were applied on the cells (100 l) after the supernatant disposal and the cells were incubated for 1 h at the same conditions described above. The absorbance was then read at 490 nm. The cells treated with the vehicles were used as control and set as 100% cell viability. Independent experiments were performed in quadruplicates. Western Blot Cell lysates (30 µg total protein/well) were separated in 10% SDS-PAGE gel and then transfered onto a nitrocellulose membrane (PROTRAN Nitrocellulose Transfer Membrane Whatman, Sigma, Taufkirchen, Germany). The Novex Sharp Prestained Protein Standard (Thermo Fisher Scientific) was used as marker. The membrane was blocked 1 hour in a 5% powdered milk/pbs-tween solution. Afterward, the membrane was incubated with the primary antibody overnight at 4 C or 1 hour at RT, washed 1 h with PBS-Tween, incubated with secondary antibody and washed again. The detection was performed with ECL kit (GE Healthcare, Amersham, Arlington, IL Dassel, Germany) according to the manufacturer's instructions. The following antibody combinations were used: mouse monoclonal anti- PK/PL (1:1000 dilution, PathHunter DiscoverX, Birmingham, UK) and anti-mouse- HRP (1:5000 dilution, Jackson Immuno Research, Hamburg, Germany) or rabbit antiserum PEP-7 3 and anti-rabbit-hrp (Sigma), respectively.
6 References 1. Nordstedt C, Fredholm BB. A modification of a protein-binding method for rapid quantification of camp in cell-culture supernatants and body fluid. Anal Biochem 1990;189: Pomerantz SH. L-tyrosine-3,5-3H assay for tyrosinase development in skin of newborn hamsters. Science 1969;164: Jimenez M, Tsukamoto K, Hearing V. Tyrosinases from two different loci are expressed by normal and by transformed melanocytes. J Biol Chem 1991;266:
OPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationModified Rapid MAIPA Protocol
Modified Rapid MAIPA Protocol This method is based on the following publication; K Campbell, K Rishi, G Howkins, D Gilby, R Mushens, C Ghevaert, P Metcalfe, WH Ouwehand, G Lucas. A modified fast MAIPA
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationPARP-1 (cleaved) Human In-Cell ELISA Kit (IR)
ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationCytotoxicity LDH Assay Kit-WST
Cytotoxicity LDH Assay Kit-WST Supplementary Information Notice to Users Preparation of Reagent This instruction complements the Technical Manual in the product. Please use this instruction as supplements
More informationProtocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation
Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation In vitro neurological research presents many challenges due to the difficulty in establishing high-yield neuronal
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationFor identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.
ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use
More informationFlashPlate File #15. High Throughput Screening. J. Watson SmithKline Beecham Pharmaceuticals, UK.
Drug Discovery Research Clinical Screening High Throughput Screening FlashPlate File #15 Use of Novel FlashPlate Technology to Measure camp Accumulation in Chinese Hamster Ovary Cells Expressing Human
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationPathHunter β-arrestin GPCR Assays
Contact Information 70-247 DRx_UM_PH_ARR_0914V7 DiscoveRx Corporation (World Wide Headquarters) 42501 Albrae Street Fremont, CA 94538 United States t 1.510.979.1415 f 1.510.979.1650 toll-free 1.866.448.4864
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationPathHunter β-arrestin GPCR Assays
PathHunter β-arrestin GPCR Assays For Chemiluminescent Detection of Activated GPCRs User Manual Simple Solutions for Complex Biology CONTENTS LEGAL SECTION INTENDED USE TECHNOLOGY PRINCIPLE ASSAY OVERVIEW
More informationCalcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included
BD Technical Data Sheet Calcium Assay Kit Product Information Catalog Number: 640176 Size Reagents for 10 plates Components: Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml 1X Calcium
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplemental Materials and Methods
Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationab Fluo-8 No Wash Calcium Assay Kit
ab112129 Fluo-8 No Wash Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe. This product is for research use only and is not intended for
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationLacZ beta Galactosidase Intracellular Detection Kit
ab189816 LacZ beta Galactosidase Intracellular Detection Kit Instructions for Use For the detection of beta-galactosidase using Microplate or FACS Assay This product is for research use only and is not
More informationhuman Serotonin 5-HT 2A Receptor Cell Line
TECHNICAL DATA SHEET ValiScreen GPCR Cell Line Caution: For Laboratory Use. A research product for research purposes only human Serotonin 5-HT 2A Receptor Cell Line Product No.: ES-313-C Lot No.: M1W-C3
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationLDH-Cytox Assay Kit. A Colorimetric Cytotoxicity Measuring Kit. Cat. No LDH-Cytox Assay Kit can be used to measure cytotoxicity in vitro
A Colorimetric Cytotoxicity Measuring Kit Cat. No. 426401 LDH-Cytox Assay Kit can be used to measure cytotoxicity in vitro BioLegend, Inc Biolegend.com It is highly recommended that this manual be read
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationTACS MTT Assays. Cell Proliferation and Viability Assays. Catalog Number: TA tests. Catalog Number: TA tests
TACS MTT Assays Cell Proliferation and Viability Assays Catalog Number: TA5355-2500 tests Catalog Number: TA5412-5000 tests This package insert must be read in its entirety before using this product. FOR
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationAlt-R CRISPR-Cpf1 System:
user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only
More informationMyBioSource.com. Human Total Bilirubin (TBB) Elisa kit. (Competitive ELISA)
Human Total Bilirubin (TBB) Elisa kit (Competitive ELISA) 96 Tests Catalog Number: MBS756198 Store all reagents at 2-8 C Valid Period: six months For samples: Serum, plasma, cell culture supernatants,
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationNuclear Condensation Assay Kit Green Fluorescence
ab139479 Nuclear Condensation Assay Kit Green Fluorescence Instructions for Use Designed to assay chromatin condensation in live cells using an intercalating dye which is excitable with a standard 488nm
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationPI3 Kinase Assay Kit. Catalog Number KA assays Version: 05. Intended for research use only.
PI3 Kinase Assay Kit Catalog Number KA0904 400 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials Supplied...
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationData Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618
Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationRat α-melanocyte stimulating hormone (α-msh) ELISA Kit
Rat α-melanocyte stimulating hormone (α-msh) ELISA Kit For the quantitative determination of rat α-melanocyte stimulating hormone (α-msh) concentrations in serum, plasma, tissue homogenates. This package
More informationIn-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
More informationHuman Opioid mu (OP3) Receptor, Frozen Cells
TECHNICAL DATA SHEET campzen Caution: For Laboratory Use. A research reagent for research purposes only. You are authorized to utilize these frozen cell preparations one time only. Any attempt to transfer,
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationData Sheet. PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions
Data Sheet PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions DESCRIPTION: Cell signaling through the PD-1 receptor upon binding the PD-L2 ligand attenuates immune responses
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationSTANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA)
STANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA) 1. PURPOSE This procedure is to be used for the characterization of purified monoclonal antibody. 2. SCOPE This
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationFluo-8 Medium Removal Calcium Assay Kit
ab112128 Fluo-8 Medium Removal Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe This product is for research use only and is not intended
More informationFor the sensitive and accurate measurement of adenylate cyclase activity in cell extracts, tissue extracts and biological fluids.
Version 7 Last updated 13 September 2017 ab138880 camp Direct Immunoassays Kit (Fluorometric) For the sensitive and accurate measurement of adenylate cyclase activity in cell extracts, tissue extracts
More informationab Cell Viability Assay Kit Fluorometric Dual Green/Red
ab112121 Cell Viability Assay Kit Fluorometric Dual Green/Red Instructions for Use For detecting cell viability in suspension and adherent cells by using dual proprietary green and red fluorescence probes.
More informationRat TAR DNA Binding Protein 43 (TDP-43) ELISA
KAMIYA BIOMEDICAL COMPANY Rat TAR DNA Binding Protein 43 (TDP-43) ELISA For the quantitative determination of rat TDP-43 in serum, plasma, cell culture supernatants, body fluid and tissue homogenate Cat.
More informationHuman Active Caspase-3 Kit
TECHNICAL DATA SHEET AlphaLISA Research Reagents Caution: For Laboratory Use. A research chemical for research purposes only. Human Active Caspase-3 Kit Product No.: AL278 C/F Lot specific kit information
More informationab65354 Superoxide Dismutase Activity Assay kit (Colorimetric)
Version 9 Last updated 11 January 2018 ab65354 Superoxide Dismutase Activity Assay kit (Colorimetric) For the measurement of Superoxide Dismutase Activity in various samples. This product is for research
More informationWeek 1: Protein isolation and quantification
Week 1: Protein isolation and quantification Objective The objective of this lab exercise is to obtain protein samples from fruit fly larvae, BCS and FBS, all of which are then quantitated in the preparation
More informationCanine Symmetric dimethylarginine ELISA Kit
Distribuito in ITALIA da Li StarFish S.r.l. Via Cavour, 35 20063 Cernusco S/N (MI) telefono 02-92150794 fax 02-92157285 info@listarfish.it www.listarfish.it Optimize Your Research Canine Symmetric dimethylarginine
More informationCulture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).
Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Characterization of non-olfactory GPCRs in human sperm with a focus on GPR18 Caroline Flegel 1, Felix Vogel 1,5, Adrian Hofreuter 1, Sebastian Wojcik 1, Clara Schoeder 3, Katarzyna
More informationElectronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011.
Experimental: MTT assay: To determine cell viability the colorimetric MTT metabolic activity assay was used. Hela cells (1 10 4 cells/well) were cultured in a 96-well plate at 37 C, and exposed to varying
More informationSupporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle
More informationMitochondrial DNA Isolation Kit
Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationAutophagy Assays (LC3B immunofluorescence, LC3B western blot, acridine orange assay) Xin Zhang and Qingsong Liu *
Autophagy Assays (LC3B immunofluorescence, LC3B western blot, acridine orange assay) Xin Zhang and Qingsong Liu * High Magnetic Field Laboratory, Chinese Academy of Sciences, Hefei, Anhui, China *For correspondence:
More informationhuman Muscarinic Acetylcholine Receptor M 4 Aequorin Cell Line
TECHNICAL DATA SHEET AequoScreen GPCR Cell Line Caution: For Laboratory Use. A research reagent for research purposes only human Muscarinic Acetylcholine Receptor M 4 Aequorin Cell Line Product No.: ES-213-A
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationElectronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
More informationFluo-8 No Wash Calcium Assay Kit
ab112129 Fluo-8 No Wash Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe This product is for research use only and is not intended for diagnostic
More informationab MDR Assay Kit (Fluorometric)
ab112142 MDR Assay Kit (Fluorometric) Instructions for Use For detecting MDR pump activities in cells using our proprietary fluorescence probe. This product is for research use only and is not intended
More informationAnti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP
Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase Product no: C2-HRP Product Description This monoclonal antibody (Mab) reacts with Asian Sea bass (Lates
More informationMouse Luteinizing Hormone (LH) ELISA
Mouse Luteinizing Hormone (LH) ELISA For the quantitative determination of mouse LH in serum, plasma and tissue homogenates Cat. No. KU-222 For Research Use Only. Not for use in diagnostic procedures.
More informationCOLORIMETRIC SANDWICH ELISA KIT INSTRUCTION MANUAL
Page 1 of 7 COLORIMETRIC SANDWICH ELISA KIT INSTRUCTION MANUAL This product is for research use ONLY and not for human or animal therapeutic or diagnostic use. Page 2 of 7 Contents Page 3 I. Supplied Materials:
More informationBovine prolactin/luteotropic hormone (PRL/LTH) ELISA Kit
Bovine prolactin/luteotropic hormone (PRL/LTH) ELISA Kit Catalog Number. MBS703224 For the quantitative determination of bovine prolactin/luteotropic hormone (PRL/LTH) concentrations in serum, plasma.
More informationRayBio Phospho- Stat 3 (Tyr705) ELISA Kit
RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationRat Calcitonin Gene Related Peptide (CGRP) Elisa kit
Rat Calcitonin Gene Related Peptide (CGRP) Elisa kit 96 Tests Catalogue Number: AMS.E02C0744 Store all reagents at 2-8 C Valid Period: six months For samples: Serum, plasma, cell culture supernatants,
More informationLHCN-M2 cell culture, differentiation treatment, and cross-linking protocol.
Cell Growth Protocol and Differentiation treatment for the LHCN-M2 Cell Line From: HudsonAlpha/Caltech ENCODE group Date: February 17, 2011 Prepared by: Chun-Hong Zhu and Woodring E. Wright (typed by Brian
More informationHuman connective tissue growth factor (CTGF) ELISA Kit. MyBioSource.com. This package insert must be read in its entirety before using this product.
Human connective tissue growth factor (CTGF) ELISA Kit Catalog Number. For the quantitative determination of human connective tissue growth factor (CTGF) concentrations in serum, plasma, tissue homogenates.
More informationAssayMax Human IL-6 ELISA Kit
AssayMax Human IL-6 ELISA Kit Assaypro LLC 3400 Harry S Truman Blvd St. Charles, MO 63301 T (636) 447-9175 F (636) 395-7419 www.assaypro.com For any questions regarding troubleshooting or performing the
More informationData Sheet. PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # Size: 96 reactions
Data Sheet PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # 72003 Size: 96 reactions DESCRIPTION: Cell signaling through the PD-1 receptor upon binding the PD-L1 ligand attenuates immune
More informationHuman Basic Fibroblast growth factor (bfgf) ELISA
Human Basic Fibroblast growth factor (bfgf) ELISA For the quantitative determination of human bfgf in serum, plasma, cell culture supernatants, body fluid and tissue homogenate Cat. No. KT-52774 For Research
More informationMouse Gonadotropin Releasing Hormone (GnRH) ELISA
KAMIYA BIOMEDICAL COMPANY Mouse Gonadotropin Releasing Hormone (GnRH) ELISA For the quantitative determination of mouse GnRH in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-58182
More informationRayBio LDH-Cytotoxicity Assay Kit
RayBio LDH-Cytotoxicity Assay Kit User Manual Version 1.0 September 11, 2014 RayBio LDH-Cytotoxicity Assay (Cat#: 68CX-LDH-S400) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationFACS Blue LacZ beta Galactosidase detection kit
ab189815 FACS Blue LacZ beta Galactosidase detection kit Instructions for Use For the detection of beta-galactosidase using Enzyme or FACS Assay This product is for research use only and is not intended
More informationHuman Pluripotent Stem Cell Functional Identification Kit
Human Pluripotent Stem Cell Functional Identification Kit Catalog Number SC027B Reagents for the identification of human pluripotent stem cells by in vitro functional differentiation. This package insert
More information96-well Checkpoint Kinase Activity Assay Kit
Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a
More informationHuman immunoglobulin G(IgG) ELISA Kit
Human immunoglobulin G(IgG) ELISA Kit For the quantitative determination of human immunoglobulin G (IgG) concentrations in serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates.
More informationSimple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology
APPLICATION NOTE HTS Reagents Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Waltham, MA Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology Introduction Immunoassays
More informationUV-Induced DNA Damage ELISA (CPD Quantitation)
KAMIYA BIOMEDICAL COMPANY UV-Induced DNA Damage ELISA (CPD Quantitation) For the rapid detection and quantitation of CPD in any DNA samples Cat. No. KT-914 For Research Use Only. Not for use in diagnostic
More informationHuman IL10RB ELISA Pair Set ( CRFB4 )
Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the
More informationNAD/NADH Cell-Based Assay Kit
NAD/NADH Cell-Based Assay Kit Item No. 600480 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Safety Data
More informationAccurate and Automated cell confluence assessment in microplates
Accurate and Automated cell confluence assessment in microplates TECAN S SPARK 20M MICROPLATE READER WITH INTEGRATED CELL IMAGING SIMPLIFIES CELL CULTURE QC AND SIGNAL NORMALIZATION TO CELL CONFLUENCE
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications
More informationMouse Peptide YY (PYY) ELISA
Mouse Peptide YY (PYY) ELISA For the quantitative determination of mouse PYY in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-58705 For Research Use Only. Not for use in diagnostic
More informationOrexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,
Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3
More informationLDH-Cytotoxicity Assay Kit II
LDH-Cytotoxicity Assay Kit II Catalog Number KA0786 500 assays Version: 08 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationWhole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
More informationMSD 96-Well MULTI-ARRAY and MULTI-SPOT Mouse Cytokine Assays: Tissue Culture Kit
MSD 96-Well MULTI-ARRAY and MULTI-SPOT Mouse Cytokine Assays: Tissue Culture Kit Summary MSD Cytokine Assays measure one to ten cytokines in a 96-well MULTI-ARRAY or MULTI-SPOT plate. The assays employ
More informationGrowth and Maintenance of the 293A Cell Line
Growth and Maintenance of the 293A Cell Line USER GUIDE Catalog Number R705-07 Publication Number MAN0000303 Revision A.0 For Research Use Only. Not for use in diagnostic procedures. The information in
More informationRayBio Phospho- Akt (Ser473) ELISA Kit
RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)
More information