Ben- Shahar Lab CRISPR/RMCE Protocol May 2015

Transcription

1 Ben- Shahar Lab CRISPR/RMCE Protocol May Before you begin a. Useful CRISPR overview for beginners: b. This protocol combines techniques described in these 2 papers: i. Zhang X, Koolhaas WH, Schnorrer F. A Versatile Two-Step CRISPR- and RMCE-Based Strategy for Efficient Genome Engineering in Drosophila. G3 (Bethesda) Oct 15;4(12): doi: /g PubMed PMID: *This protocol describes the 2 step process used here. In the first step, sgrnas flanking a genomic region of interest mediate the targeted insertion of a cassette containing attp sites for recombination in step 2, and dsred expressed under the eye-specific promoter P3 for easy screening. In the second step, the previously inserted attp sites ate used for targeted recombinase-mediated cassette exchange (RMCE), a high efficiency step for insertion of your sequence of choice. Here, recombination replaces the dsred sequence, allowing screening for the lack of dsred expression. This protocol is especially useful for making multiple transgenic lines with manipulations in the same genetic region. STEP 1: ii. Gokcezade J, Sienski G, Duchek P. Efficient CRISPR/Cas9 Plasmids for Rapid and Versatile Genome Editing in Drosophila. G3 (Bethesda) Sep 17;4(11): doi: /g PubMed PMID: ; PubMed Central PMCID: PMC *This protocol describes the use of a readily available plasmid from which both sgrnas and Cas9 can be produced in vivo. This allows for injection into any fly strain, rather than requiring a line that transgenically expresses Cas9. 2. Design oligos a. sgrna target sequences i. 20 nucleotide sequence from genomic region of interest that is adjacent to PAM site (NGG). Make sure to not include PAM site in ordered oligos (even though this is included in the target sequences displayed when using some online tools). ii. Design sgrna target sequences flanking a targeted genomic region (2 sgrna sites). As in Zhang et al. 2014, we have targeted up to ~1 kb region, and are currently planning to try targeting larger regions. We have had success using multiple sgrnas simultaneously (2 for each site, 4 in total). For this design, sgrnas should be located in or within 10 base pairs of introns. A useful website for finding sgrna template sequences in introns is here: iii. Each sgrna target sequence will be ligated into the pdcc6 vector (which encodes Cas9, and allows in vivo transcription of sgrnas; available from addgene #59985). The pdcc6 vector will be cut with BbsI for ligation of sgrna sequences, so to make this ligation easy, include appropriate overhangs when ordering sgrna template oligos. (Look at Gokcezade et al., 2014, Figure 1)

2 iv. Oligo design 5 CTTCGNNNNNNNNNNNNNN CNNNNNNNNNNNNNNCAAA 3 (CTTC and CAAA are complimentary to the overhangs created from BbsI digest of pdcc6 vector, G and complimentary C are needed for RNA Pol III to transcribe sgrna, N s = sgrna target sequence and compliment) v. For each sgrna, order 2 oligos (with overhangs shown in step iv). These will be annealed and inserted into the pdcc6 vector. b. Homology arms i. should be approx. 1 Kb in length. The end of the homology arm should ideally be within 10 bps of the sgrna target sequence. Make sure the sgrna and adjacent PAM sequence are not included in the homology arms, otherwise Cas9 can cut the homology arm plasmid. Make sure homology arms are designed so that the break point for insertion of the dsred construct does not disrupt exon sequence (or splice donor/acceptor sites- the two base pairs within introns that are adjacent to exon sequences). In your final transgenic line, extra sequence will be left at these breakpoints. ii. Homology arms will be cloned into a plasmid using a golden gate reaction. (Helpful overview if you are unfamiliar with this technique and- synthetic- biology/gene- assembly/golden- gate- assembly) iii. Golden Gate cloning design: 1. GGAC left homology arm left homology arm GGTC 2. CCAG dsred construct dsred construct ACAA 3. TGTT right homology arm right homology arm GCAT 4. CGTA pxz13 backbone pxz13 backbone CCTG

3 Final plasmid all together will look like this: i. Plasmids: a. pjet1.2- STOP- dsred construct is available from addgene (plasmid #60944) b. pxz13 backbone from addgene (pbs- GGAC- ATGC, plasmid #60949) ii. Oligos for homology arm cloning should be designed to include both: a. primer sequence to clone the homology arm b. BsmbI site + appropriate overhang for golden gate cloning iii. Homology Arm Oligo templates: a. Left homology arm forward primer: cacaccacgtctcaggacnnnnnnnnnnnnnnnnnnnn b. Left homology arm reverse primer: cacaccacgtctcactggnnnnnnnnnnnnnnnnnnnn c. Right homology arm forward primer: cacaccacgtctcatgttnnnnnnnnnnnnnnnnnnnn d. Right homology arm reverse primer: cacaccacgtctcagcatnnnnnnnnnnnnnnnnnnnn (BsbmBI site, Overhang sequence, N s = your specific PCR primer sequence) 3. Insert sgrna template oligos into pddc6 plasmid a. Phosphorylate sgrna template oligos i..5 ul of 100uM oligo (50 pmol) ii. 2 ul 10x T4PK buffer (thermos scientific T4PK Buffer A) iii. 2 ul 10 mm ATP (not included in buffer) iv. 1 ul T4 Polynucleotide Kinase v ul H20 vi. 20 ul total

4 vii. Incubate at 37 degrees of 20 minutes, then 75 degrees for 10 mins (for heat inactivation of T4PK) b. Anneal oligos for sgrna template i. 10 ul of each phosphorylation rxn for complimentary oligos ii..5 ul T4 ligase buffer iii. 4.5 ul H2O iv. 25 ul total v. Annealing reaction- in the PCR machine: degrees for 5 mins 2. Cycle: start at 95 degrees for 1 minute, each cycle decrease 1 degree for 70 cycles 3. 4 degree hold vi. Alternatively, the annealing reaction can be done in a heat block (or water bath), by incubating for 10 mins at 85, then turn off heat, and leave tubes while heat block cools (for 30 mins- 1 hr) vii. Estimated concentration should be ~ 9.24 ng/ul (calculated using Promega biomath pmol to ug calculator) viii. Add 225 ul of water to each sample for total of 250 ul, and approx. concentration.924 ng/ul c. Digest pdcc6 plasmid with BbsI i. 15 ul miniprep ii. 5 ul BbsI enzyme (this enzyme is stored at - 80) iii. 5 ul NEBuffer 2.1 iv. 25 ul H20 v. Total 50 ul rxn vi. Incubate at 37 degrees (2-4 hrs), then 65 degrees for 20 mins (heat inactivation of BbsI). vii. Add 1 ul CIP for dephosphorylation, incubate 37 degrees 1 hr. viii. Run on 1% gel and cut out band, gel digest. d. Ligation i. NEBio Ligation Calculator is helpful ii. set up 20 ul reactions using T4 DNA ligase and buffer iii. 1:3 and 1:5 vector:insert ratios both worked well, using ng of vector iv. Recommended rxn: ul pdcc6-1 vector (70 ng) ul annealed oligos (1.335 ng) (5:1 ratio) 3. 2 ul T4 ligase buffer 4. 1 ul T4 ligase enzyme ul H2O ul total rxn volume v. PCR machine: 22 degrees 1 hr, 70 degrees 5 mins. e. Transformation

5 i. 5 ul ligation reaction + 50 ul TOP 10 cells ii. Ice 30 mins, 42 degrees 30 sec, ice 5 mins, add 950 ul room temp SOC along with cells into culture tube, shake for 1 hr. Plate 30 ul. (all plasmids are amp resistant, plate with amp or carb) f. Miniprep and check sequence using pdcc6 5 sequencing primer (144 base pairs upstream of BsbI sites): CGAACTGTGTTTTCAACAAACG i. Make sure the sgrna is sequence is correct. Make sure the TTTT following sgrna sequence is intact (this is the stop sequence for Pol III). 4. Clone Homology Arms a. Obtain DNA template to clone homology arms (ideally this should be the strain you plan to inject into to make your crispr transgenic fly). Use a DNA isolation protocol. b. For PCR reaction, use a high fidelity polymerase. Blunt ends are needed to insert into pjet vector (or you can do a blunting rxn). c. Each rxn: i. 2.5 ul accuprime mix ii. 1.5 ul 10 um primer mix (4 ul of each primer 100 um + 32 ul H2O) iii..5 ul DNA template (~200 ng/ul) iv..4 ul accuprime enzyme v ul H2O vi. 25 ul total d. PCR reaction i. 95 degrees 2 mins ii. 35 cycles: degrees 15 sec degrees 30 sec (for primer Tm s 74-75, adjust accordingly) degrees 1 min, 20 secs (for PCR products ~ 1 kb) iii. 68 degrees 5 mins iv. 4 degrees v. Troubleshooting suggestions for more difficult primer pairs: 200 ng template DNA, 1 ul accuprime enzyme, lower annealing temp (try a gradient PCR reaction), and/or.8 ul MgSO4 per rxn. e. Gel extract (if multiple bands) or PCR cleanup (if single, clean band) 5. Insert Homology Arms into pjet vector a. Or any other vector should work. We use clonejet PCR cloning kit from life technologies (K1231) b. Set up ligation rxn on ice: i. 10 ul 2x rxn buffer (comes with pjet kit) ii. 25 ng PCR insert iii. 25 ng pjet1.2 cloning vector (.5 ul) iv. 1 ul T4 DNA ligase

6 v. 8 ul H2O vi. 20 ul total c. Incubate at room temp for 10 mins. d. Transform 2.5 ul (as above), miniprep and check sequences. *Alternatively, you can skip step 5, and the PCR reaction product from 4 can be used for the golden gate reaction in Step 6. We ve had almost 100% success rate including step 5, about 50% success skipping step Engineer plasmid containing DSRed reporter in between homology arms a. Golden Gate reaction i. 50 ng backbone (pxz13) ii. 80 ng pjet1.2- STOP- dsred iii. 80 ng homology arm left iv. 80 ng homology arm right v. 1.5 ul 10x T4 Ligase Buffer vi. 1 ul T4 Ligase Enzyme vii. 1 ul BsmBI viii. Water to 15 ul total volume ix. (Note: thermoscientific T4 DNA ligase and buffer with NEB BsmBI enzyme works fine.) x. Protocol: cycles: 37 degrees for 15 mins, 16 degrees for 10 mins degrees for 15 mins degrees for 5 mins degrees for 5 mins 5. 4 degree hold b. Transform 5 ul of golden gate reaction 7. Prepare plasmids for injection Suggested final concentrations of plasmids are ng/ul for pdcc6 plasmids with sgrna template insert, and 500 ng/ul for the DSRed plasmid resulting from golden gate reaction. It is recommended that total concentration of injection mixture remains at or below 1000 ng/ul 8. Screening Flies Injected flies should be individually crossed to a balancer line for the appropriate chromosome. Collect the offspring of these crosses (F1), and screen for fluorescent red eyes. Those that are positive should be considered separate lines. Each should be crossed to the balancer line. PCR screen offspring to confirm insertion location of transgene.

7 STEP 2: In the second step, the inserted attp sites will be used for targeted recombinase- mediated cassette exchange (RMCE) as in Zhang et al., The attb plasmid used here is available from the Drosophila Genomics Resource Center (DGRC). pbs- KS- attb1-2- PT- SA- SD- 0, stock #1297, originally from Hugo Bellen, Baylor College of Medicine. 2. Order double stranded DNA for insertion a. Double stranded DNA up to 2 kb can be ordered as a gblock from IDT. Design gblock for easy insertion into attb plasmid, with XBaI site at the beginning, and HindIII site at the end. 3. Insert double stranded DNA into attb plasmid a. Double digest both attb plasmid and ordered gblock with XBaI and HindIII. b. Gel extraction c. Ligation reaction d. Transformation e. Miniprep and check sequence 4. Plasmids for injections: Inject a cocktail of engineered attb plasmid (150 ng/ul), and vasa ΦC31 plasmid (200 ng/ul) (addgene plasmid #60948 p3xp3- EGFP.vas- int.nls) into embryos from transgenic line developed in Step Screening Flies Collect and cross flies as for Step 1. Screen F1 flies for those lacking dsred expression. Questions? Feel free to alexis.s.hill@wustl.edu