ENCODE DCC Antibody Validation Document
|
|
|
- Lester Caldwell
- 6 years ago
- Views:
Transcription
1 ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology Catalog Number, database ID, laboratory sc-8984 Lot Number Antibody Description: Rabbit ploclonal antibody raised against amino acids of SREBP-1 of human origin. Target Description: Transcriptional activator required for lipid homeostasis. Regulates transcription of the LDL receptor gene as well as the fatty acid and to a lesser degree the cholesterol synthesis pathway (By similarity). Binds to the sterol regulatory element 1 (SRE-1) (5'-ATCACCCCAC-3'). Has dual sequence specificity binding to both an E-box motif (5'-ATCACGTGA-3') and to SRE-1 (5'-ATCACCCCAC-3') Species Target Human Species Host Rabbit Validation Method #1 Western Blot Validation Method #2 IP-Mass Spec Purification Method Affinity Polyclonal/ Monoclonal Polyclonal Vendor URL: datasheet=8984 Reference (PI/ Publication Information) Please complete the following for antibodies to histone modifications: if your specifications are not listed in the drop-down box, please write-in the appropriate information Histone Name AA modified AA Position Modification
2 Western blot of HelaS3 and HepG2 nuclear extracts using the anti SREBP1 (sc-8984) detects a single high molecular weight protein of about 125kD. This band was further analyzed by IP-Mass Spec. Validation #1 Analysis Insert Validation Image (click here)
3 Western'Blot'analysis'of'nuclear'extracts'from'HelaS3' and'hepg2'using'an;'srebp1'an;body'(scb8984).' Expected'protein'band'125'kD.'
4 Immunoprecipitation of SREBP1 from HepG2 cells using sc-8984 antibody. Lane 1: input nuclear lysate, Lane 2: material immunoprecipitated with sc-8984, Lane 3: material immunoprecipitated using control IgG. Band A was excised from the gel and subjected to analysis by mass spectrometry.! IP followed by masspectrometry: Briefly, protein was immunoprecipitated from HepG2 whole cell lysates using sc-8984, and the IP fraction was loaded on a 10% polyacrylamide gel (NuPAGE Bis-Tris Gel) and separated with an Invitrogen NuPAGE electrophoresis system. The gel was silver-stained, gel fragments corresponding to the bands indicated were excised and destained using the SilverSNAP Stain for Mass Spectrometry (Pierce). Then proteins were trypsinized using the in-gel digestion method. Digested proteins were analyzed on an LTQ- Orbitrap (Thermo Scientific) by the nanolc-esi-ms/ms technique. Peptides were identified by the SEQUEST algorithm and filtered with a high confidence threshold (Protein false discovery rate < 1%, 2 peptides per protein minimum).! We report 27proteins identified in band A, although 3 of these are also present in a control immunoprecipitation and are thus likely to present due to non-specific association with the IP matrix. Of the specifically immunoprecipitated proteins, SREBP1 is the most abundant (40 peptides).! Based on these observations, this band is likely due to the presence of immunoprecipitated SREBP1 and sc-8984 meets the ENCODE standard for validation by this criterion. Validation #2 Analysis Insert Validation Image (Click here)
5 Immunoprecipita-on.assay.(IP).+..mass.spectrometry.assay. MW. SREBP1(sc8984).(R).125.kD Band.A Lane Lane.1.Input.lysate.. Lane.2.Bound.material.from.IP.. Lane.3.Bound.material.from.IP... using.nonkspecific.igg.
6 Spectrum) Name)of)Protein) Count)of)pep2des) Ra2o(SREBP1/IgG)Control)) SREBP1.Band.A. Isoform.4.of.Sterol.regulatory.elementKbinding.protein NOT.IN.CONTROL.IP. SREBP1.Band.A. OxysterolKbinding.protein. 31. NOT.IN.CONTROL.IP. SREBP1.Band.A. Puta-ve.uncharacterized.protein.SFRS NOT.IN.CONTROL.IP. SREBP1.Band.A. 10Kformyltetrahydrofolate.dehydrogenase. 18. NOT.IN.CONTROL.IP. SREBP1.Band.A. Formyltetrahydrofolate.dehydrogenase.isoform.a.variant. 18. NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.1.of.NKterminal.kinaseKlike.protein. 18. NOT.IN.CONTROL.IP. SREBP1.Band.A. Hemoglobin.subunit.beta. 17. NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.5.of.NKterminal.kinaseKlike.protein. 17. NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.2.of.OxysterolKbinding.proteinKrelated.protein NOT.IN.CONTROL.IP. SREBP1.Band.A. interleukin.enhancerkbinding.factor.3.isoform.d. 14. NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.1.of.Interleukin.enhancerKbinding.factor NOT.IN.CONTROL.IP. SREBP1.Band.A. Endoplasmin SREBP1.Band.A. HNRPU.protein SREBP1.Band.A. Isoform.Long.of.Heterogeneous.nuclear.ribonucleoprotein.U SREBP1.Band.A. Isoform.RF1/RF2.of.RetrotransposonKderived.protein.PEG NOT.IN.CONTROL.IP. SREBP1.Band.A. MatrinK3. 9. NOT.IN.CONTROL.IP. SREBP1.Band.A. Puta-ve.uncharacterized.protein.MATR3. 9. NOT.IN.CONTROL.IP. SREBP1.Band.A. retrotransposonkderived.protein.peg10.isoform NOT.IN.CONTROL.IP. SREBP1.Band.A. Aldehyde.dehydrogenase.1.family,.member.L1,.isoform.CRA_a. 7. NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.1.of.Splicing.factor.3B.subunit NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.1.of.Serum.albumin. 4. NOT.IN.CONTROL.IP. SREBP1.Band.A. FACT.complex.subunit.SPT NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.RF1.of.RetrotransposonKderived.protein.PEG NOT.IN.CONTROL.IP. SREBP1.Band.A. retrotransposonkderived.protein.peg10.isoform NOT.IN.CONTROL.IP. SREBP1.Band.A. Desmoplakin.Ia. 2. NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.DPI.of.Desmoplakin. 2. NOT.IN.CONTROL.IP. SREBP1.Band.A. Isoform.DPII.of.Desmoplakin. 2. NOT.IN.CONTROL.IP.
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345()
!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345() Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345()
!"#$%!&%##&'()*+,-.&/01*-0)*,(&%,2345() Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
Really high sensitivity mass spectrometry and Discovery and analysis of protein complexes
Really high sensitivity mass spectrometry and Discovery and analysis of protein complexes The PRIME lab and AMS Importance of protein complexes in biology Methods for isolation of protein complexes In
ENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
Stable Isotope Labeling with Amino Acids in Cell Culture. Thermo Scientific Pierce SILAC Protein Quantitation Kits
Stable Isotope Labeling with Amino Acids in Cell Culture Thermo Scientific Pierce SILAC Protein Quantitation Kits Quantitative Analysis of Differential Protein Expression Stable isotope labeling using
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
Lecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry
Lecture 5: 8/31 CHAPTER 5 Techniques in Protein Biochemistry Chapter 5 Outline The proteome is the entire set of proteins expressed and modified by a cell under a particular set of biochemical conditions.
Solutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
Reach greater highs. (and lows ) with new protein ladder choices. Fermentas now sold as. Thermo Scientific
Introducing Thermo Scientific Pierce Prestained and Unstained s for easy protein molecular weight determination. Fermentas now sold as Thermo Scientific Reach greater highs (and lows ) with new protein
Objective. Introduction. IP assisted LC/MS/MS making study protein complexes easy. Jon Hao 1, Yi Liu 1, Xiaozhi Ren 2, and King-Wai Yau 2
IP assisted LC/MS/MS making study protein complexes easy Jon Hao 1, Yi Liu 1, Xiaozhi Ren 2, and King-Wai Yau 2 1 Poochon Scientific, Frederick, Maryland 21701 2 Department of Neuroscience, Johns Hopkins
SUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # C Component Size Shipping Temperature
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K27M Histone H3K27me1 (H3K27 Monomethyl) Polyclonal Antibody 25 µg
Identification of Microprotein-Protein Interactions via APEX Tagging
Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian
Proteomics and some of its Mass Spectrometric Applications
Proteomics and some of its Mass Spectrometric Applications What? Large scale screening of proteins, their expression, modifications and interactions by using high-throughput approaches 2 1 Why? The number
ENCODE and modencode Guidelines For Experiments Generating Chromatin and Transcription Factor Data Version 1.0, April 09, 2010
ENCODE and modencode Guidelines For Experiments Generating Chromatin and Transcription Factor Data Version 1.0, April 09, 2010 Every data producer aims to generate high- quality data sets. To help achieve
Proteomics. Proteomics is the study of all proteins within organism. Challenges
Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we
T-cell response. Taken from NIAID: s.aspx
T-cell receptor T-cell response 1. Macrophage or dendritic cell digest antigen bacteria, virus 2. Fragments of Ag bind to major histo-compatiblity (MHC) proteins in macrophage. 3. MHC I-Ag fragment expressed
Product Datasheet. UXT Antibody NBP Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 1
Product Datasheet UXT Antibody NBP1-00129 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 1 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nbp1-00129
Product Datasheet. LMO2 Antibody NB Unit Size: 0.1 ml
Product Datasheet LMO2 Antibody NB110-83978 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related Products, Reviews,
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody
Proteomics and Cancer
Proteomics and Cancer Japan Society for the Promotion of Science (JSPS) Science Dialogue Program at Niitsu Senior High School Niitsu, Niigata September 4th 2006 Vladimir Valera, M.D, PhD JSPS Postdoctoral
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin (A), D1-CD2 (B), and the D1-CD2 variant 3 (C) to Adomain
Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
Western-GUARANTEED Antibody Service FAQ
Western-GUARANTEED Antibody Service FAQ Content Q 1: When do I need a Western GUARANTEED Peptide Antibody Package?...2 Q 2: Can GenScript provide a Western blot guaranteed antibody?...2 Q 3: Does GenScript
We asked, you answered
We asked, you answered NOVUS ANTIBODY QUALITY SURVEY RESULTS MARCH 2014 We asked, you answered: Novus survey reveals customer aspirations for antibody quality The results are in! We asked you, our customers,
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications
![MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications](/thumbs/74/71368870.jpg "MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications")
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein
mcherry Polyclonal Antibody Catalog Number PA Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size
Gα i Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product
Cell Signaling Technology
Cell Signaling Technology PTMScan Direct: Multipathway v2.0 Proteomics Service Group January 14, 2013 PhosphoScan Deliverables Project Overview Methods PTMScan Direct: Multipathway V2.0 (Tables 1,2) Qualitative
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:VAPA mouse monoclonal antibody, clone OTI10E10 (formerly 10E10) Product Data Sheet - TRUEMAB Catalog: TA809100 Components: VAPA mouse monoclonal
The Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
Product Datasheet. ATF3 Antibody NBP Unit Size: 0.1 ml. Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Product Datasheet ATF3 Antibody NBP1-02935 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 2 Protocols, Publications, Related Products,
SUPPLEMENTARY INFORMATION FILE
SUPPLEMENTARY INFORMATION FILE Existence of a microrna pathway in anucleate platelets Patricia Landry, Isabelle Plante, Dominique L. Ouellet, Marjorie P. Perron, Guy Rousseau & Patrick Provost 1. SUPPLEMENTARY
Small-Molecule Drug Target Identification/Deconvolution Technologies
Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily
VERIFY Tagged Antigen. Validation Data
VERIFY Tagged Antigen Validation Data Antibody Validation Figure 1. Over-expression cell lysate for human STAT3 (NM_139276) was used to test 3 commercial antibodies. Antibody A shows strong antigen binding.
ChIP-seq guidlines used by ENCODE AND modencode consortia. 2012/11/15 DJEKIDEL Mohamed Nadhir
ChIP-seq guidlines used by ENCODE AND modencode consortia 2012/11/15 DJEKIDEL Mohamed Nadhir Paper & authors ENCODE and modencode performed: >1000 ChIP-seq experiment. 140 different factors. 100 cell lines
Instant-Bands Protein Sample Loading Buffer for SDS-PAGE. User s Manual. View Protein Bands in an SDS Gel. Instantly. EZBiolab.
Instant-Bands Protein Sample Loading Buffer for SDS-PAGE User s Manual View Protein Bands in an SDS Gel Instantly www.ezbiolab.com 2 Instant-Bands User s Manual Table of Contents Introduction 3 Storage
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
Separose 4 Fast Flow beads stored in 100% isopropanol (Amersham. Bioscience) were washed four times with 1 mm HCl and twice with coupling buffer
Supporting Information Materials and Methods Affinity chromatography. Three-hundred microliters of N-hydroxysuccinimideactivated Separose 4 Fast Flow beads stored in 100% isopropanol (Amersham Bioscience)
HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
Cdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
H3K36me3 polyclonal antibody
H3K36me3 polyclonal antibody Cat. No. C15410192 Type: Polyclonal ChIP-grade/ChIP-seq grade Source: Rabbit Lot #: A1845P Size: 50 µg/32 µl Concentration: 1.6 μg/μl Specificity: Human, mouse, Arabidopsis,
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Overcoming HSP27-mediated resistance by altered dimerization of HSP27 using small molecules
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Overcoming HSP27-mediated resistance by altered dimerization of HSP27 using small molecules Supplementary Materials SUPPLEMENTARY
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
western blotting tech
western blotting tech note 6148 Transfer of High Molecular Weight Proteins to Membranes: A Comparison of Transfer Efficiency Between Blotting Systems Nik Chmiel, Bio-Rad Laboratories, Inc., 6000 James
User Rules & Regulations Core Facility for Mass Spectrometry and Proteomics (CFMP) at the Centre for Molecular Biology of Heidelberg University (ZMBH)
User Rules & Regulations Core Facility for Mass Spectrometry and Proteomics (CFMP) at the Centre for Molecular Biology of Heidelberg University (ZMBH) Accepted on 30. January 2017 1 Definition and aims
We have a gel for that. Trusted performance from a broad range of protein gel options
We have a gel for that Trusted performance from a broad range of protein gel options Choice without compromise With a focus on your evolving protein research needs, we offer you a complete array of products
Protein A Agarose Immunoprecipitation Kit
Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
Product Datasheet. GRB2 Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 1
Product Datasheet GRB2 Antibody NB100-866 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 1 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb100-866
Enrichment of EGFR/PI3K/AKT/PTEN Proteins for Research using Immunoprecipitation and with Mass Spectrometry-based Analysis
Enrichment of /PI3K/AKT/ Proteins for Research using Immunoprecipitation and with Mass Spectrometry-based Analysis Bhavin Patel, Scott Meier, Kay Opperman, Paul Haney, Barbara Kaboord, John Rogers Thermo
Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
Description of supplementary material file
Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information
Arf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
Supplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
Product Datasheet. 5-HT3A Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 3
Product Datasheet 5-HT3A Antibody NB100-41382 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 3 Protocols, Publications, Related Products, Reviews, Research Tools and
PROTÉOMIQUE. Application de la protéomique à la cartographie de l interactome et la découverte de biomarqueurs. BENOIT COULOMBE, PhD
PROTÉOMIQUE Application de la protéomique à la cartographie de l interactome et la découverte de biomarqueurs BENOIT COULOMBE, PhD Laboratoire de protéomique & transcription génique BCM2003, mars 2012
20.320, notes for 9/13
20.320 Notes Page 1 20.320, notes for 9/13 Thursday, September 13, 2012 9:36 AM Coming Assignments 1st part of design project coming up, assigned 9/14 (tomorrow) and due 9/21. Last time We covered ITC
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
This is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
Supplementary Figure 1. Immunoprecipitation of synthetic SUMOm-remnant peptides using UMO monoclonal antibody. (a) LC-MS analyses of tryptic
Supplementary Figure 1. Immunoprecipitation of synthetic SUMOm-remnant peptides using UMO 1-7-7 monoclonal antibody. (a) LC-MS analyses of tryptic digest from HEK293 cells spiked with 6 SUMOmremnant peptides
Gα 13 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product
GFP as affinity tag for immunoprecipitation
1/5 Preamble This document compares existing conventional antibodies against GFP in biochemical studies with the GFPTrap, a readytouse pulldown reagent derived from alpaca. What are the differences between
Product Data Sheet - ANTIBODY
888.267.4436 techsupport@origene.com www.origene.com Name:Mouse Monoclonal MBP Antibody (2H9) Product Data Sheet - ANTIBODY Catalog: TA336919 Components: Mouse Monoclonal MBP Antibody (2H9) (TA336919)
Appendix. Table of contents
Appendix Table of contents 1. Appendix figures 2. Legends of Appendix figures 3. References Appendix Figure S1 -Tub STIL (41) DVFFYQADDEHYIPR (55) (64) AVLLDLEPR (72) 1 451aa (1071) YLNENQLSQLSVTR (1084)
Product Data Sheet - TRUEMAB
Name:Mouse monoclonal anti-pcna antibody, clone 4B2, Loading, clone OTI4B2 (formerly 4B2) Product Data Sheet - TRUEMAB 888.267.4436 techsupport@origene.com www.origene.com Catalog: TA800880 Components:
Description Wako Catalog No. Page # microrna Purification Kits based on Immunoprecipitation method using antibody against Argonaute protein
Wako microrna Products Wako Pure Chemical Industries, Ltd. microrna Cloning Ago IP microrna Purification Target mrna Screening micrornas (mirnas) are endogenous RNAs, approximately 22 nucleotides in length,
Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1.
GR24 (μm) 0 20 0 20 GST-ShHTL7 anti-gst His-MAX2 His-COI1 PVDF staining Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. Pull-down assays using GST-ShHTL7
Exam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
Topic 2: Proteins. 2-1 specific proteins can be purified from cell extracts. Molecular Biology and Public Health ( 分子生物学与公共卫生 )
HAPTER20: Techniques of Molecular Biology Molecular Biology and Public Health ( 分子生物学与公共卫生 ) -------Protein manipulation ( 蛋白操作 ) Topic 2: Proteins 1. Protein purification ( 蛋白质纯化 ) 2. Affinity chromatography
COURSE OUTLINE Biology 103 Molecular Biology and Genetics
Degree Applicable I. Catalog Statement COURSE OUTLINE Biology 103 Molecular Biology and Genetics Glendale Community College November 2014 Biology 103 is an extension of the study of molecular biology,
mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
Mass Spectrometry and Proteomics - Lecture 6 - Matthias Trost Newcastle University
Mass Spectrometry and Proteomics - Lecture 6 - Matthias Trost Newcastle University matthias.trost@ncl.ac.uk Previously Quantitation techniques Label-free TMT SILAC Peptide identification and FDR 194 Lecture
Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs
Technical Overview Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs Authors Stephen Madden, Crystal Cody, and Jungkap Park Agilent Technologies, Inc. Santa Clara, California,
Supplementary information
Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary
Perform reproducible immunoprecipitation in less than 40 minutes
Perform reproducible immunoprecipitation in less than 40 minutes Dynabeads products Immunoprecipitation made easy with low nonspecific binding, high yield, and reproducibility Magnetic beads have become
Rab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
Nature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
Instructions SILAC Protein Quantitation Kits
Instructions SILAC Protein Quantitation Kits CIL Catalog No. Description DMEM LYS C SILAC Protein Quantitation Kit DMEM (Dulbecco s Modified Eagle s Medium) Kit contains: SILAC DMEM Media, 2 x 500 ml Dialyzed
Confident Protein ID using Spectrum Mill Software
Welcome to our E-Seminar: Confident Protein ID using Spectrum Mill Software Slide 1 Spectrum Mill Informatics Software Start with batches of raw MS data! Sp ec t ru m Mi ll Biologist-friendly answers!
BIBC 103 Letter Grade Credit by Examination. Student Information Sheet
BIBC 103 Letter Grade Credit by Examination Student Information Sheet This exam is a comprehensive test of the concepts, skills, competencies learned in the BIBC 103 (Biochemical Techniques) course. It
BIBC 103 Learning Goals with Supporting Learning Outcomes
BIBC 103 Learning Goals with Supporting Learning Outcomes 1) Basic Lab Skills A. Conceptual understanding and moderate level of hands-on proficiency in making laboratory solutions, including understanding
special offers from your protein biology resource
special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research
Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg
![Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg](/thumbs/88/115416970.jpg "Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg")
Product Datasheet Histone H4 [Dimethyl Lys20] Antibody NB21-2089SS Unit Size: 0.025 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related
Use of a Label-Free Quantitative Platform Based on MS/MS Average TIC to Calculate Dynamics of Protein Complexes in Insulin Signaling
ABRF 2009 SELECTED PRESENTATIONS Use of a Label-Free Quantitative Platform Based on MS/MS Average TIC to Calculate Dynamics of Protein Complexes in Insulin Signaling Xuemei Yang, 1 Adam Friedman, 2 Shailender
11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
Application Note 18 RNA/DNA/Protein Sample Preparation METHODS AND MATERIALS INTRODUCTION
Application Note 18 /DNA/Protein Sample Preparation Sequential Purification of, DNA and Protein from a Single Sample using 's /DNA/Protein Purification Kit and Comparison to a Market B. Lam, PhD 1, C.
Mannen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Mannen et al., http ://www.jcb.org /cgi /content /full /jcb.201601024 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Characterization of SNB components. (A) SNB localization of Venus-tagged
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog
Figure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy
A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb
Molecular Techniques. 3 Goals in Molecular Biology. Nucleic Acids: DNA and RNA. Disclaimer Nucleic Acids Proteins
Molecular Techniques Disclaimer Nucleic Acids Proteins Houpt, CMN, 9-30-11 3 Goals in Molecular Biology Identify All nucleic acids (and proteins) are chemically identical in aggregate - need to identify