SIBC 512: Real-time PCR. Assistant Professor Chatchawan Srisawat MD. Ph.D

Size: px
Start display at page:

Download "SIBC 512: Real-time PCR. Assistant Professor Chatchawan Srisawat MD. Ph.D"

Transcription

1 SIBC 512: Real-time PCR Assistant Professor Chatchawan Srisawat MD. Ph.D

2 REAL-TIME QUANTITATIVE PCR In many applications, accurate quantitation of the number or amount of the interesting gene or its products present in the specimens are desirable. e.g. - Gene expression analysis -> level of gene expression - Diagnostics -> The ability to determine the amount of pathogens or copy number of oncogenes or diseased genes could be used to indicate the disease severity.

3 REAL-TIME QUANTITATIVE PCR Based on the principle of PCR, the amount of PCR products can indirectly reflect the starting copy number of the DNA template if PCR starts with N template copies, the yield will be ~ N2 n. If the PCR amplifcation is done for a fixed cycle number (e.g. 20 or 30) and the PCR products are analyzed on agarose gel, the intensity of the bands generally correlates with the amount of the starting DNA templates. (End point analysis)

4 REAL-TIME QUANTITATIVE PCR Difficulties associated with the end-point analysis included: (i) quantitation must be done when the amplification is within the log phase where the PCR product is directly proportional to the starting copy number. not easy to tell becuase the PCR products are not continously monitored. (ii) The usual method to detect the product once linear amplification was achieved (e.g. electrophoresis, southern blot, etc) is tedious and timecomsuming.

5 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Real-time PCR or quantitative PCR (qpcr) is a recently developed technique (1996) and has been increasingly popular for PCR product quantitation. It avoid the drawbacks of the previously-mentioned PCR quantiation. a) PCR products are monitored continously (or in real-time) to make sure the amplication is in the log phase. End-point analysis Real-time analysis b) PCR products can be easily detected from the PCR tubes by the real-time PCR machine (not a regular PCR machine). Detection of up to 384 reactions in less than a minute

6 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR SYBR green Pros: simple, no need to design the probes Cons: unable to differentiate signals from non-specific products unable to do multiplex PCR

7 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Principle of SyBr green.flv

8 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Fluorescence Energy Resonance Transfer (FRET) Reporter Quencher PCR primer No signals Hydrolysis or Taqman probes 5-3 exonuclease activity of Taq The increase in fluorescence measured cycle by cycle is a direct consequence of the amplification process.

9 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR The signals are detected every cycle by real-time PCR instruments. Stratagene MX3005P.flv

10 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Stratagene MX3005P.flv

11 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR The signals are detected every cycle by real-time PCR instruments. Real-time PCR instruments enable detection of PCR products in the linear phase. No subsequent detection is required.

12 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR Ct (threshold cycle) within the log phase is determined. X t = X 0 2 Ct log 2 [X t ] = log 2 [X 0 ] + Ct [Ct] = log 2 [X t ] log 2 [X 0 ] [Ct] = K log 2 [X 0 ] X t = number of copies at threshold cycle X 0 = starting tempate (cycle 0)

13 PRINCIPLE OF REAL-TIME QUANTITATIVE PCR [Ct] = K log 2 [X 0 ] [Ct] = K 3.32log[X 0 ] A log plot of Ct and copy number Unknown samples can be quantitated using a standard curve to obtain the number of copies in the sample.

14 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Absolute vs. Relative quantitation Absolute quantitation e.g. number of c-myc mrna 2500 copies/cells, viral load in the blood 400 copies/ml of blood Require standard curve preparation Relative quantitation In some situations, it may be unnecessary to determine the absolute transcript copy number and reporting the relative change will suffice. e.g. - The expression of c-myc is 3.5-fold higher in cancer compared with normal tissues. - The level of COL1A1 mrna in sirna-treated fibroblasts is 1% of that in untreated fibroblasts.

15 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Relative quantitation e.g. - The expression of MYC is 3.5-fold higher in cancer compared with normal tissues. Technical terms to know before getting started. - Gene of interest (GOI) -> MYC - Calibrator = control samples (e.g. normal tissues, cells from Day 0 or untreated cells, control sirna-treated group). The level of expression calibrator is set at 1 (or 100%). -Unknown = experiment or unknown samples (e.g. cancer tissues, cells at various interavals after treatment, Gene-specific sirna) Relative expression of MYC = Level of MYC in unknown Level of MYC in calibrator e.g. Ct of MYC in unknown and calibrator = 25 and 27 cycles

16 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Relative quantitation e.g. - The expression of MYC is 3.5-fold higher in cancer compared with normal tissues. - Generally, the level of GOI is normalized with the level of an endogenous reference gene or normalizing gene, e.g. housekeeping genes, whose expression is relatively constant in various tissues and conditions. - This approach provides a method for correcting results for differing amounts of input RNA. - This is particularly attractive when it is not practical to measure the amount of input RNA by other methods. Such situations include when only limited amounts of RNA are available or when high-throughput processing of many samples is desired. Example of normalizing gene Actin, GAPDH, Tubulin, Aldolase A

17 ANALYSIS OF REAL-TIME QUANTITATIVE PCR DATA Relative quantitation e.g. - The expression of MYC is 3.5-fold higher in cancer compared with normal tissues. If GAPDH is used as a normalizing gene, Relative expression of MYC/GAPDH in calibrator = Level of MYC in calibrator Level of GAPDH in calibrator Relative expression of MYC/GAPDH in unknown = Level of MYC in unknown Level of GAPDH in unknown Eq.1 Eq.2 Relative expression of MYC in unknown compared with calibrator = Eq.2 Eq.1

18 EXPERIMENTAL PROCEDURES See the handout

19 EXPERIMENTAL PROCEDURES Divide into 4 groups ( a group of ~ 4 students) To prepare master mix, Group 1 & 2 each group prepares the assay reactions of beta-actin and GAPDH (e.g. 1A actin, 1B GAPDH). * The students working with real-time PCR experiments must know how to use automatic pipette accurately because real-time quantiation is a sensitive quantitative assay.

20 EXPERIMENTAL PROCEDURES Divide into 4 groups ( a group of ~ 4 students) To prepare master mix, Group 3 & 4 each group prepares the standard curve to determine the amplification efficiency (e.g. 3A- actin, 3B GAPDH)

21 EXPERIMENTAL PROCEDURES Please read the following reference paper before class tomorrow. Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2- Ct Method. METHODS 25, (2001) doi: /meth ). Click to download the paper.

22 2 nd session

23 DISCUSSION Analysis of real-time PCR data Gene of interest or target gene = level of Actin Normalizing (reference) gene = GAPDH Unknown or test or experiment group = treated cells at day 3 and 7 Calibrator or control group = untreated cells at day 0 If GAPDH is used as a normalizing gene, Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown Level of GAPDH in unknown Relative expression of Actin/GAPDH in calibrator = Level of Actin in calibrator Level of GAPDH in calibrator Eq.1 Eq.2 Relative expression of Actin in unknown compared with calibrator = Eq.1 Eq.2

24 DISCUSSION Analysis of real-time PCR data Let A, G = copies number of Actin and GAPDH respectively C T = threshold cycle, cb = calibrator, unk = unknown Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown Level of GAPDH in unknown Eq.1 X n = X 0 * 2 n A CT-A,unk = A unk * 2 C T-A,unk G CT-G,unk = G unk * 2 C T-G,unk Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown = A unk Level of GAPDH in unknown G unk

25 DISCUSSION Analysis of real-time PCR data Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown = A unk Level of GAPDH in unknown G unk A unk = A CT-A,unk G unk = G CT-G,unk 2 C T-A,unk 2 C T-G,unk A CT-A,unk A unk = 2 C T-A,unk A CT-A,unk x 2 C T-G,unk G unk G CT-G,unk G CT-G,unk x 2 C T-A,unk 2 C T-G,unk A CT-A,unk x 2 (C T-G,unk - CT-A,unk) G CT-G,unk

26 DISCUSSION Analysis of real-time PCR data Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown = A unk Level of GAPDH in unknown G unk A unk = A CT-A,unk x 2 (C T-G,unk - CT-A,unk) G unk G CT-G,unk A CT-A,unk x 2 - (C T-A,unk - CT-G,unk) G CT-G,unk A CT-A,unk x 2 - C T,unk G CT-G,unk

27 DISCUSSION Analysis of real-time PCR data The same calculation is applied in the case of calibrator. Relative expression of Actin/GAPDH in calibrator = Level of Actin in calibrator = A cb Level of GAPDH in calibrator G cb A cb = A CT-A,cb x 2 - C T,cb G cb G CT-G,cb

28 DISCUSSION Analysis of real-time PCR data Relative expression of Actin/GAPDH in unknown = Level of Actin in unknown Level of GAPDH in unknown Relative expression of Actin/GAPDH in calibrator = Level of Actin in calibrator Level of GAPDH in calibrator Eq.1 Eq.2 Relative expression of Actin in unknown compared with calibrator = Eq.1 Eq.2 A CT-A,unk x 2 - C T,unk A unk G unk = G CT-G,unk A cb A CT-A,cb x 2 - C T,cb G cb G CT-G,cb

29 DISCUSSION Analysis of real-time PCR data C T threshold cycle = the cycle number at which the amount of amplified target reaches a fixed threshold. GAPDH cb actin unk GAPDH unk actin cb GAPDH actin At threshold cycles Level of actin in calibrator at C T Level of GAPDH in calibrator at C T = Level of actin in unknown at C T Level of GAPDH in unknown at C T

30 DISCUSSION Analysis of real-time PCR data A unk A CT-A,unk x 2 - C T,unk G unk = G CT-G,unk A cb A CT-A,cb x 2 - C T,cb G cb G CT-G,cb = 2 - C T,unk 2 - C T,cb = 2 -( C T,unk - CT,cb) = 2 - C T

31 DISCUSSION Analysis of real-time PCR data Relative expression of actin/gapdh in unknown = Level of actin in unknown A cb Level of GAPDH in unknown G cb Relative expression of actin/gapdh in calibrator = Level of actin in calibrator A unk Level of GAPDH in calibrator G 0,unk Eq.1 Eq.2 Relative expression of actin in unknown compared with calibrator = Eq.1 = Eq.2 A unk G unk A cb G cb = 2 - C T CT = -( CT,unk - CT,cb)

32 DISCUSSION Analysis of real-time PCR data Xn = the number of target copies at cycle n of PCR X0 = starting number of target copies. EX = the efficiency of target amplification n = the number of PCR cycles. If the efficiency of PCR amplification of this gene is 100%, the (1+Ex) is 2. X n = X 0 * 2 n

33 DISCUSSION Analysis of real-time PCR data Calculate relative expression of actin in the treated cells at day 3, and day 7 compared with the untreated control cells at day 0. After you finish calculatin, then compare with the results calculated by the software.

34 DISCUSSION Analysis of real-time PCR data Approximation method assume that amplification efficiencies of both genes are equal and close to 100%, which might not be true in some instances. The amplification efficiency can be calculated from the standard curve of serially-diluted samples. MX Pro software can let the researchers to change the amplification efficiencies to get more accurate quantitation.

35 DISCUSSION Analysis of real-time PCR data Tutorial videos Real Time QPCR Data Analysis Tutorial part I.flv Real Time QPCR Data Analysis Tutorial part II.flv

36 DISCUSSION Dissociation curve movie Dissociation curve results Primers used in the experiment GAPDH_Forward GAPDH_Reverse ACTIN_Forward ACTIN_Reverse Sequence (5 ->3 ) CAG CCT CAA GAT CAT CAG CA CAT GAG TCC TTC CAC GAT AC TCA CCC ACA CTG TGC CCA TCT ACG A CAG CGG AAC CGC TCA TTG CCA ATG G Product (bp) Calculated Product Tm

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol Event-specific Method for the Quantification of Soybean Line A2704-12 Using Real-time PCR Protocol 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer Protection Biotechnology

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Quantitative Real time PCR. Only for teaching purposes - not for reproduction or sale

Quantitative Real time PCR. Only for teaching purposes - not for reproduction or sale Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation

More information

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu

More information

Protocol T45 Community Reference Laboratory for GM Food and Feed

Protocol T45 Community Reference Laboratory for GM Food and Feed EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR Protocol 10 June 2008 Joint Research Centre Institute for Health and Consumer Protection Biotechnology & GMOs Unit

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

Quantitative Real-Time RT-PCR

Quantitative Real-Time RT-PCR Quantitative Real-Time RT-PCR A Very Short Course Gregory L. Shipley, Ph.D. Department of Integrative Biology & Pharmacology University of Texas Health Science Center - Houston Houston, Texas I. Assay

More information

Module1TheBasicsofRealTimePCR Monday, March 19, 2007

Module1TheBasicsofRealTimePCR Monday, March 19, 2007 Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,

More information

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase

More information

Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR Protocol 20 September 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

User Bulletin. ABI PRISM 7000 Sequence Detection System DRAFT. SUBJECT: Software Upgrade from Version 1.0 to 1.1. Version 1.

User Bulletin. ABI PRISM 7000 Sequence Detection System DRAFT. SUBJECT: Software Upgrade from Version 1.0 to 1.1. Version 1. User Bulletin ABI PRISM 7000 Sequence Detection System 9/15/03 SUBJECT: Software Upgrade from Version 1.0 to 1.1 The ABI PRISM 7000 Sequence Detection System version 1.1 software is a free upgrade. Also

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Event-specific Method for the Quantification of Maize VCO Using Real-time PCR. Validated Method

Event-specific Method for the Quantification of Maize VCO Using Real-time PCR. Validated Method EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Maize VCO-01981-5 Using Real-time

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

Assay Design Considerations, Optimization and Validation

Assay Design Considerations, Optimization and Validation Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

More information

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

SOP: SYBR Green-based real-time RT-PCR

SOP: SYBR Green-based real-time RT-PCR SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong

More information

AmoyDx TM JAK2 V617F Mutation Detection Kit

AmoyDx TM JAK2 V617F Mutation Detection Kit AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background

More information

Real-Time PCR: Practical Issues and Troubleshooting Mehmet Tevfik DORAK, MD PhD

Real-Time PCR: Practical Issues and Troubleshooting Mehmet Tevfik DORAK, MD PhD Real-Time PCR: Practical Issues and Troubleshooting Mehmet Tevfik DORAK, MD PhD Dept of Environmental & Occupational Health Robert Stempel College of Public Health and Social Work Florida International

More information

Custom Assay Development Process

Custom Assay Development Process Custom Assay Development Process Unravelling DNA to Enable Your Discovery Ben Jackson PhD Global Marketing Manager

More information

Contents.

Contents. Contents... 3 Introduction....3 Overview of real-time PCR...4 Overview of qpcr and qrt-pcr components...5 Real-time PCR analysis terminology...8 Real-time PCR fluorescence detection systems...14 Melting

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

Gene Expression on the Fluidigm BioMark HD

Gene Expression on the Fluidigm BioMark HD Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental

More information

Chapter 13 Chromatin Structure and its Effects on Transcription

Chapter 13 Chromatin Structure and its Effects on Transcription Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing

More information

AmoyDx JAK2 Mutation Detection Kit

AmoyDx JAK2 Mutation Detection Kit AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instruction for Use For Research Use Only Instruction Version: B2.6 Revision Date: October 2013 Store at -20±5 Xiamen,

More information

User Bulletin #2. ABI PRISM 7700 Sequence Detection System. Introduction. Contents. December 11, 1997

User Bulletin #2. ABI PRISM 7700 Sequence Detection System. Introduction. Contents. December 11, 1997 User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be performed to standardize

More information

Boost Your Real-Time Results

Boost Your Real-Time Results Boost Your Real-Time Results Refresh your knowledge of the fundamentals of real-time PCR Sample & Assay Technologies 1 Introduction Real-time PCR and RT-PCR are highly sensitive techniques that enable

More information

Copy number standard curve. for absolute quantification by real-time PCR

Copy number standard curve. for absolute quantification by real-time PCR Copy number standard curve for absolute quantification by real-time PCR Kit contents Positive control template for standard curve (RED) Template preparation buffer (YELLOW) RNase/DNase free water (WHITE)

More information

AmoyDx TM PIK3CA Five Mutations Detection Kit

AmoyDx TM PIK3CA Five Mutations Detection Kit AmoyDx TM PIK3CA Five Mutations Detection Kit Detection of five mutations in PIK3CA gene Instructions For Use Instructions Version: B1.3 Date of Revision: April 2012 Store at -20±2 1/5 Background Phosphatidylinositol

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

Supporting Online Information

Supporting Online Information Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical

More information

Detection and quantification of hepatitis E virus by real-time reverse transcriptase PCR

Detection and quantification of hepatitis E virus by real-time reverse transcriptase PCR Page 1 of 6 EU FP VII PROJECT VITAL STANDARD OPERATING Detection and quantification of hepatitis E virus by real-time reverse transcriptase PCR CREATED: REVISED: APPROVED: David Rodríguez Lázaro: 18-2-2010

More information

AmoyDx JAK2 Mutation Detection Kit

AmoyDx JAK2 Mutation Detection Kit AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use For Research Use Only and For Reference Only Instructions Version: B1.2 Date of Revision: June 2016

More information

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Roche Molecular Biochemicals Technical Note No. LC 9/2000 Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges.

Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges. Dr. Angela Cicatelli acicatelli@unisa.it Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges. 1st Workshop on "Risk prognosis of environmental

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Thermo Scientific DyNAmo Probe qpcr Kit

Thermo Scientific DyNAmo Probe qpcr Kit PRODUCT INFORMATION Thermo Scientific DyNAmo Probe qpcr Kit #F-450L Lot Store F at -20 C Expiry Date _ www.thermoscientific.com/onebio Rev. 2 f 2 COMPONENTS OF THE KIT Contents COMPONENTS OF THE KIT...

More information

SYBR Real-Time PCR Kit

SYBR Real-Time PCR Kit SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

Synthetic sirna Quantitation Core Kit

Synthetic sirna Quantitation Core Kit Cat. # 6142 For Research Use Synthetic sirna Quantitation Core Kit Product Manual v201010da Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 4 IV.

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

RT 2 Profiler PCR Array: Web-based data analysis tutorial

RT 2 Profiler PCR Array: Web-based data analysis tutorial RT 2 Profiler PCR Array: Web-based data analysis tutorial.questions? Comments? or Suggestions?.Ask now or contact Technical Support.M F, 9 AM 6 PM EST..Telephone: 888-503-3187;.Email: support@sabiosciences.com.international

More information

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

II 0.95 DM2 (RPP1) DM3 (At3g61540) b Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

Use of BHQplus Probes to Optimize Multiplex Competitive qrt-pcr in Diagnostics. Dr. James C. Willey Chief Medical Advisor Accugenomics, Inc.

Use of BHQplus Probes to Optimize Multiplex Competitive qrt-pcr in Diagnostics. Dr. James C. Willey Chief Medical Advisor Accugenomics, Inc. Use of BHQplus Probes to Optimize Multiplex Competitive qrt-pcr in Diagnostics Dr. James C. Willey Chief Medical Advisor Accugenomics, Inc. Professor, Medicine and Pathology University of Toledo College

More information

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA) The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

Application Note Detecting low copy numbers. Introduction. Methods A08-005B

Application Note Detecting low copy numbers. Introduction. Methods A08-005B Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template

More information

Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design

Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Nadine Nassif, January 2013 Outline Real-Time PCR overview / Understanding qpcr data qpcr detection strategies: dye-based versus label-based

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

Retro-X qrt-pcr Titration Kit. User Manual. User Manual. Catalog No PT (091613)

Retro-X qrt-pcr Titration Kit. User Manual. User Manual. Catalog No PT (091613) User Manual Retro-X qrt-pcr Titration Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc. A Takara

More information

Real-Time PCR ABI Prism 7500 (PSC 563, NSC 338) Real-Time PCR StepOne (PSC 563)

Real-Time PCR ABI Prism 7500 (PSC 563, NSC 338) Real-Time PCR StepOne (PSC 563) Real-Time PCR ABI Prism 7500 (PSC 563, NSC 338) Real-Time PCR StepOne (PSC 563) Every time you use any of the qpcr instruments, you MUST sign the log book. Use Lab Commander to reserve a time. Each instrument

More information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary

More information

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

More information

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

Brilliant II SYBR Green QPCR Master Mix

Brilliant II SYBR Green QPCR Master Mix Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko

More information

PCR Array FAQ s. PCR Arrays: Placing an order

PCR Array FAQ s. PCR Arrays: Placing an order PCR Array FAQ s PCR Arrays: Placing an order What PCR Array services does the facility provide? The DNA Analysis Facility provides support for gene expression studies using PCR Array technology from a

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

Stratagene QPCR Human Reference Total RNA

Stratagene QPCR Human Reference Total RNA Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data

More information

BLOOD, PLASMA & SERUM SAMPLE PREPARATION

BLOOD, PLASMA & SERUM SAMPLE PREPARATION BLOOD, PLASMA & SERUM SAMPLE PREPARATION The New Standard in RNA Purification, Best-in-Class, Pure & Simple Collection, preservation & isolation of inhibitor-free RNA, microrna and genomic DNA for any

More information

CASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist

CASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist CASE-STUDY- VALIDATION of PCR based methodology Beata Surmacz-Cordle Senior Analytical Development Scientist UK RMP Pluripotent Stem Cell Platform Validation Workshop 2 nd June 2016 RT-qPCR assay for detection

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information

Supplemental Data. Distinct Pathways for snorna and mrna Termination

Supplemental Data. Distinct Pathways for snorna and mrna Termination Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A

More information

Real-Time PCR Validations

Real-Time PCR Validations Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed

More information

MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46

MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 INTRODUCTION The mammalian MPR 46 (human, mouse, bovine) sequences show extensive homologies. Among the non-mammalian vertebrates, only a partial sequence

More information

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR

More information

Quantitative PCR Systems

Quantitative PCR Systems QUANTITATIVE PCR Quantitative PCR Systems Our QPCR systems meet your current research needs, offer flexibility for future research goals, and match your budget. HIGH-PERFORMANCE Mx3005P System FULL-FEATURED

More information