SIBC 512: Real-time PCR. Assistant Professor Chatchawan Srisawat MD. Ph.D
|
|
- Gary Norris
- 6 years ago
- Views:
Transcription
1 SIBC 512: Real-time PCR Assistant Professor Chatchawan Srisawat MD. Ph.D
2 REAL-TIME QUANTITATIVE PCR In many applications, accurate quantitation of the number or amount of the interesting gene or its products present in the specimens are desirable. e.g. - Gene expression analysis -> level of gene expression - Diagnostics -> The ability to determine the amount of pathogens or copy number of oncogenes or diseased genes could be used to indicate the disease severity.
3 REAL-TIME QUANTITATIVE PCR Based on the principle of PCR, the amount of PCR products can indirectly reflect the starting copy number of the DNA template if PCR starts with N template copies, the yield will be ~ N2 n. If the PCR amplifcation is done for a fixed cycle number (e.g. 20 or 30) and the PCR products are analyzed on agarose gel, the intensity of the bands generally correlates with the amount of the starting DNA templates. (End point analysis)
4 REAL-TIME QUANTITATIVE PCR Difficulties associated with the end-point analysis included: (i) quantitation must be done when the amplification is within the log phase where the PCR product is directly proportional to the starting copy number. not easy to tell becuase the PCR products are not continously monitored. (ii) The usual method to detect the product once linear amplification was achieved (e.g. electrophoresis, southern blot, etc) is tedious and timecomsuming.
5 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Real-time PCR or quantitative PCR (qpcr) is a recently developed technique (1996) and has been increasingly popular for PCR product quantitation. It avoid the drawbacks of the previously-mentioned PCR quantiation. a) PCR products are monitored continously (or in real-time) to make sure the amplication is in the log phase. End-point analysis Real-time analysis b) PCR products can be easily detected from the PCR tubes by the real-time PCR machine (not a regular PCR machine). Detection of up to 384 reactions in less than a minute
6 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR SYBR green Pros: simple, no need to design the probes Cons: unable to differentiate signals from non-specific products unable to do multiplex PCR
7 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Principle of SyBr green.flv
8 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Fluorescence Energy Resonance Transfer (FRET) Reporter Quencher PCR primer No signals Hydrolysis or Taqman probes 5-3 exonuclease activity of Taq The increase in fluorescence measured cycle by cycle is a direct consequence of the amplification process.
9 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR The signals are detected every cycle by real-time PCR instruments. Stratagene MX3005P.flv
10 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Stratagene MX3005P.flv
11 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR The signals are detected every cycle by real-time PCR instruments. Real-time PCR instruments enable detection of PCR products in the linear phase. No subsequent detection is required.
12 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Ct (threshold cycle) within the log phase is determined. X t = X 0 2 Ct log 2 [X t ] = log 2 [X 0 ] + Ct [Ct] = log 2 [X t ] log 2 [X 0 ] [Ct] = K log 2 [X 0 ] X t = number of copies at threshold cycle X 0 = starting tempate (cycle 0)
13 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR [Ct] = K log 2 [X 0 ] [Ct] = K 3.32log[X 0 ] A log plot of Ct and copy number Unknown samples can be quantitated using a standard curve to obtain the number of copies in the sample.
14 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Absolute vs. Relative quantitation Absolute quantitation e.g. number of c-myc mrna 2500 copies/cells, viral load in the blood 400 copies/ml of blood Require standard curve preparation Relative quantitation In some situations, it may be unnecessary to determine the absolute transcript copy number and reporting the relative change will suffice. e.g. - The expression of c-myc is 3.5-fold higher in cancer compared with normal tissues. - The level of COL1A1 mrna in sirna-treated fibroblasts is 1% of that in untreated fibroblasts.
15 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Relative quantitation e.g. - The expression of MYC is 3.5-fold higher in cancer compared with normal tissues. Technical terms to know before getting started. - Gene of interest (GOI) -> MYC - Calibrator = control samples (e.g. normal tissues, cells from Day 0 or untreated cells, control sirna-treated group). The level of expression calibrator is set at 1 (or 100%). -Unknown = experiment or unknown samples (e.g. cancer tissues, cells at various interavals after treatment, Gene-specific sirna) Relative expression of MYC = Level of MYC in unknown Level of MYC in calibrator e.g. Ct of MYC in unknown and calibrator = 25 and 27 cycles
16 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Relative quantitation e.g. - The expression of MYC is 3.5-fold higher in cancer compared with normal tissues. - Generally, the level of GOI is normalized with the level of an endogenous reference gene or normalizing gene, e.g. housekeeping genes, whose expression is relatively constant in various tissues and conditions. - This approach provides a method for correcting results for differing amounts of input RNA. - This is particularly attractive when it is not practical to measure the amount of input RNA by other methods. Such situations include when only limited amounts of RNA are available or when high-throughput processing of many samples is desired. Example of normalizing gene Actin, GAPDH, Tubulin, Aldolase A
17 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Relative quantitation e.g. - The expression of MYC is 3.5-fold higher in cancer compared with normal tissues. If GAPDH is used as a normalizing gene, Relative expression of MYC/GAPDH in calibrator = Level of MYC in calibrator Level of GAPDH in calibrator Relative expression of MYC/GAPDH in unknown = Level of MYC in unknown Level of GAPDH in unknown Eq.1 Eq.2 Relative expression of MYC in unknown compared with calibrator = Eq.2 Eq.1
18 EXPERIMENTAL PROCEDURES See the handout
19 EXPERIMENTAL PROCEDURES Divide into 4 groups ( a group of ~ 4 students) To prepare master mix, Group 1 & 2 each group prepares the assay reactions of beta-actin and GAPDH (e.g. 1A actin, 1B GAPDH). * The students working with real-time PCR experiments must know how to use automatic pipette accurately because real-time quantiation is a sensitive quantitative assay.
20 EXPERIMENTAL PROCEDURES Divide into 4 groups ( a group of ~ 4 students) To prepare master mix, Group 3 & 4 each group prepares the standard curve to determine the amplification efficiency (e.g. 3A- actin, 3B GAPDH)
21 EXPERIMENTAL PROCEDURES Please read the following reference paper before class tomorrow. Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2- Ct Method. METHODS 25, (2001) doi: /meth ). Click to download the paper.
22 2 nd session
23 DISCUSSION Analysis of real-time PCR data Gene of interest or target gene = level of Actin Normalizing (reference) gene = GAPDH Unknown or test or experiment group = treated cells at day 3 and 7 Calibrator or control group = untreated cells at day 0 If GAPDH is used as a normalizing gene, Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown Level of GAPDH in unknown Relative expression of Actin/GAPDH in calibrator = Level of Actin in calibrator Level of GAPDH in calibrator Eq.1 Eq.2 Relative expression of Actin in unknown compared with calibrator = Eq.1 Eq.2
24 DISCUSSION Analysis of real-time PCR data Let A, G = copies number of Actin and GAPDH respectively C T = threshold cycle, cb = calibrator, unk = unknown Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown Level of GAPDH in unknown Eq.1 X n = X 0 * 2 n A CT-A,unk = A unk * 2 C T-A,unk G CT-G,unk = G unk * 2 C T-G,unk Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown = A unk Level of GAPDH in unknown G unk
25 DISCUSSION Analysis of real-time PCR data Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown = A unk Level of GAPDH in unknown G unk A unk = A CT-A,unk G unk = G CT-G,unk 2 C T-A,unk 2 C T-G,unk A CT-A,unk A unk = 2 C T-A,unk A CT-A,unk x 2 C T-G,unk G unk G CT-G,unk G CT-G,unk x 2 C T-A,unk 2 C T-G,unk A CT-A,unk x 2 (C T-G,unk - CT-A,unk) G CT-G,unk
26 DISCUSSION Analysis of real-time PCR data Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown = A unk Level of GAPDH in unknown G unk A unk = A CT-A,unk x 2 (C T-G,unk - CT-A,unk) G unk G CT-G,unk A CT-A,unk x 2 - (C T-A,unk - CT-G,unk) G CT-G,unk A CT-A,unk x 2 - C T,unk G CT-G,unk
27 DISCUSSION Analysis of real-time PCR data The same calculation is applied in the case of calibrator. Relative expression of Actin/GAPDH in calibrator = Level of Actin in calibrator = A cb Level of GAPDH in calibrator G cb A cb = A CT-A,cb x 2 - C T,cb G cb G CT-G,cb
28 DISCUSSION Analysis of real-time PCR data Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown Level of GAPDH in unknown Relative expression of Actin/GAPDH in calibrator = Level of Actin in calibrator Level of GAPDH in calibrator Eq.1 Eq.2 Relative expression of Actin in unknown compared with calibrator = Eq.1 Eq.2 A CT-A,unk x 2 - C T,unk A unk G unk = G CT-G,unk A cb A CT-A,cb x 2 - C T,cb G cb G CT-G,cb
29 DISCUSSION Analysis of real-time PCR data C T threshold cycle = the cycle number at which the amount of amplified target reaches a fixed threshold. GAPDH cb actin unk GAPDH unk actin cb GAPDH actin At threshold cycles Level of actin in calibrator at C T Level of GAPDH in calibrator at C T = Level of actin in unknown at C T Level of GAPDH in unknown at C T
30 DISCUSSION Analysis of real-time PCR data A unk A CT-A,unk x 2 - C T,unk G unk = G CT-G,unk A cb A CT-A,cb x 2 - C T,cb G cb G CT-G,cb = 2 - C T,unk 2 - C T,cb = 2 -( C T,unk - CT,cb) = 2 - C T
31 DISCUSSION Analysis of real-time PCR data Relative expression of actin/gapdh in unknown = Level of actin in unknown A cb Level of GAPDH in unknown G cb Relative expression of actin/gapdh in calibrator = Level of actin in calibrator A unk Level of GAPDH in calibrator G 0,unk Eq.1 Eq.2 Relative expression of actin in unknown compared with calibrator = Eq.1 = Eq.2 A unk G unk A cb G cb = 2 - C T CT = -( CT,unk - CT,cb)
32 DISCUSSION Analysis of real-time PCR data Xn = the number of target copies at cycle n of PCR X0 = starting number of target copies. EX = the efficiency of target amplification n = the number of PCR cycles. If the efficiency of PCR amplification of this gene is 100%, the (1+Ex) is 2. X n = X 0 * 2 n
33 DISCUSSION Analysis of real-time PCR data Calculate relative expression of actin in the treated cells at day 3, and day 7 compared with the untreated control cells at day 0. After you finish calculatin, then compare with the results calculated by the software.
34 DISCUSSION Analysis of real-time PCR data Approximation method assume that amplification efficiencies of both genes are equal and close to 100%, which might not be true in some instances. The amplification efficiency can be calculated from the standard curve of serially-diluted samples. MX Pro software can let the researchers to change the amplification efficiencies to get more accurate quantitation.
35 DISCUSSION Analysis of real-time PCR data Tutorial videos Real Time QPCR Data Analysis Tutorial part I.flv Real Time QPCR Data Analysis Tutorial part II.flv
36 DISCUSSION Dissociation curve movie Dissociation curve results Primers used in the experiment GAPDH_Forward GAPDH_Reverse ACTIN_Forward ACTIN_Reverse Sequence (5 ->3 ) CAG CCT CAA GAT CAT CAG CA CAT GAG TCC TTC CAC GAT AC TCA CCC ACA CTG TGC CCA TCT ACG A CAG CGG AAC CGC TCA TTG CCA ATG G Product (bp) Calculated Product Tm
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationEvent-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Soybean Line A2704-12 Using Real-time PCR Protocol 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer Protection Biotechnology
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationReal-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation
Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationProtocol T45 Community Reference Laboratory for GM Food and Feed
EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationEvent-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR Protocol 10 June 2008 Joint Research Centre Institute for Health and Consumer Protection Biotechnology & GMOs Unit
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationQuantitative Real-Time RT-PCR
Quantitative Real-Time RT-PCR A Very Short Course Gregory L. Shipley, Ph.D. Department of Integrative Biology & Pharmacology University of Texas Health Science Center - Houston Houston, Texas I. Assay
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationPolymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr
Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase
More informationEvent-specific Method for the Quantification of Soybean CV127 Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR Protocol 20 September 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics
More informationUser Bulletin. ABI PRISM 7000 Sequence Detection System DRAFT. SUBJECT: Software Upgrade from Version 1.0 to 1.1. Version 1.
User Bulletin ABI PRISM 7000 Sequence Detection System 9/15/03 SUBJECT: Software Upgrade from Version 1.0 to 1.1 The ABI PRISM 7000 Sequence Detection System version 1.1 software is a free upgrade. Also
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationEvent-specific Method for the Quantification of Maize VCO Using Real-time PCR. Validated Method
EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Maize VCO-01981-5 Using Real-time
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationSupplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the
Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More informationAmoyDx TM JAK2 V617F Mutation Detection Kit
AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background
More informationReal-Time PCR: Practical Issues and Troubleshooting Mehmet Tevfik DORAK, MD PhD
Real-Time PCR: Practical Issues and Troubleshooting Mehmet Tevfik DORAK, MD PhD Dept of Environmental & Occupational Health Robert Stempel College of Public Health and Social Work Florida International
More informationCustom Assay Development Process
Custom Assay Development Process Unravelling DNA to Enable Your Discovery Ben Jackson PhD Global Marketing Manager
More informationContents.
Contents... 3 Introduction....3 Overview of real-time PCR...4 Overview of qpcr and qrt-pcr components...5 Real-time PCR analysis terminology...8 Real-time PCR fluorescence detection systems...14 Melting
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationGene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More informationChapter 13 Chromatin Structure and its Effects on Transcription
Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationLightCycler 480 qpcr Tools. Meeting the Challenge of Your Research
LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing
More informationAmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instruction for Use For Research Use Only Instruction Version: B2.6 Revision Date: October 2013 Store at -20±5 Xiamen,
More informationUser Bulletin #2. ABI PRISM 7700 Sequence Detection System. Introduction. Contents. December 11, 1997
User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be performed to standardize
More informationBoost Your Real-Time Results
Boost Your Real-Time Results Refresh your knowledge of the fundamentals of real-time PCR Sample & Assay Technologies 1 Introduction Real-time PCR and RT-PCR are highly sensitive techniques that enable
More informationCopy number standard curve. for absolute quantification by real-time PCR
Copy number standard curve for absolute quantification by real-time PCR Kit contents Positive control template for standard curve (RED) Template preparation buffer (YELLOW) RNase/DNase free water (WHITE)
More informationAmoyDx TM PIK3CA Five Mutations Detection Kit
AmoyDx TM PIK3CA Five Mutations Detection Kit Detection of five mutations in PIK3CA gene Instructions For Use Instructions Version: B1.3 Date of Revision: April 2012 Store at -20±2 1/5 Background Phosphatidylinositol
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationDetection and quantification of hepatitis E virus by real-time reverse transcriptase PCR
Page 1 of 6 EU FP VII PROJECT VITAL STANDARD OPERATING Detection and quantification of hepatitis E virus by real-time reverse transcriptase PCR CREATED: REVISED: APPROVED: David Rodríguez Lázaro: 18-2-2010
More informationAmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use For Research Use Only and For Reference Only Instructions Version: B1.2 Date of Revision: June 2016
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationMolecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges.
Dr. Angela Cicatelli acicatelli@unisa.it Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges. 1st Workshop on "Risk prognosis of environmental
More informationStratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationThermo Scientific DyNAmo Probe qpcr Kit
PRODUCT INFORMATION Thermo Scientific DyNAmo Probe qpcr Kit #F-450L Lot Store F at -20 C Expiry Date _ www.thermoscientific.com/onebio Rev. 2 f 2 COMPONENTS OF THE KIT Contents COMPONENTS OF THE KIT...
More informationSYBR Real-Time PCR Kit
SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationSynthetic sirna Quantitation Core Kit
Cat. # 6142 For Research Use Synthetic sirna Quantitation Core Kit Product Manual v201010da Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 4 IV.
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationRT 2 Profiler PCR Array: Web-based data analysis tutorial
RT 2 Profiler PCR Array: Web-based data analysis tutorial.questions? Comments? or Suggestions?.Ask now or contact Technical Support.M F, 9 AM 6 PM EST..Telephone: 888-503-3187;.Email: support@sabiosciences.com.international
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationUse of BHQplus Probes to Optimize Multiplex Competitive qrt-pcr in Diagnostics. Dr. James C. Willey Chief Medical Advisor Accugenomics, Inc.
Use of BHQplus Probes to Optimize Multiplex Competitive qrt-pcr in Diagnostics Dr. James C. Willey Chief Medical Advisor Accugenomics, Inc. Professor, Medicine and Pathology University of Toledo College
More informationRelative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)
The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationApplication Note Detecting low copy numbers. Introduction. Methods A08-005B
Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template
More informationOptimize Your qpcr and RT-qPCR Assays with Careful Planning and Design
Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Nadine Nassif, January 2013 Outline Real-Time PCR overview / Understanding qpcr data qpcr detection strategies: dye-based versus label-based
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationRetro-X qrt-pcr Titration Kit. User Manual. User Manual. Catalog No PT (091613)
User Manual Retro-X qrt-pcr Titration Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc. A Takara
More informationReal-Time PCR ABI Prism 7500 (PSC 563, NSC 338) Real-Time PCR StepOne (PSC 563)
Real-Time PCR ABI Prism 7500 (PSC 563, NSC 338) Real-Time PCR StepOne (PSC 563) Every time you use any of the qpcr instruments, you MUST sign the log book. Use Lab Commander to reserve a time. Each instrument
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationHELINI White spot Syndrome virus [WSSV] Real-time PCR Kit
HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationBrilliant II SYBR Green QPCR Master Mix
Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationPCR Array FAQ s. PCR Arrays: Placing an order
PCR Array FAQ s PCR Arrays: Placing an order What PCR Array services does the facility provide? The DNA Analysis Facility provides support for gene expression studies using PCR Array technology from a
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationStratagene QPCR Human Reference Total RNA
Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationUser Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR
User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data
More informationBLOOD, PLASMA & SERUM SAMPLE PREPARATION
BLOOD, PLASMA & SERUM SAMPLE PREPARATION The New Standard in RNA Purification, Best-in-Class, Pure & Simple Collection, preservation & isolation of inhibitor-free RNA, microrna and genomic DNA for any
More informationCASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist
CASE-STUDY- VALIDATION of PCR based methodology Beata Surmacz-Cordle Senior Analytical Development Scientist UK RMP Pluripotent Stem Cell Platform Validation Workshop 2 nd June 2016 RT-qPCR assay for detection
More informationPrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
More informationSupplemental Data. Distinct Pathways for snorna and mrna Termination
Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A
More informationReal-Time PCR Validations
Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed
More informationMOLECULAR CLONING AND SEQUENCING OF FISH MPR 46
MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 INTRODUCTION The mammalian MPR 46 (human, mouse, bovine) sequences show extensive homologies. Among the non-mammalian vertebrates, only a partial sequence
More informationHUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)
HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR
More informationQuantitative PCR Systems
QUANTITATIVE PCR Quantitative PCR Systems Our QPCR systems meet your current research needs, offer flexibility for future research goals, and match your budget. HIGH-PERFORMANCE Mx3005P System FULL-FEATURED
More information