Supplemental materials and methods. The itraq labelling of the proteins was done as described previously [1]. Briefly, C2C12 myotubes

Size: px
Start display at page:

Download "Supplemental materials and methods. The itraq labelling of the proteins was done as described previously [1]. Briefly, C2C12 myotubes"

Transcription

1 1 Supplemental materials and methods 2 itraq labelling and nanolc-ms/ms analysis The itraq labelling of the proteins was done as described previously [1]. Briefly, C2C12 myotubes were treated with Myostatin (5 μg/ml) (or carrier) for 24 hr and washed three times with cold PBS. Two independent itraq experiments were performed. In each itraq experiment, three independent cell cultures were pooled. The myotubes were re-suspended in 200 µl of lysis buffer (500 mm triethylammonium bicarbonate (TEAB), 1% SDS, complete protease inhibitor cocktail tablet (Roche, USA) and PhosSTOP phosphatase inhibitor cocktail tablets (Roche, USA)). The samples were then sonicated using a VCX500 sonicator (Sonics, USA) at 25% amplitude and 8 sec pulse in 3 cycles. After centrifugation at 20,000g for 15 min at 4 o C, proteins in the supernatant were quantified using the BCA Protein Assay kit. Two hundred micrograms of protein from Myostatin treated and control myotubes were reduced by tris (carboxyethylphosphine) hydrochloride (TCEP), alkylated with methylmethanethiosulfonate (MMTS). The samples were then diluted to 0.1% SDS and digested with trypsin as previously reported [2, 3]. The resulting peptides were dried and resuspended in 30 μl of 500 mm TEAB (ph 8.5). Each sample was divided into two equal portions, and then isotopically labelled according to the manufacturer s protocol (Applied Biosystems, USA). The labelling scheme was 114: Myostatin treated; 115: control; 116: Myostatin Treated; 117: Control. The labelled samples were combined, dried and stored at -80 C until further analysis The dried itraq labelled sample were re-suspended in 200 µl SCX buffer A (10 mm KH 2 PO 4 in 25% acetonitrile, ph 3). SCX chromatography was performed on a Shimadzu Prominence TM UFLC unit (Kyoto, Japan) using a mm (5 µm particle sizes, 200 Å pore size) PolySULFOETHYL A TM column (PolyLC, USA). The sample was fractionated using a 50-min gradient of 100% buffer A for 5 min, 0 30% buffer B (10 mm KH 2 PO 4, ph 3.0, 500 mm KCl, ACN/H 2 O 25/75 (v/v)) for 35 min, % buffer B for 5 min and finally 100% buffer B for 5 min, at a constant flow rate of 1 ml/min. Fractions were collected at 1 min intervals and consecutive fractions with low peak intensity were combined. Finally, a total of 20 fractions were obtained, desalted using Sep-Pak C18 cartridges

2 27 28 (Waters Corporation, USA). Eluents were lyophilized and stored at -80 C before LC-MS/MS analysis Each of the dried SCX fractions was reconstituted in 0.1% formic acid and then analyzed with a QStar Elite Q-TOF (Applied Biosystems, Framingham, MA, USA) coupled with a Shimadzu Prominence TM UFLC unit. Each fraction was first trapped and desalted with Zorbax 300SB-C18 column, and further separated with an integrated nano-bored C18 column, packed with Magic 5 μm C18 particles. The UFLC flow rate was set at 30 ml/min and a splitter was used to create an approximate 300 nl/min flow rate at the electrospray tip with a 90-min LC gradient. The data acquisition was performed with Analyst QS 2.0 software (Applied Biosystems, Framingham, MA, USA). The mass spectrometer was set to perform data acquisition with a selected mass range of m/z. The three most abundant peptides (with 2+ to 5+ charge states) were selected for MS/MS analysis, and dynamically excluded for 30 sec with ±30mmu tolerance. Smart information-dependent acquisition (IDA) was activated with automatic collision energy and automatic MS/MS accumulation. The fragment intensity multiplier was set to 20 and maximum accumulation time was 2 sec. 41 Data analysis The two independent itraq data sets and the combination of these two data were searched with ProteinPilot software v2.0.1 (Applied Biosystems/MDS-Sciex) for protein identification and quantification. The Paragon algorithm in the ProteinPilot software was used for the peptide identification and further processed by Pro Group algorithm where isoform-specific quantification was adopted to trace the differences between expressions of various isoforms. The defined parameters were as follows: (i) Sample Type: itraq 4-plex (Peptide Labeled); (ii) Cysteine alkylation: MMTS; (iii) Digestion: Trypsin; (iv) Instrument: QSTAR ESI; (v) Special factors: None; (vi) Species: None; (vii) Specify Processing: Quantitate; (viii) ID Focus: biological modifications, amino acid substitutions; (ix) Database: a concatenated target (International Protein Index (IPI) mice database, version 3.34, including sequences and residues) and decoy database [the reverse amino acid sequence for the estimation of false discovery rate

3 (FDR=(decoy_hits/total_hit)*100%]); (x) Search effort: thorough. The peptide for quantification was automatically selected by Pro Group algorithm to calculate the reporter peak area, error factor (EF) and p-value. The p-value can be used to assess whether the changes in protein expression is statistically significant or not. The p-value is a measure of the certainty of a change in the protein expression that is independent of the magnitude of the change. The resulting data set was auto bias corrected and background corrected by the Paragon algorithm. The itraq results of the combined data and the two independent experimental data were exported from ProteinPilot as Protein Summary reports in Microsoft Excel file format non-redundant proteins were identified with FDR lower than 1.0%. Of which, 1290 proteins were identified with Unused ProtScore > 1.3 (Confidence > 95%), and 1337 proteins were quantified with itraq reporter ratio. The itraq result was further analyzed using the online gene ontology software available at and Subcellular and functional categories are based on the annotations of Gene Ontology (GO) using the MGI GO-Slim Chart Tool available at MGI To measure changes in the relative abundance of protein, duplicate sets, [Set #1, 114:115 (Myostatin Treated: Control) and Set #2 116:117 (Myostatin Treated: Control)] were analysed using itraq. This experiment was repeated twice. To assess the reproducibility of the experiments and the quality of the itraq data sets, the geometric mean of itraq reporter ratio and the log scale standard deviation of each identified protein from the four sets of itraq ratio of the two independent experiments were calculated

4 79 References Gan CS, Guo T, Zhang H, Lim SK, Sze SK. A comparative study of electrostatic repulsionhydrophilic interaction chromatography (ERLIC) versus SCX-IMAC-based methods for phosphopeptide isolation/enrichment. J Proteome Res 2008; 7 (11): Datta A, Park JE, Li X et al. Phenotyping of an in vitro model of ischemic penumbra by itraq-based shotgun quantitative proteomics. Journal of proteome research 2010; 9 (1): Guo T, Gan CS, Zhang H et al. Hybridization of pulsed-q dissociation and collision-activated dissociation in linear ion trap mass spectrometer for itraq quantitation. Journal of proteome research 2008; 7 (11):

5 Supplemental figure legends and tables Fig Specific knockdown of MuRF1 expression doesn t alter the expression of sarcomeric genes (Supporting to Fig. 4) RT-qPCR analysis of the expression of individual isoforms of Myh and Myl from untreated and Myostatin treated (Mstn) myotubes from shatrogin-1 (A) or shmurf1 (B) transfected C2C12 cells. Data is from two independent experiments and graphs represent mean fold change when compared to shrna controls. The gene expression changes presented in graphs were found to be insignificant.

6 Table-1 List of primary and secondary antibodies used in this manuscript. Antibodies used in this manuscript Antibodies name Catalog No. Company Atrogin-1 Gift Regeneron MuRF1 Gift Regeneron Myh (all type) MF20 DSHB Myh fast A4.74 DSHB Myh embroynic F1.652 DSHB Myh fast 2A 2F7 DSHB Myh fast 2B 10F5 DSHB Myh fast 2X 6H1 DSHB Myh slow A4.840 DSHB Myl (all type) T14 DSHB IgG agarose A2909 Sigma CBP sepharose GE health α-tubulin T9026 Sigma Ubiquitin sc-8017 Santa Cruz FoxO1 sc Santa Cruz p-foxo1 sc Santa Cruz Smad2/3 sc-6032 Santa Cruz p-smad2/3 sc Santa Cruz Rabbit HRP conjugate Bio-rad Mouse HRP conjugate Bio-rad

7 Table-2 Set of oligo s used for making the shrna/psilencer vector constructs. shrna oligo sequences shrna oligo sequences used for cloning into the psilencer vector shrna Target Sense strand Oligo (5'-3' orientation) Anti-Sense strand Atrogin-1 Set-1 MuRF1 Set-1 Smad3 Set-1 Atrogin-1 Set-2 MuRF1 Set-2 Smad3 Set-2 GATCCGCGCTTCTTGGATGA GAAATTCAAGAGATTTCTCA TCCAAGAAGCGCTT A GATCCGACAAAGAGGATCC GAGTGTTCAAGAGACACTC GGATCCTCTTTGTCTTA GATCCACTTTCTACTGCCAC TTGGTTCAAGAGACCAAGT GGCAGTAGAAAGTTTA GATCCGGAGGTATACAGTA AGGAGTTCAAGAGACTCCTT ACTGTATACCTCCTTA GATCCAGAGGATCCGAGTG GGTTTCTCAAGAGAAAACC CACTCGGATCCTCTTTA GATCCGTTCTCCAGAGTTAA AAGCTTCAAGAGAGCTTTTA ACTCTGGAGAACTT A AGCTTAAGCGCTTCTTGGAT GAGAAATCTCTTGAATTTCT CATCCAAGAAGCGC G AGCTTAAGACAAAGAGGATC CGAGTGTCTCTTGAACACTC GGATCCTCTTTGTCG AGCTTAAACTTTCTACTGCC ACTTGGTCTCTTGAACCAAG TGGCAGTAGAAAGTG AGCTTAAGGAGGTATACAGT AAGGAGTCTCTTGAACTCCT TACTGTATACCTCCG AGCTTAAAGAGGATCCGAGT GGGTTTTCTCTTGAGAAACC CACTCGGATCCTCT G AGCTTAAGTTCTCCAGAGTT AAAAGCTCTCTTGAAGCTTT TAACTCTGGAGAACG

8

Protein preparation and digestion. P. aeruginosa strains were grown in in AB minimal medium

Protein preparation and digestion. P. aeruginosa strains were grown in in AB minimal medium Supplementary data itraq-based Proteomics Analyses Protein preparation and digestion. P. aeruginosa strains were grown in in AB minimal medium supplemented with 5g L -1 glucose for 48 hours at 37 C with

More information

Investigating Biological Variation of Liver Enzymes in Human Hepatocytes

Investigating Biological Variation of Liver Enzymes in Human Hepatocytes Investigating Biological Variation of Liver Enzymes in Human Hepatocytes SWATH Acquisition on the TripleTOF Systems Xu Wang 1, Hui Zhang 2, Christie Hunter 1 1 SCIEX, USA, 2 Pfizer, USA MS/MS ALL with

More information

New Approaches to Quantitative Proteomics Analysis

New Approaches to Quantitative Proteomics Analysis New Approaches to Quantitative Proteomics Analysis Chris Hodgkins, Market Development Manager, SCIEX ANZ 2 nd November, 2017 Who is SCIEX? Founded by Dr. Barry French & others: University of Toronto Introduced

More information

Proteomics Technology Note

Proteomics Technology Note Targeted Proteomics for the Identification of Nucleic Acid Binding Proteins in E. coli: Finding more low abundant proteins using the QSTAR LC/MS/MS System, Multi- Dimensional Liquid Chromatography, Pro

More information

igem2016 Microbiology BMB SDU

igem2016 Microbiology BMB SDU igem2016 Microbiology BMB SDU Project type: Plastic Project title: characterizing and optimizing PHB productin in E. coli. Sub project: 1. Creation date: 2016.09.26 Written by: Joel Performed by: Joel

More information

Quantitative mass spec based proteomics

Quantitative mass spec based proteomics Quantitative mass spec based proteomics Tuula Nyman Institute of Biotechnology tuula.nyman@helsinki.fi THE PROTEOME The complete protein complement expressed by a genome or by a cell or a tissue type (M.

More information

Liver Mitochondria Proteomics Employing High-Resolution MS Technology

Liver Mitochondria Proteomics Employing High-Resolution MS Technology Liver Mitochondria Proteomics Employing High-Resolution MS Technology Jenny Ho, 1 Loïc Dayon, 2 John Corthésy, 2 Umberto De Marchi, 2 Antonio Núñez, 2 Andreas Wiederkehr, 2 Rosa Viner, 3 Michael Blank,

More information

LC/MS/MS Solutions for Biomarker Discovery QSTAR. Elite Hybrid LC/MS/MS System. More performance, more reliability, more answers

LC/MS/MS Solutions for Biomarker Discovery QSTAR. Elite Hybrid LC/MS/MS System. More performance, more reliability, more answers LC/MS/MS Solutions for Biomarker Discovery QSTAR Elite Hybrid LC/MS/MS System More performance, more reliability, more answers More is better and the QSTAR Elite LC/MS/MS system has more to offer. More

More information

Improving Sensitivity in Bioanalysis using Trap-and-Elute MicroLC-MS

Improving Sensitivity in Bioanalysis using Trap-and-Elute MicroLC-MS Improving Sensitivity in Bioanalysis using Trap-and-Elute MicroLC-MS Using the SCIEX M3 MicroLC system for Increased Sensitivity in Antibody Quantitation Remco van Soest and Lei Xiong SCIEX, Redwood City,

More information

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis SWATH Acquisition on the TripleTOF 5600+ System Samuel L. Bader, Robert L. Moritz Institute of Systems Biology,

More information

Simultaneous analysis of relative protein expression levels across multiple samples using itraq isobaric tags with 2D nano LC MS/MS

Simultaneous analysis of relative protein expression levels across multiple samples using itraq isobaric tags with 2D nano LC MS/MS Simultaneous analysis of relative protein expression levels across multiple samples using itraq isobaric tags with 2D nano LC MS/MS Richard D Unwin 1,2, John R Griffiths 1 & Anthony D Whetton 1 1 Stem

More information

Rapid Peptide Catabolite ID using the SCIEX Routine Biotransform Solution

Rapid Peptide Catabolite ID using the SCIEX Routine Biotransform Solution Rapid Peptide Catabolite ID using the SCIEX Routine Biotransform Solution Rapidly Identify Major Catabolites with the SCIEX X500R QTOF System and MetabolitePilot TM 2.0 Software Ian Moore and Jinal Patel

More information

The Effect of MS/MS Fragment Ion Mass Accuracy on Peptide Identification in Shotgun Proteomics

The Effect of MS/MS Fragment Ion Mass Accuracy on Peptide Identification in Shotgun Proteomics The Effect of MS/MS Fragment Ion Mass Accuracy on Peptide Identification in Shotgun Proteomics Authors David M. Horn Christine A. Miller Bryan D. Miller Agilent Technologies Santa Clara, CA Abstract It

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins

Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins BioPharma Compass TM is a fully automated solution for the rapid characterization

More information

A highly sensitive and robust 150 µm column to enable high-throughput proteomics

A highly sensitive and robust 150 µm column to enable high-throughput proteomics APPLICATION NOTE 21744 Robust LC Separation Optimized MS Acquisition Comprehensive Data Informatics A highly sensitive and robust 15 µm column to enable high-throughput proteomics Authors Xin Zhang, 1

More information

Identification of Microprotein-Protein Interactions via APEX Tagging

Identification of Microprotein-Protein Interactions via APEX Tagging Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian

More information

N- The rank of the specified protein relative to all other proteins in the list of detected proteins.

N- The rank of the specified protein relative to all other proteins in the list of detected proteins. PROTEIN SUMMARY file N- The rank of the specified protein relative to all other proteins in the list of detected proteins. Unused (ProtScore) - A measure of the protein confidence for a detected protein,

More information

Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs

Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs Technical Overview Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs Authors Stephen Madden, Crystal Cody, and Jungkap Park Agilent Technologies, Inc. Santa Clara, California,

More information

SUPPLEMENTARY MATERIALS AND METHODS

SUPPLEMENTARY MATERIALS AND METHODS SUPPLEMENTARY MATERIALS AND METHODS itraq quantitative proteomics Reduction, alkylation and trypsin digestion To identify downstream signals of ZNF322A, proteins were extracted from A549 cells treated

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO

More information

A Unique LC-MS Assay for Host Cell Proteins(HCPs) ) in Biologics

A Unique LC-MS Assay for Host Cell Proteins(HCPs) ) in Biologics A Unique LC-MS Assay for Host Cell Proteins(HCPs) ) in Biologics Catalin Doneanu,, Ph.D. Biopharmaceutical Sciences, Waters September 16, 2009 Mass Spec 2009 2009 Waters Corporation Host Cell Proteins

More information

AFFINITY GST PURIFICATION

AFFINITY GST PURIFICATION DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding proteins. are products that allow batch or column purifications. Purification

More information

Supplemental Materials for. Convergence of Ser/Thr and Two-Component Signaling to Coordinate Expression of the Dormancy

Supplemental Materials for. Convergence of Ser/Thr and Two-Component Signaling to Coordinate Expression of the Dormancy Supplemental Materials for Convergence of Ser/Thr and Two-Component Signaling to Coordinate Expression of the Dormancy Regulon in Mycobacterium tuberculosis Joseph D. Chao, Kadamba G. Papavinasasundaram,

More information

BioHPLC columns. Tim Rice Biocolumn Technical Specialist

BioHPLC columns. Tim Rice Biocolumn Technical Specialist BioHPLC columns Tim Rice Biocolumn Technical Specialist AU Typical Application Areas Size Exclusion: Aggregation Analysis Ion Exchange: Charge Isoform Analysis 0.035 Monomer 0.030 0.025 0.020 0.015 Dimer

More information

Proteomics. Proteomics is the study of all proteins within organism. Challenges

Proteomics. Proteomics is the study of all proteins within organism. Challenges Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we

More information

PLRP-S Polymeric Reversed-Phase Column for LC/MS Separation of mabs and ADC

PLRP-S Polymeric Reversed-Phase Column for LC/MS Separation of mabs and ADC PLRP-S Polymeric Reversed-Phase Column for LC/MS Separation of mabs and ADC Analysis of Intact and Fragmented mabs and ADC Application Note Biotherapeutics and Biologics Author Suresh Babu C.V. Agilent

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

Algorithm for Matching Additional Spectra

Algorithm for Matching Additional Spectra Improved Methods for Comprehensive Sample Analysis Using Protein Prospector Peter R. Baker 1, Katalin F. Medzihradszky 1 and Alma L. Burlingame 1 1 Mass Spectrometry Facility, Dept. of Pharmaceutical Chemistry,

More information

TECHNICAL BULLETIN. Catalog Number RAB0012 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0012 Storage Temperature 20 C Phospho-Akt (pser 473 )/pan-akt ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) and pan-akt in cell and tissue lysates Catalog Number RAB0012 Storage Temperature 20 C TECHNICAL

More information

RayBio Rat IL-6 ELISA Kit (For Lysates)

RayBio Rat IL-6 ELISA Kit (For Lysates) RayBio Rat IL-6 ELISA Kit (For Lysates) Catalog #: ELR-IL6-CL User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

RayBio Phospho- Akt (Ser473) ELISA Kit

RayBio Phospho- Akt (Ser473) ELISA Kit RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

APOB (Human) ELISA Kit

APOB (Human) ELISA Kit APOB (Human) ELISA Kit Catalog Number KA1028 96 assays Version: 17 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General

More information

SUMOylated protein capture kit

SUMOylated protein capture kit SUMOylated protein capture kit Cat no. A010-100 Capture and detect SUMOylated proteins High capacity, high specificity SUMO binding matrix Fast, convenient protein isolation using purification system provided

More information

Enhanced chromatography with the Agilent Polaris-HR-Chip-3C18 improved LC/MS/MS proteomics results

Enhanced chromatography with the Agilent Polaris-HR-Chip-3C18 improved LC/MS/MS proteomics results Enhanced chromatography with the Agilent Polaris-HR-Chip-3C18 improved LC/MS/MS proteomics results Technical Overview Authors Stephan Buckenmaier, José Mora, and Tom van de Goor Agilent Technologies Inc.

More information

RayBio Human Caspase-3 ELISA Kit

RayBio Human Caspase-3 ELISA Kit RayBio Human Caspase-3 ELISA Kit Catalog #: ELH-CASP3 User Manual Last revised July 21, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Removal of Multiple High-Abundant Proteins from Mouse Plasma Using the Agilent Multiple Affinity Removal System for Mouse Application

Removal of Multiple High-Abundant Proteins from Mouse Plasma Using the Agilent Multiple Affinity Removal System for Mouse Application Removal of Multiple High-Abundant Proteins from Mouse Plasma Using the Agilent Multiple Affinity Removal System for Mouse Application Proteomics Authors William Barrett, Nina Zolotarjova, Haiying Chen,

More information

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra GE Healthcare Instructions 28-9670-57 AA Mag Sepharose Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra Protein A Mag Sepharose Xtra and Protein G Mag Sepharose Xtra are available in the following

More information

mabs and ADCs analysis by RP

mabs and ADCs analysis by RP mabs and ADCs analysis by RP Shanhua Lin, Ph.D. The world leader in serving science Protein and mab Separation by HPLC Size difference? YES Size Exclusion Chromatography (SEC) MAbPac SEC-1 NO NO Charge

More information

UC San Diego UC San Diego Electronic Theses and Dissertations

UC San Diego UC San Diego Electronic Theses and Dissertations UC San Diego UC San Diego Electronic Theses and Dissertations Title A strategy for the quantification of protein polyethylene glycol (PEG) derivatized sites using itraq Permalink https://escholarship.org/uc/item/0bk9f1f4

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table

More information

ab Vimentin Human Profiling ELISA Kit

ab Vimentin Human Profiling ELISA Kit ab173190 Vimentin Human Profiling ELISA Kit Instructions for Use For the measurement of total Vimentin protein in Human samples. This product is for research use only and is not intended for diagnostic

More information

RockerBox. Filtering massive Mascot search results at the.dat level

RockerBox. Filtering massive Mascot search results at the.dat level RockerBox Filtering massive Mascot search results at the.dat level Challenges Big experiments High amount of data Large raw and.dat files (> 2GB) How to handle our results?? The 2.2 peptide summary could

More information

Fast and Efficient Peptide Mapping of a Monoclonal Antibody (mab): UHPLC Performance with Superficially Porous Particles

Fast and Efficient Peptide Mapping of a Monoclonal Antibody (mab): UHPLC Performance with Superficially Porous Particles Fast and Efficient Peptide Mapping of a Monoclonal Antibody (mab): UHPLC Performance with Superficially Porous Particles Application Note Biotherapeutics and Biosimilars Authors James Martosella, Alex

More information

N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF

N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF Application Note Authors Xianming Liu, Wei Zhang, Yi Du, Sheng Yin, Hong Que, and Weichang Zhou WuXi AppTec iopharmaceuticals

More information

Peptide Mapping: A Quality by Design (QbD) Approach

Peptide Mapping: A Quality by Design (QbD) Approach Peptide Mapping: A Quality by Design (QbD) Approach Application Note Bio-Pharmaceutical Authors Sreelakshmy Menon and Suresh babu C.V. Agilent Technologies, Inc. Richard Verseput S-Matrix Corporation Abstract

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

Development of Analysis Methods for Therapeutic Monoclonal Antibodies Using Innovative Superficially Porous Particle Biocolumns

Development of Analysis Methods for Therapeutic Monoclonal Antibodies Using Innovative Superficially Porous Particle Biocolumns Development of Analysis Methods for Therapeutic Monoclonal Antibodies Using Innovative Superficially Porous Particle Biocolumns Anne Blackwell Bio Columns Product Support Scientist Suresh Babu Senior Application

More information

Generating Automated and Efficient LC/MS Peptide Mapping Results with the Biopharmaceutical Platform Solution with UNIFI

Generating Automated and Efficient LC/MS Peptide Mapping Results with the Biopharmaceutical Platform Solution with UNIFI with the Biopharmaceutical Platform Solution with UNIFI Vera B. Ivleva, Ying Qing Yu, Scott Berger, and Weibin Chen Waters Corporation, Milford, MA, USA A P P L I C AT ION B E N E F I T S The ability to

More information

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT PAGE 1 HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT FOR THE QUANTITATIVE DETERMINATION OF HUMAN CTGF CONCENTRATIONS IN SERUM AND PLASMA PURCHASE INFORMATION: ELISA NAME Catalog No. Lot No. Formulation

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension.

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension. 1 AFFINITY GST PURIFICATION Procedure for Use Glutathione Agarose 4 Resin DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding

More information

Application Note. Authors. Abstract

Application Note. Authors. Abstract Automated, High Precision Tryptic Digestion and SISCAPA-MS Quantification of Human Plasma Proteins Using the Agilent Bravo Automated Liquid Handling Platform Application Note Authors Morteza Razavi, N.

More information

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

ab GFP ELISA Kit Instructions for Use  For the quantitative measurement of GFP protein expression ab117992 GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression This product is for research use only and is not for diagnostic use. intended www.abcam.com Table

More information

Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins

Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins Esther Lewis, 1 Kevin Meyer, 2 Zhiqi Hao, 1 Nick Herold,

More information

itraq Proteomics Profiling of Regulatory Proteins During

itraq Proteomics Profiling of Regulatory Proteins During itraq Proteomics Profiling of Regulatory Proteins During Oligodendrocyte Differentiation Mohit Raja Jain 1, Tong Liu 1, Teresa L. Wood 2 and Hong Li 1* 1 Center for Advanced Proteomics Research and Department

More information

Dynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors

Dynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors Contact Us: www.pall.com/contact Dynamic High Capacity Mustang Q Membrane Units for Scaleable Anion Exchange Chromatography Purification of Adenoviral Vectors Dynamic High Capacity Mustang Q Membrane Units

More information

CQA Assessment by Peptide Mapping Using LC/MS with an AdvanceBio Peptide Plus Column

CQA Assessment by Peptide Mapping Using LC/MS with an AdvanceBio Peptide Plus Column CQA Assessment by Peptide Mapping Using LC/MS with an AdvanceBio Peptide Plus Column Anne Blackwell, Ph.D. BioColumns Product Support Scientist June 7, 27 ASMS Analytical groups are tasked with method

More information

Assay of Cytokines in Tissue Culture Supernatants AfCS Procedure Protocol PP Version 1, 03/17/04

Assay of Cytokines in Tissue Culture Supernatants AfCS Procedure Protocol PP Version 1, 03/17/04 AfCS Procedure Protocol PP00000223 Version 1, 03/17/04 The Bio-Plex cytokine assay employs a liquid suspension array for quantification of cytokines in tissue culture supernatants or serum. Using this

More information

Rapid Soft Spot Analysis using the SCIEX Routine Biotransform Solution

Rapid Soft Spot Analysis using the SCIEX Routine Biotransform Solution Rapid Soft Spot Analysis using the SCIEX Routine Biotransform Solution Rapidly Identify Top Metabolites with the SCIEX X500R QTOF System and MetabolitePilot TM 2.0 Software Shaokun Pang and Ian Moore SCIEX,

More information

hfab Rhodamine Housekeeping Antibodies

hfab Rhodamine Housekeeping Antibodies hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine

More information

Application Note. Authors. Abstract. Clinical Research

Application Note. Authors. Abstract. Clinical Research Workflow Automation for LC/MS: In-Solution Protein Digestion, Peptide Cleanup, and Strong Cation-Exchange Fractionation of Peptides Enabled by AssayMAP Technology Application Note Clinical Research Authors

More information

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,

More information

GST Fusion Protein Purification Kit

GST Fusion Protein Purification Kit Glutathione Resin GST Fusion Protein Purification Kit Cat. No. L00206 Cat. No. L00207 Technical Manual No. TM0185 Version 01042012 Index 1. Product Description 2. Related Products 3. Purification Procedure

More information

Precise Characterization of Intact Monoclonal Antibodies by the Agilent 6545XT AdvanceBio LC/Q-TOF

Precise Characterization of Intact Monoclonal Antibodies by the Agilent 6545XT AdvanceBio LC/Q-TOF Precise Characterization of Intact Monoclonal Antibodies by the Agilent 6545XT AdvanceBio LC/Q-TOF Application Note Author David L. Wong Agilent Technologies, Inc. Santa Clara, CA, USA Introduction Monoclonal

More information

1638 Molecular & Cellular Proteomics 6.9

1638 Molecular & Cellular Proteomics 6.9 Supplemental Material can be found at: http://www.mcponline.org/cgi/content/full/t600050-mcp200/ DC1 Technology The Paragon Algorithm, a Next Generation Search Engine That Uses Sequence Temperature Values

More information

Human IgG Antigen ELISA Kit

Human IgG Antigen ELISA Kit Human IgG Antigen ELISA Kit Catalog No: IHUIGGKT Lot No: SAMPLE INTENDED USE This human immunoglobulin G antigen assay is intended for the quantitative determination of total human IgG antigen in serum,

More information

CaptiveSpray nanobooster

CaptiveSpray nanobooster CaptiveSpray nanobooster The Revolution in Proteomics Ionization Innovation with Integrity LC-MS Source The Key to Performance and Reliability for nano flow MS Bruker CaptiveSpray principle: Stable and

More information

RayBio Custom ELISA Kit

RayBio Custom ELISA Kit RayBio Custom ELISA Kit Catalog #: EL-PRELIM User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross, GA 30092

More information

ichemistry SOLUTIONS Integrated chemistries to boost mass spectrometry workflows

ichemistry SOLUTIONS Integrated chemistries to boost mass spectrometry workflows ichemistry SOLUTIONS Integrated chemistries to boost mass spectrometry workflows ichemistry SOLUTIONS ichemistry solutions ichemistry solutions are the world s only reagents and consumables that are customdesigned

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

Detecting Challenging Post Translational Modifications (PTMs) using CESI-MS

Detecting Challenging Post Translational Modifications (PTMs) using CESI-MS Detecting Challenging Post Translational Modifications (PTMs) using CESI-MS Sensitive workflow for the detection of PTMs in biological samples from small sample volumes Klaus Faserl, 1 Bettina Sarg, 1

More information

Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis

Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis 2D gel electrophoresis remains a dominant technique in proteomics. Obtaining high quality gels requires careful and tedious

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog

More information

Mouse Factor XII Total ELISA Kit

Mouse Factor XII Total ELISA Kit Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography

More information

Bioanalytical LC-MS of monoclonal antibody therapeutics

Bioanalytical LC-MS of monoclonal antibody therapeutics Bioanalytical LC-MS of monoclonal antibody therapeutics William D van Dongen, product manager pharma bioanalysis small molecules immunogenicity 40 years experience in bioanalysis Bioanalytical Expertise

More information

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer.

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer. Mouse IL-6 (Lysate) ELISA Kit Catalog No: CKM054 Size: 1 x 96 tests I. Introduction The Cell Sciences Mouse IL-6 ELISA (Enzyme-Linked Immunosorbent Assay) kit is an in vitro enzyme-linked immunosorbent

More information

Proteomics: A Challenge for Technology and Information Science. What is proteomics?

Proteomics: A Challenge for Technology and Information Science. What is proteomics? Proteomics: A Challenge for Technology and Information Science CBCB Seminar, November 21, 2005 Tim Griffin Dept. Biochemistry, Molecular Biology and Biophysics tgriffin@umn.edu What is proteomics? Proteomics

More information

Low pg/ml Detection of rhuepos in Horse Plasma Employing High-Resolution MS

Low pg/ml Detection of rhuepos in Horse Plasma Employing High-Resolution MS Low pg/ml Detection of rhuepos in Horse Plasma Employing High-Resolution MS Claire Dauly 1, Patrice Garcia 2, Joel Louette 3, Florence Cormant 2, Madalina Oppermann 4, Marie-Agnès Popot 2, Yves Bonnaire

More information

RayBio Human HGF ELISA Kit

RayBio Human HGF ELISA Kit RayBio Human HGF ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human HGF ELISA Kit Protocol (Cat#: ELH-HGF-001C) RayBiotech, Inc. We Provide You With Excellent

More information

A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS

A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS Zhiqi Hao, 1 Yi Zhang, 1 David Horn, 1 Seema Sharma, 1 Shiaw-Lin

More information

Mitochondria/Cytosol Fractionation Kit

Mitochondria/Cytosol Fractionation Kit Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)

More information

MassPREP On-Line Desalting Cartridge

MassPREP On-Line Desalting Cartridge CONTENTS I. INTRODUCTION II. INSTALLING THE MASSPREP ON-LINE DESALTING CARTRIDGE INTO THE SENTRY.1 X 1 MM GUARD COLUMN HOLDER III. RECOMMENDED LC/MS SYSTEM CONFIGURATION TO MINIMIZE MS SOURCE CONTAMINATION

More information

ab G alpha i Activation Assay Kit

ab G alpha i Activation Assay Kit ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version

More information

Faster, easier, flexible proteomics solutions

Faster, easier, flexible proteomics solutions Agilent HPLC-Chip LC/MS Faster, easier, flexible proteomics solutions Our measure is your success. products applications soft ware services Phospho- Anaysis Intact Glycan & Glycoprotein Agilent s HPLC-Chip

More information

Application Note. Kwasi Antwi, Amanda Ribar, Urban A. Kiernan, and Eric E. Niederkofler Thermo Fisher Scientific, Tempe, Arizona

Application Note. Kwasi Antwi, Amanda Ribar, Urban A. Kiernan, and Eric E. Niederkofler Thermo Fisher Scientific, Tempe, Arizona Analysis of an Antibody Drug Conjugate using MSIA D.A.R.T. S. Technology, an Integral Part of Ligand Binding Mass Spectrometric Immunoassay (LB-MSIA) Workflow Application Note Kwasi Antwi, Amanda Ribar,

More information

2012 Waters Corporation 1

2012 Waters Corporation 1 UPLC User meeeting April 2012 Principles and Practices for SEC, IEX for Intact Protein Analysis by UPLC anders_feldthus@waters.com 2012 Waters Corporation 1 Agenda Ion-Exchange Chromatography Theory and

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a

More information

Application Note LCMS-87 Automated Acquisition and Analysis of Data for Monitoring Protein Conjugation by LC-MS Using BioPharma Compass

Application Note LCMS-87 Automated Acquisition and Analysis of Data for Monitoring Protein Conjugation by LC-MS Using BioPharma Compass Application Note LCMS-87 Automated Acquisition and Analysis of Data for Monitoring Protein Conjugation by LC-MS Using BioPharma Compass Abstract Here we describe the development and use of an automated

More information