Supplemental Materials and Methods

Size: px
Start display at page:

Download "Supplemental Materials and Methods"

Transcription

1 Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells ( ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM), anti-cxcr7 antibody clone 11G8 (10µg/mL) or CCX771 small-molecule compound (1µM) in RPMI, BSA 1%, HEPES 20 mm, ph 7.4 for 45 min. 125 I-CXCL12 (1.6ng/mL corresponding to 0.2nM) was then added for 3h at 37 C. Non-specific internalized ligand was determined by maintaining the cells on ice throughout the experiment. KG1 cells were then incubated for 5 min with stripping buffer composed of 0.5 M NaCl, 0.2 M Acetic Acid, ph 2.6. The mixture was added on a 12% sucrose cushion and centrifugated for 10 min. Supernatant containing the unbound 125 I- CXCL12 was aspirated and the cell pellet was resuspended and transferred into a fresh counting tube. 125 I-CXCL12 was quantified by Gamma counter Packard Cobra II Auto- Gamma. Expression of a CXCR7-YFP plasmid CXCR7-YFP plasmid, a kind gift from r A. Levoye and r F. Bachelerie (Institut Pasteur, Paris, France) (Levoye et al. Blood., 2009, 113(24): ) was transfected in SkBr3 cells with FuGENE H transfection reagent for 48h following FuGENE H protocol database ( SkBr3 cells were then stained with anti-cxcr7 antibody and analyzed by B Fortessa flow cytometer and TC5 SP5 confocal microscope (Leica Wetzlar-Germany).

2 Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Reverse transcription of total RNA from C34 cells was achieved using TaqMan Reverse Transcription Reagents (Applied Biosytems) as previously described (Chabanon et al., Stem Cells 2008, 26(12): ). For not quantitative PCR, cna was amplified for 40 cycles using HotStart Taq polymerase kit (Quiagen). Specific Primer sequences are detailed in Table S2.

3

4 I-CXCL12 (in percentage) 50 0 CTL CXCL12 CXCL11 anti-cxcr7 (11G8) CCX771 Supplemental Figure 2: 125 I-CXCL12 binds to CXCR7 in C34 KG1 cells C34 KG1 cells were pre-incubated on ice for 45 min with medium alone (CTL) or with CXCL12, CXCL11, anti-cxcr7 antibody (clone 11G8) or the CCX771 small-molecule antagonist. 125 I-CXCL12 was then added and cells incubated for 3h at 37 C to promote endocytosis of bound radioligand. Cells were then put back on ice and surface-bound radioligand removed by incubation with an acidic stripping buffer. Cell associated (internalized) radioligand was separated from unbound by centrifugation through a 12% sucrose cushion. Histograms show cell-associated 125 I-CXCL12; data are expressed as the mean percentage ± S (n³5) of the value measured in control cells. indicate the significance of differences between experimental conditions (ANOVA, p<0.001).

5 Cyclin1 Fold change vs. isotype control G 0 G 1 SG 2 /M CyclinA Fold change vs. isotype control CyclinB1 G 0 G 1 SG 2 /M Fold change vs. isotype control G 0 G 1 SG 2 /M SF-1 anti-cxcr7 anti-cxcr4 Supplemental Figure 3: CXCR7 participates with CXCR4 in CXCL12-induced cyclin1, A, B1 overexpression in PB C34 cells PB C34 cells were stimulated 48 hours in a serum- and cytokine-free StemaA medium in the presence or absence of CXCL12 (0.5 ng/ml), neutralizing anti-cxcr4 and/or -CXCR7 antibodies or isotype control. After Cyclin 1, A, B1/PI labeling, the percentages of cyclin 1, A, B1 expressing cells in G 0 /G 1 or SG 2 /M phases were determined by flow cytometry. Histograms show the modulations of the percentages of cyclin 1, A, B1 expressing cells in G 0 /G 1 or SG 2 /M phases vs. control cells as mean of fold changes ± S (n>3)., indicate significance versus control cells (p 0.05 and p 0.01)., indicate significance between conditions (p 0.05 and p 0.01).

6 SUPPLEMENTAL TABLES Table S1 : Antibodies Antibody Manufacturer Clone CXCR4 R&Systems 12G5 CXCR4 Abcam CXCR4-FITC R&Systems 12G5 CXCR4-PE B Biosciences 12G5 CXCR7 MBL 9C4 CXCR7 ChemoCentryx Inc. 11G8 CXCR7 GeneTex CXCR7-PE MBL International 9C4 C34-Percp B Biosciences 8G12 β-arrestin2 Cell Signaling C169 Phospho-Akt Cell Signaling 193H12 Akt Cell Signaling Actin MBL 61 Ki67-FITC B-Pharmingen B56 Cyclin A-FITC B-Pharmingen BF683 Cyclin B1-FITC B-Pharmingen GNS-1 Cyclin 1-FITC B-Pharmingen G Cyclin 3-FITC B-Pharmingen G IgG1 B Biosciences MOPC-21 IgG2a R&Systems IgG1-PE B Biosciences MOPC-31C IgG1-Percp B Biosciences X40 IgG2a-FITC Immunotech U7.27 IgG2a-PE B Biosciences G

7 Table S2 : Primers sequences Name CXCR4 CXCR7 Cyclin1 Cyclin3 CyclinE1 P27 TBP Sequence Forward 5 CCCATCCTCTATGCTTTCCTTG3 Reverse 5 GTCCACCTCGCTTTCCTTTG3 Forward 5 TGCTCCCTCTTCACTCTACTC3 Reverse 5 TCTGGGACGGGTTTACTTGTT3 Forward 5 TTCTTATCCCCTGCCCCTTC3 Reverse 5 CACTCTTGCCACCTCCCTTC3 Forward 5 CCTGGATCGCTACCTGTCTTG3 Reverse 5 CAGCGTGGTCGGTGTAGATG3 Forward 5 CCTGGATGTTGACTGCCTTG3 Reverse 5 TATGTCGCACCACTGATACCC3 Forward 5 AAAGCAACAGAAACCTATCCTCAC3 Reverse 5 AACATTCAAAACTCCCAAGCAC3 Forward 5 TGGTGTTGTGAGAAGATGGATG3 Reverse 5 CCAGATAGCAGCACGGTATGAG3

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar September Assay Portability on the BD FACSVerse System Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar Contents Summary Introduction 3 Objective 4 Methods 6 Results Discussion Conclusions

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

Tag-lite Tachykinin NK1 labeled Cells, ready-to-use (transformed & labeled), 200 tests* (Part# C1TT1NK1)

Tag-lite Tachykinin NK1 labeled Cells, ready-to-use (transformed & labeled), 200 tests* (Part# C1TT1NK1) TAG - L I T E Tag-lite Tachykinin NK1 Receptor Ligand Binding Assay protocol Tachykinin NK1 labeled cells for: 200 tests Part#: C1TT1NK1 Lot#: 03-1 March 2016 (See expiration date on package label) Store

More information

Catalog # Product Size PRIME-XV Hematopoietic Cell Basal XSFM 500 ml (liquid) Additional package sizes are available at request

Catalog # Product Size PRIME-XV Hematopoietic Cell Basal XSFM 500 ml (liquid) Additional package sizes are available at request PRIME-XV HEMATOPOIETIC CELL BASAL XSFM PRIME-XV Hematopoietic Cell Basal XSFM is an optimized xeno- and serum free media recommended for use in the expansion of human hematopoietic cells, including hematopoietic

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

TAG-LITE RECEPTOR LIGAND BINDING ASSAY

TAG-LITE RECEPTOR LIGAND BINDING ASSAY TAG - L I T E TAG-LITE RECEPTOR LIGAND BINDING ASSAY PROTOCOL ASSAY PRINCIPLE The Tag-lite Ligand Binding Assay is a homogeneous alternative to radio ligand binding assays for HTS and compound profiling.

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

BD Mouse Pluripotent Stem Cell Transcription Factor Analysis Kit

BD Mouse Pluripotent Stem Cell Transcription Factor Analysis Kit BD Mouse Pluripotent Stem Cell Transcription Factor Analysis Kit Instruction Manual Catalog No. 560585 ii BD Mouse Pluripotent Stem Cell Transcription Factor Analysis Kit Trademarks Cy is a trademark of

More information

Supplementary File 3: DNA and RNA isolation

Supplementary File 3: DNA and RNA isolation Supplementary File 3: DNA and RNA isolation Q-CROC-02 Biopsy protocol For the purposes of this protocol, four needle core biopsies (NCBs) of lymph node tissue are isolated from each patient using a 16G

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Human Pluripotent Stem Cell Functional Identification Kit

Human Pluripotent Stem Cell Functional Identification Kit Human Pluripotent Stem Cell Functional Identification Kit Catalog Number SC027B Reagents for the identification of human pluripotent stem cells by in vitro functional differentiation. This package insert

More information

RayBio Phospho- Akt (Ser473) ELISA Kit

RayBio Phospho- Akt (Ser473) ELISA Kit RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

ab GFP ELISA Kit Instructions for Use  For the quantitative measurement of GFP protein expression ab117992 GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression This product is for research use only and is not for diagnostic use. intended www.abcam.com Table

More information

TECHNICAL BULLETIN. Catalog Number RAB0012 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0012 Storage Temperature 20 C Phospho-Akt (pser 473 )/pan-akt ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) and pan-akt in cell and tissue lysates Catalog Number RAB0012 Storage Temperature 20 C TECHNICAL

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

QuickTiter Adenovirus Titer ELISA Kit

QuickTiter Adenovirus Titer ELISA Kit Product Manual QuickTiter Adenovirus Titer ELISA Kit Catalog Number VPK-110 2 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Recombinant adenoviruses have tremendous

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

Human TGF-beta1 ELISA

Human TGF-beta1 ELISA K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic

More information

STEMdiff Hematopoietic Kit

STEMdiff Hematopoietic Kit For differentiation of human ES or ips cells into hematopoietic progenitor cells Catalog #05310 1 Kit Product Description Kit includes a defined, serum-free basal medium and supplements for the feeder-free

More information

Regulatory B Cell Isolation Kit mouse

Regulatory B Cell Isolation Kit mouse For further information refer to our website www.miltenyibiotec.com For technical questions, please contact your local subsidiary or distributor. Technical Support Team, Germany: E-mail: macstec@miltenyibiotec.de

More information

ab Cell Viability Assay Kit Fluorometric Dual Green/Red

ab Cell Viability Assay Kit Fluorometric Dual Green/Red ab112121 Cell Viability Assay Kit Fluorometric Dual Green/Red Instructions for Use For detecting cell viability in suspension and adherent cells by using dual proprietary green and red fluorescence probes.

More information

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Characterization of non-olfactory GPCRs in human sperm with a focus on GPR18 Caroline Flegel 1, Felix Vogel 1,5, Adrian Hofreuter 1, Sebastian Wojcik 1, Clara Schoeder 3, Katarzyna

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications

More information

E.Z.N.A. Water DNA Kit. D preps D preps D preps

E.Z.N.A. Water DNA Kit. D preps D preps D preps E.Z.N.A. Water DNA Kit D5525-00 5 preps D5525-01 50 preps D5525-02 200 preps April 2017 E.Z.N.A. Water DNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

****** Competition ELISA Kit Instruction

****** Competition ELISA Kit Instruction FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC PURPOSES ****** Competition ELISA Kit Instruction Kit name and catalog number Your analyte ELISA Kit, Catalog#: ***** Intended use The kit is used to detect the

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

Alt-R CRISPR-Cas9 system:

Alt-R CRISPR-Cas9 system: Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

a Beckman Coulter Life Sciences: White Paper

a Beckman Coulter Life Sciences: White Paper a Beckman Coulter Life Sciences: White Paper Flow Cytometric Analysis of Endothelial Progenitor Cells Authors: Affiliation: Dorota Sadowicz, Vasilis Toxavidis, John Tigges Beth Israel Deaconess Medical

More information

In-Cell Western Kits I and II

In-Cell Western Kits I and II Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp

More information

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:

More information

One-step split GFP staining for sensitive protein detection and localization in mammalian cells

One-step split GFP staining for sensitive protein detection and localization in mammalian cells Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,

More information

Human CNTF ELISA Kit

Human CNTF ELISA Kit Human CNTF ELISA Kit Catalog No. K0331254 Lot No. 31202 Quantity 96 tests Storage 4 C Standard Range 31.25 2000 pg/ml [Important Notice] Please read this User Manual carefully prior to performing the assay.

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Neutrophil/Monocyte Respiratory Burst Assay Kit

Neutrophil/Monocyte Respiratory Burst Assay Kit Neutrophil/Monocyte Respiratory Burst Assay Kit Item No. 601130 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS

More information

E.Z.N.A. Stool DNA Kit. D preps D preps D preps

E.Z.N.A. Stool DNA Kit. D preps D preps D preps E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps April 2013 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage

More information

Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP

Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase Product no: C2-HRP Product Description This monoclonal antibody (Mab) reacts with Asian Sea bass (Lates

More information

Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry

Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Kristie M. Grebe and Terry A. Potter* (Published 10 September

More information

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

TECHNICAL BULLETIN NUCLEI EZ PREP NUCLEI ISOLATION KIT. Product Number NUC-101 Store at 2-8 C

TECHNICAL BULLETIN NUCLEI EZ PREP NUCLEI ISOLATION KIT. Product Number NUC-101 Store at 2-8 C NUCLEI EZ PREP NUCLEI ISOLATION KIT Product Number NUC-101 Store at 2-8 C TECHNICAL BULLETIN Product Description Sigma s Nuclei EZ Prep Kit is designed for the rapid isolation of nuclei from mammalian

More information

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab) Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with

More information

Quantos Cell Proliferation Assay Kit

Quantos Cell Proliferation Assay Kit Quantos Cell Proliferation Assay Kit INSTRUCTION MANUAL Catalog #302011 Revision #041001a For In Vitro Use Only *302011-12_041001a/* LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement

More information

E.Z.N.A. Stool DNA Kit. D preps D preps D preps

E.Z.N.A. Stool DNA Kit. D preps D preps D preps E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps July 2017 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO

More information

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro

More information

HUMAN ENDOTHELIAL- CELL SPECIFIC MOLECULE- 1 (ESM-1) ELISA KIT

HUMAN ENDOTHELIAL- CELL SPECIFIC MOLECULE- 1 (ESM-1) ELISA KIT PAGE 1 HUMAN ENDOTHELIAL- CELL SPECIFIC MOLECULE- 1 (ESM-1) ELISA KIT FOR THE QUANTITATIVE DETERMINATION OF HUMAN ESM-1 CONCENTRATIONS IN SERUM AND EDTA PLASMA ALWAYS REFER TO LOT SPECIFIC PROTCOL PROVIDED

More information

ab VEGF Receptor 2 Human ELISA Kit

ab VEGF Receptor 2 Human ELISA Kit ab100665 VEGF Receptor 2 Human ELISA Kit Instructions for Use For the quantitative measurement Human VEGF Receptor 2 in serum, plasma and cell culture supernatants. This product is for research use only

More information

QuickExtract RNA Extraction Kit

QuickExtract RNA Extraction Kit Cat. Nos. QER09015 and QER090150 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 299 12/2012 1

More information

Myers Lab ChIP-seq Protocol v Modified January 10, 2014

Myers Lab ChIP-seq Protocol v Modified January 10, 2014 Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Mouse ICAM-1 / CD54 ELISA Pair Set

Mouse ICAM-1 / CD54 ELISA Pair Set Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General

More information

Phagocytosis Assay Kit (IgG FITC)

Phagocytosis Assay Kit (IgG FITC) Phagocytosis Assay Kit (IgG FITC) Item No. 500290 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

MagniSort Mouse CD3 Positive Selection Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse CD3 Positive Selection Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse CD3 Positive Selection Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse splenocytes were unsorted (left) or sorted with the MagniSort Mouse CD3 Positive

More information

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table

More information

Supporting Information

Supporting Information Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the

More information

ab IL-1 alpha (Interleukin-1 alpha) Human ELISA Kit

ab IL-1 alpha (Interleukin-1 alpha) Human ELISA Kit ab100560 IL-1 alpha (Interleukin-1 alpha) Human ELISA Kit Instructions for Use For the quantitative measurement of Human IL-1 alpha in serum, plasma, and cell culture supernatants. This product is for

More information

Store samples to be assayed within 24 hours at 2-8 C. For long-term storage, aliquot and freeze samples at -20 C. Avoid repeated freeze-thaw cycles.

Store samples to be assayed within 24 hours at 2-8 C. For long-term storage, aliquot and freeze samples at -20 C. Avoid repeated freeze-thaw cycles. Human Retinol Binding Protein 4, RBP4 ELISA Kit Preparation Plate Washing Discard the solution in the plate without touching the side walls. Blot the plate onto paper towels or other absorbent material.

More information

ab99978 BDNF Human ELISA Kit

ab99978 BDNF Human ELISA Kit ab99978 BDNF Human ELISA Kit Instructions for Use For the quantitative measurement of Human BDNF in serum, plasma, and cell culture supernatants. This product is for research use only and is not intended

More information

ab TNF alpha Human ELISA Kit

ab TNF alpha Human ELISA Kit ab100654 TNF alpha Human ELISA Kit Instructions for Use For the quantitative measurement of Human TNF alpha in serum, plasma and cell culture supernatants. (Human TNF alpha concentration is pretty low

More information

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11 Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED

More information

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,

More information

PURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis

PURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis LABORATORY PROCEDURE: IMMUNOPHENOTYPING: Lymphocyte Staining for FACS Analysis Date: April 29 2014 Authors: Jennifer Hossler PURPOSE: To delineate the subsets of human lymphocytes based on the expression

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay -PLEX Immunogenicity Assay Application Note 1 Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay The use of biotherapeutics, biosimilars, and combination biotherapies

More information

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse Hematopoietic Lineage Depletion Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse bone marrow cells were unsorted (top row) or sorted with the MagniSort

More information

Standard Operating Procedure

Standard Operating Procedure Standard Operating Procedure Title Subtitle NANoREG Work package/task: Owner and co-owner(s) Date finalised Document name Key words: Standard Operating Procedure (SOP) for TaqMan realtime Reverse Transcription

More information

Protocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System

Protocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System Luciferase Assay System Protocol High-throughput Transfection Protocol for GoClone Reporter Assays LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow promoter luciferase Step 1: Simultaneously

More information

ab Beta Galactosidase Detection Kit (Fluorometric) Instructions for Use For monitoring β-galactosidase activity in cells.

ab Beta Galactosidase Detection Kit (Fluorometric) Instructions for Use For monitoring β-galactosidase activity in cells. ab176721 Beta Galactosidase Detection Kit (Fluorometric) Instructions for Use For monitoring β-galactosidase activity in cells. This product is for research use only and is not intended for diagnostic

More information

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information