Microtubule Assembly Dynamics at the Nanoscale
|
|
- Philippa Tyler
- 6 years ago
- Views:
Transcription
1 Microtubule Assembly Dynamics at the Nanoscale Melissa K. Gardner, Henry T. Schek III*, Alan J. Hunt, and David J. Odde Department of Biomedical Engineering, University of Minnesota, Minneapolis, MN *European Molecular Biology Laboratory, Meyerhofstrasse 1, Heidelberg Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 4819.
2 Observation of microtubule assembly at the nanoscale Observation of microtubule assembly at the nanoscale. (A) Schematic top view of the experimental geometry. A dynamic microtubule extension polymerizes from a beadlinked microtubule seed. The bead is held in the optical trap (magenta) such that when the growing microtubule contacts the barrier (gray), it polymerizes against the force of the trap. (B) Differential interference contrast micrograph of an experiment showing the bead, microtubule, and barrier. (C) Applying a force clamp allows an approximately constant load to be maintained at the microtubule tip.
3 Simulation of microtubule assembly at the nanoscale Simulated MT Length (nm) A B C D E Simulated MT Length (nm) A B Time (sec) Simulated MT Length Number of GTP Subunits C D E Number of GTP Subunits Simulation of microtubule assembly at the nanoscale At time (A), the microtubule tip has a multiprotofilament extension with a relatively long and spatially-distributed GTP cap (magenta) of 35 subunits on average. The leading protofilaments then depolymerize and recap, resulting in a growth-phase shortening event, as shown in (B). Note that the GTP cap remains intact, never being less than 2 GTPtubulin subunits during the shortening phase. Subsequently, the microtubule polymer continues growth, as shown in (C). Catastrophe occurs after 1 sec, as shown in (D-E), at which point the GTP cap has only 3 subunits on average.
4 A Microtubule assembly at the nanoscale 12 Experimental, GTP-Tubulin Simulation, GTP-Tubulin Experimental, GMPCPP Tubulin Simulation, GMPCPP Tubulin Bead Position (nm) (detail below) Time (sec) B Quantification of Microtubule Assembly at the Nanoscale Shortening Excursion:.4 sec, -32 nm Bead Position (nm) Time (sec) Growth Excursion:.9 sec, +55 nm Single time Increment:.1 sec, +5 nm Microtubule assembly at the nanoscale. (A) Experimental and simulated individual traces of microtubule plus-end assembly behavior at 1.5 pn clamp force are shown as compared to GMP- CPP control traces. Slow net assembly at the microtubule tip is highly variable both experimentally and in simulation. There are clearly retreats during microtubule assembly that are larger than a single layer of tubulin subunits, or even a few layers. (B) To quantify the variability in microtubule assembly, growth and shortening excursions are defined as the total number of consecutive displacements in either the positive or the negative direction (shown by green and red arrows, respectively).
5 Microtubule assembly is highly variable, with frequent growth-phase shortening events Shortening and Growth Excursions at Clamp Force = -1 pn.16-1 pn Force Data, n=7617 excursions.14.5 pn GMPCPP Control, n=1733 excursions Frequency Shortening Simulation, -1 pn Force, n=1671 excursions Growth.4.2 < >48 Microtubule Excursion Length (nm) Microtubule assembly is highly variable, with frequent growth-phase shortening events. A histogram of microtubule growth-phase excursion lengths for -1 pn force clamp as compared to GMP-CPP controls. Excursion lengths are defined in this analysis as sequential negative or positive microtubule length changes (no fitting), as shown in previous slide. Growth-phase shortening events are large compared to GMP-CPP controls, indicating that experimental noise cannot account for the observed behavior. The model qualitatively accounts for the extent of positive and negative excursions (red)
6 Single-Layer GTP-Cap Simulations Do Not Reproduce Nanoscale Microtubule Assembly Data Lateral Cap Model Simulations vs Experiment Frequency pn Force Data, n=7617 excursions.5 pn GMPCPP Control, n=1733 excursions Simulation, Lateral Cap Model, n=583 excursions < >48 Microtubule Excursion Length (nm) Lateral Cap model simulations as compared to nanoscale experimental microtubule assembly data. The single-layer lateral GTP-cap model is unable to account for the large fluctuations in nanoscale microtubule assembly that are observed experimentally.
7 Single time increment sampling demonstrates single subunit addition Single Time Increments (.1 sec): -2.5 pn Clamp Force Frequency Polymerizing MTs, n=16,762 Increments GMP-CPP Controls, n=2442 Increments Simulation, n=1372 Increments MT Increment Length (nm) Single.1 second time increment sampling demonstrates that tubulin dimers add as single subunits, not oligomers. Single time microtubule length increments are summarized for individual time steps during assembly. Both GTP microtubules and GMP-CPP control microtubules show small, Gaussian-distributed length fluctuations at single time steps, indicating that tubulin oligomer addition and loss is highly unlikely. The increments in the presence of GTP are larger than in GMP- CPP controls, and the model accounts for the extent of fluctuations observed experimentally while assuming that tubulin addition occurs via single subunits only.
8 Growth Velocity depends weakly on force Microtubule Growth Velocity vs Clamp Force MT Growth Velocity (nm/sec) Experimental Force-Clamp Data Simulated Force-Clamp Data Linear Fit to Experimental Data Clamp Force (pn) Growth velocity depends weakly on force. Microtubule growth velocity is weakly dependent on force both in simulation and experiment. The high variability is the result of variability in assembly at the nanoscale.
9 Conclusions Microtubule assembly observed at unprecedented temporal and spatial resolution reveals highly variable assembly behavior at the nanoscale. Microtubule shortening excursions of multiple GTP-tubulin layers are common during assembly, suggesting that the commonly accepted single layer cap model for microtubule dynamic instability requires reevaluation. Simulations that rely on an exponentially distributed GTP-Cap qualitatively reproduce the experimentally observed variability in microtubule growth. Simulations that rely on a single-layer GTP-Cap do not reproduce the experimentally observed variability in microtubule growth. Microtubule assembly variability is not due to incorporation and loss of tubulin oligomers. Single time-step addition and loss events correlate to single tubulin subunit addition and loss. Microtubule growth velocity is weakly dependent on force.
Dissociation of the Tubulin-sequestering and Microtubule Catastrophe-promoting Activities of Oncoprotein 18/Stathmin
Molecular Biology of the Cell Vol. 10, 105 118, January 1999 Dissociation of the Tubulin-sequestering and Microtubule Catastrophe-promoting Activities of Oncoprotein 18/Stathmin Bonnie Howell,* Niklas
More informationAcetylated Microtubules Are Preferentially Bundled Leading to Enhanced
Biophysical Journal, Volume 113 Supplemental Information Acetylated Microtubules Are Preferentially Bundled Leading to Enhanced Kinesin-1 Motility Linda Balabanian, Christopher L. Berger, and Adam G. Hendricks
More informationCell cycle oscillations
Positive and negative feedback produce a cell cycle Fast Slow Cell cycle oscillations Active Cdk1-Cyclin Inactive Cdk1-Cyclin Active APC 1 Ubiquitin mediated proteolysis Glycine Isopeptide bond Lysine
More informationMicrotubules. Forms a sheet of protofilaments that folds to a tube Both tubulins bind GTP
Microtubules Polymerize from a-tubulin/ß-tubulin dimers Hollow tube of 13 protofilaments In vitro- filament number varies In vivo- always 13 protofilaments Forms a sheet of protofilaments that folds to
More informationBME Engineering Molecular Cell Biology. The Cytoskeleton (I): Actin The Cytoskeleton (II): Microtubule & Intermediate Filament
BME 42-620 Engineering Molecular Cell Biology Lecture 09: The Cytoskeleton (I): Actin The Cytoskeleton (II): Microtubule & Intermediate Filament BME42-620 Lecture 09, September 27, 2011 1 Outline Overviewofcytoskeletal
More informationSection 10. Junaid Malek, M.D.
Section 10 Junaid Malek, M.D. Cell Division Make sure you understand: How do cells know when to divide? (What drives the cell cycle? Why is it important to regulate this?) How is DNA replication regulated?
More informationPeakForce Tapping and ScanAsyst An introduction to the technique featuring Bruker s Dimension Edge. Bede Pittenger, Ph.D.
PeakForce Tapping and ScanAsyst An introduction to the technique featuring Bruker s Dimension Edge Bede Pittenger, Ph.D. Dimension Edge with ScanAsyst: High performance AFM breaking down cost and productivity
More informationThree major types of cytoskeleton
The Cytoskeleton Organizes and stabilizes cells Pulls chromosomes apart Drives intracellular traffic Supports plasma membrane and nuclear envelope Enables cellular movement Guides growth of the plant cell
More informationChapter 15. Cytoskeletal Systems. Lectures by Kathleen Fitzpatrick Simon Fraser University Pearson Education, Inc.
Chapter 15 Cytoskeletal Systems Lectures by Kathleen Fitzpatrick Simon Fraser University Table 15-1 - Microtubules Table 15-1 - Microfilaments Table 15-1 Intermediate Filaments Table 15-3 Microtubules
More informationPolyamine Sharing between Tubulin Dimers Favours Microtubule Nucleation and Elongation via Facilitated Diffusion
Polyamine Sharing between Tubulin Dimers Favours Microtubule Nucleation and Elongation via Facilitated Diffusion Alain Mechulam 1,2, Konstantin G. Chernov 1,2,3, Elodie Mucher 1,2, Loic Hamon 1,2, Patrick
More informationT HE term "dynamic instability" describes microtubule
Published Online: 1 October, 1988 Supp Info: http://doi.org/10.1083/jcb.107.4.1437 Downloaded from jcb.rupress.org on April 6, 2018 Dynamic Instability of Individual Microtubules Analyzed by Video Light
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationFluorescence Imaging with One Nanometer Accuracy Lab
I. Introduction. Fluorescence Imaging with One Nanometer Accuracy Lab Traditional light microscope is limited by the diffraction limit of light, typically around 250 nm. However, many biological processes
More informationFinal exam. Please write your name on the exam and keep an ID card ready.
Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an
More informationComparison of Recharge Estimation Methods Used in Minnesota
Comparison of Recharge Estimation Methods Used in Minnesota by Geoffrey Delin, Richard Healy, David Lorenz, and John Nimmo Minnesota Ground Water Association Spring Conference Methods for Solving Complex
More informationNano-Scale Engineering III Bio-Molecular Motors for Engineering
Nano-Scale Engineering III Bio-Molecular Motors for Engineering Y. C. Lee Department of Mechanical Engineering University of Colorado Boulder, CO 80309-0427 leeyc@colorado.edu March 4, 2014 1 MLD of Hybrid
More informationMICROINDENTATION & FRACTURE OF MINERAL ROCK
MICROINDENTATION & FRACTURE OF MINERAL ROCK Prepared by Jorge Ramirez 6 Morgan, Ste156, Irvine CA 92618 P: 949.461.9292 F: 949.461.9232 nanovea.com Today s standard for tomorrow s materials. INTRO The
More informationActive Transport by Biomolecular Motors: A New Tool for Nanotechnology
Active Transport by Biomolecular Motors: A New Tool for Nanotechnology H. Hess, C. Brunner, J. Clemmens, K. H. Ernst, T. Nitta, S. Ramachandran, R.Tucker, D. Wu and V. Vogel Dep. of Bioengineering, University
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationChromosome Congression by Kinesin-5 Motor-Mediated Disassembly of Longer Kinetochore Microtubules
Chromosome Congression by Kinesin-5 Motor-Mediated Disassembly of Longer Kinetochore Microtubules Melissa K. Gardner, 1 David C. Bouck, 2 Leocadia V. Paliulis, 2 Janet B. Meehl, 3 Eileen T. O Toole, 3
More informationTubulin Polymerization Assay Kit
The Protein Experts Manual Cytoskeleton, Inc. V 3.0 Tubulin Polymerization Assay Kit Cat. # BK006P cytoskeleton.com Phone: (303) 322.2254 Fax: (303) 322.2257 Customer Service: cserve@cytoskeleton.com Technical
More informationCGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS
5 CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 29 Supplementary Figure 1 Sequence of the DNA primer/template pair used in Figure 1bc. A 23nt primer is
More informationSlow DNA Transport through Nanopores in Hafnium Oxide Membranes
Slow DNA Transport through Nanopores in Hafnium Oxide Membranes Joseph Larkin, Robert Henley, David C. Bell, Tzahi Cohen-Karni, # Jacob K. Rosenstein, and Meni Wanunu * Departments of Physics and Chemistry/Chemical
More informationCollege of Science and Engineering. Project Title: Development of a High-Resolution Virtual Wind Simulator for Optimal Design of Wind Energy Projects
Twin Cities Campus Saint Anthony Falls Laboratory Engineering, Environmental, Biological and Geophysical Fluid Dynamics College of Science and Engineering Mississippi River at 3 rd Avenue S.E. Minneapolis,
More informationMicro Laser Assisted Machining (µ-lam) of Semiconductors and Ceramics. Machining Direction
Micro Laser Assisted Machining (µ-lam) of Semiconductors and Ceramics John Patten, Director, Manufacturing Research Center Western Michigan University Machining Direction IR laser Machining Direction Work
More informationTension directly stabilizes reconstituted. kinetochore-microtubule attachments
SUPPLEMENTARY INFORMATION Tension directly stabilizes reconstituted kinetochore-microtubule attachments Bungo Akiyoshi, Krishna K. Sarangapani, Andrew F. Powers, Christian R. Nelson, Steve L. Reichow,
More informationLabel-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis
Introduction APPLICATION NOTE IncuCyte Live-Cell Analysis System Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis Susana L. Alcantara, Miniver Oliver, Kalpana Patel,
More informationBiomolecular motors at the intersection of. nanotechnology and polymer science
Biomolecular motors at the intersection of nanotechnology and polymer science Ashutosh Agarwal 1 and Henry Hess 2 * 1 Department of Materials Science and Engineering, University of Florida, Gainesville,
More informationLabChip GXII: Antibody Analysis
WHITE PAPER LabChip GXII: Antibody Analysis Antibody Analysis using microfluidic technology in high throughput Quality by Design Experiments Abstract Current initiatives in Process Analytical Technology
More informationOscillating Channels and Sensors ONR/DARPA Julie E. M. McGeoch and Guido Guidotti 1998
Oscillating Channels and Sensors ONR/DARPA Julie E. M. McGeoch and Guido Guidotti 1998 Impact New biological-electronic interface. Compact, rapid sensor of agents. Protection of personnel. Detection of
More informationIN-VITRO ACCELERATED FATIGUE TESTING PROTOCOL
IN-VITRO ACCELERATED FATIGUE TESTING PROTOCOL THIS IS A TEST PLAN FOR ACCLERATED, TORSIONAL FATIGUE TESTING OF COMPANY DEVICES. THE DURATION OF THIS TEST SIMULATES 10 YEARS OF IMPLANTATION LIFE. AUTHOR:
More informationCrush Performance of Thin Walled Spot-Welded and Weld-Bonded Sections
Crush Performance of Thin Walled Spot-Welded and Weld-Bonded Sections Paul Davidson*, M.S Engineering Prof. Donald Malen University of Michigan, Ann Arbor, MI 48109 *pauldave@umich.edu Acknowledgement
More informationChromosome segregation depends upon the action of the
Model for anaphase B: Role of three mitotic motors in a switch from poleward flux to spindle elongation I. Brust-Mascher, G. Civelekoglu-Scholey, M. Kwon, A. Mogilner, and J. M. Scholey* Laboratory of
More informationLife cycle of MTs: persistent growth in the cell interior, asymmetric transition frequencies and effects of the cell boundary
Research Article 3527 Life cycle of MTs: persistent growth in the cell interior, asymmetric transition frequencies and effects of the cell boundary Yulia A. Komarova 1,2, *, Ivan A. Vorobjev 2 and Gary
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationTruePrime Single Cell WGA Kit
TruePrime SINGLE CELL WGA KIT HANDBOOK TruePrime Single Cell WGA Kit INDEX Legal...4 Intended use...4 Kit contents...5 Shipping and storage...5 Handling...6 Quality control...6 Reagents and equipment to
More informationLASER WELDING OF AM60 MAGNESIUM ALLOY
Magnesium Technology 2004 Edited by Alan A. Luo TMS (The Minerals, Metals & Materials Society), 2004 LASER WELDING OF AM60 MAGNESIUM ALLOY Ashish K. Dasgupta 1 and Jyoti Mazumder 1 1 CLAIM, University
More informationNanoindentation, Scratch and nanodma : Innovations for Atomic Force Microscopes. Ryan Stromberg
Nanoindentation, Scratch and nanodma : Innovations for Atomic Force Microscopes Ryan Stromberg 09-07-2017 2 Outline Hysitron TriboScope Technology Mechanical Testing Indenter Stylus vs. AFM Cantilever
More informationUrine Protein Electrophoresis and Immunoelectrophoresis Using Unconcentrated or Minimally Concentrated Urine Samples
Immunopathology / Electrophoresis of Unconcentrated Urine Samples Urine Protein Electrophoresis and Immunoelectrophoresis Using Unconcentrated or Minimally Concentrated Urine Samples Anja C. Roden, MD,
More informationHow Microtubules Get Fluorescent Speckles
Biophysical Journal Volume 75 October 1998 2059 2069 2059 How Microtubules Get Fluorescent Speckles Clare M. Waterman-Storer and E. D. Salmon Department of Biology, University of North Carolina, Chapel
More informationBASE MATERIALS Through Assembly
Thermal Analysis of BASE MATERIALS Through Assembly Can current analytical techniques predict and characterize differences in laminate performance prior to exposure to thermal excursions during assembly?
More information4.4 Single Load Path Structure
4.4 Single Load Path Structure For a single load path structure, the only means to protect the safety is to prevent the damage growth from degrading the strength of the structure to less than the design
More informationInvestigating Protein Stability with the Optical Tweezer
Investigating Protein Stability with the Optical Tweezer I. Introduction. Various experimental and computational techniques have been developed to study the process by which proteins go from a linear sequence
More informationNANO SCRATCH TESTING OF THIN FILM ON GLASS SUBSTRATE
NANO SCRATCH TESTING OF THIN FILM ON GLASS SUBSTRATE Prepared by Jesse Angle 6 Morgan, Ste156, Irvine CA 92618 P: 949.461.9292 F: 949.461.9232 nanovea.com Today's standard for tomorrow's materials. 2010
More informationDynamics of Mitotic Microtubules in Fission Yeast
University of Colorado, Boulder CU Scholar Undergraduate Honors Theses Honors Program Spring 2017 Dynamics of Mitotic Microtubules in Fission Yeast Patrick Flynn pafl9640@colorado.edu Follow this and additional
More informationEDGE CHIPPING RESISTANCE USING MACROINDENTATION TESTING
EDGE CHIPPING RESISTANCE USING MACROINDENTATION TESTING Prepared by Ali Mansouri 6 Morgan, Ste156, Irvine CA 92618 P: 949.461.9292 F: 949.461.9232 nanovea.com Today's standard for tomorrow's materials.
More informationImage Analysis of Kevlar 49 Fabric at High Strain Rate
Proceedings of the XIth International Congress and Exposition June -5, 8 Orlando, Florida USA 8 Society for Experimental Mechanics Inc. Image Analysis of Kevlar 49 Fabric at High Strain Rate Deju Zhu (),
More informationApplication Note #124 VITA: Quantitative Nanoscale Characterization and Unambiguous Material Identification for Polymers
Local thermal analysis identifies polymer AFM image of polymer blend Application Note #124 VITA: Quantitative Nanoscale Characterization and Unambiguous Material Identification for Polymers VITA module
More informationSupplemental Information. Glutamylation Regulates Transport, Specializes. Function, and Sculpts the Structure of Cilia
Current Biology, Volume 27 Supplemental Information Glutamylation Regulates Transport, Specializes Function, and Sculpts the Structure of Cilia Robert O'Hagan, Malan Silva, Ken C.Q. Nguyen, Winnie Zhang,
More informationStabilization of Microtubules by Tubulin-GDP-Pi Subunits?
8136 Biochemistry 1989, 28, 8 136-8 141 Stabilization of Microtubules by Tubulin-GDP-Pi Subunits? M. Caplow,* R. Ruhlen, J. Shanks, R.. Walker, and E. D. Salmon Departments of Biochemistry and Biology,
More informationIntroduction: The eukaryotic cytoskeleton and actin-microtubule coordination
Chapter 1 Introduction: The eukaryotic cytoskeleton and actin-microtubule coordination In this introductory chapter we first outline the general properties of the three eukaryotic cytoskeletal systems:
More informationMicrotubule Minus-End Stabilization by Polymerization-Driven CAMSAP Deposition
Article Microtubule Minus-End Stabilization by Polymerization-Driven CAMSAP Deposition Kai Jiang, 1 Shasha Hua, 1 Renu Mohan, 1 Ilya Grigoriev, 1 Kah Wai Yau, 1 Qingyang Liu, 1,2 Eugene A. Katrukha, 1
More informationEVALUATION A PRACTICAL APPROACH FOR COMMUNITY HEALTH PROGRAMS ERIN A. BILLS, MPH
EVALUATION A PRACTICAL APPROACH FOR COMMUNITY HEALTH PROGRAMS ERIN A. BILLS, MPH ERIN A. BILLS, MPH Project Coordinator, Montana Office of Rural Health and Area Health Education Center Background in biology,
More informationRate Dependency Plastic Modeling
Rate Dependency Plastic Modeling Hubert Lobo expert material testing CAE material parameters CAE Validation software & infrastructure for materials materials knowledge electronic lab notebooks Considerations
More informationModeling Component Assembly of a Bearing Using Abaqus
Modeling Component Assembly of a Bearing Using Abaqus Bisen Lin, Ph.D., P.E. and Michael W. Guillot, Ph.D., P.E. Stress Engineering Services, Inc. Abstract: Assembly process of a bearing considered in
More informationAssembly of synapses by neuronal adhesion molecules: single molecule studies
Assembly of synapses by neuronal adhesion molecules: single molecule studies Olivier Thoumine Interdisciplinary Institute of Neurosciences CNRS - University of Bordeaux Connectivity in the brain 300 nm
More informationEFFECTS OF CYSTEINE MODIFICATION ON MICROTUBULE-MOTOR FUNCTION AND TUBULIN ASSEMBLY. by Kalmia Kniel Phelps
EFFECTS OF CYSTEINE MODIFICATION ON MICROTUBULE-MOTOR FUNCTION AND TUBULIN ASSEMBLY by Kalmia Kniel Phelps Thesis submitted to the faculty of the Virginia Polytechnic Institute and State University in
More informationOptical Fiber Sensors for Biomedical Applications
Optical Fiber Sensors for Biomedical Applications Xingwei (Vivian) Wang, Ph.D. Assistant Professor Department of Electrical and Computer Engineering University of Massachusetts Lowell Phone: (978) 934-1981
More informationPart I. Progress toward the Total Synthesis of Tubulysin Analogs
Part I. Progress toward the Total Synthesis of Tubulysin Analogs Zhiyong Wang Research Topic Presentation September 16, 2006 Ac S Ph C Four Stage of a Cell Cycle G1-S-G2-M A General Look at the Cell Cycle
More informationBottleneck Detection of Manufacturing Systems Using Data Driven Method
Proceedings of the 2007 IEEE International Symposium on Assembly and Manufacturing Ann Arbor, Michigan, USA, July 22-25, 2007 MoB2.1 Bottleneck Detection of Manufacturing Systems Using Data Driven Method
More informationUniversity of Michigan
University of Michigan Department of Mechanical Engineering Low-cost Non-invasive Diagnosis of Malaria Infected Red Blood Cells Han Yu Undergraduate Student Department of Electrical Engineering and Computer
More informationMECHANICAL PROPERTIES
MECHANICAL PROPERTIES Dynamic S.C. BAYNE, 1 J.Y. Thompson 2 1 University of Michigan School of Dentistry, Ann Arbor, MI 48109-1078 sbayne@umich.edu 2 Nova Southeastern College of Dental Medicine, Ft. Lauderdale,
More informationELASTOMER RATE-DEPENDENCE: A TESTING AND MATERIAL MODELING METHODOLOGY
Paper # 11 ELASTOMER RATE-DEPENDENCE: A TESTING AND MATERIAL MODELING METHODOLOGY By Tod Dalrymple* and Jaehwan Choi DASSAULT SYSTÈMES SIMULIA CORP. Great Lakes Region Northville, Michigan and Kurt Miller
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationThe Rheological Characterization of Materials for Biomedical Applications
The Rheological Characterization of Materials for Biomedical Applications Stephen H. Spiegelberg Presented at the TA Instruments User Meeting Newport, RI 2006 Cambridge Polymer Group, Inc. Testing, Consultation,
More informationDigital resolution enhancement in surface plasmon microscopy
Digital resolution enhancement in surface plasmon microscopy I.I. Smolyaninov 1) *, J. Elliott 2), G. Wurtz 2), A.V. Zayats 2), C.C. Davis 1) 1) Department of Electrical and Computer Engineering, University
More informationSupplementary Info. Directed Enzymatic Activation of 1-D DNA Tiles
Supplementary Info Directed Enzymatic Activation of 1-D DNA Tiles Sudhanshu Garg,, Harish Chandran,, Nikhil Gopalkrishnan,, Thomas H. LaBean,, and John Reif Department of Computer Science, Duke University,
More informationHigh-throughput and Sensitive Size Exclusion Chromatography (SEC) of Biologics Using Agilent AdvanceBio SEC Columns
High-throughput and Sensitive Size Exclusion Chromatography (SEC) of Biologics Using Agilent AdvanceBio SEC Columns Agilent AdvanceBio SEC 3 Å, 2.7 µm columns Application note Bio-Pharmaceutical Author
More informationContribution of plus and minus end pathways to microtubule turnover
Journal of Cell Science 112, 2277-2289 (1999) Printed in Great Britain The Company of Biologists Limited 1999 JCS0417 2277 Contribution of plus and minus end pathways to microtubule turnover I. A. Vorobjev
More informationT50 MODULE OPTIONS. 60 x 39 x 62cm
TRIBOMETERS The Tribometers provide highly accurate and repeatable wear and friction testing compliant to ISO and ASTM standards. Now available as a stand alone dual controlled load or traditional desktop
More informationUltrahydrogel Columns
CONTENTS I. INTRODUCTION II. INSTALLATION a. Solvents b. Column c. Organic solvents d. Aqueous salt and buffer solution e. Flow rate f. Solvent and sample preparation g. Guard columns h. Column installation
More informationCell cycle oscillations. Active Cdk1-Cyclin Inactive Cdk1-Cyclin Active APC
Cell cycle oscillations Active Cdk1-Cyclin Inactive Cdk1-Cyclin Active APC 20 Ubiquitin mediated proteolysis Glycine Isopeptide bond Lysine Many biological processes are regulated by controlling the stability
More informationExperiment 2b X-Ray Diffraction* Optical Diffraction Experiments
* Experiment 2b X-Ray Diffraction* Adapted from Teaching General Chemistry: A Materials Science Companion by A. B. Ellis et al.: ACS, Washington, DC (1993). Introduction Inorganic chemists, physicists,
More informationDynamic Nanoindentation Characterization: nanodma III. Ude Hangen, Ph.D
Dynamic Nanoindentation Characterization: nanodma III Ude Hangen, Ph.D. 2017-11-02 Displacement 11/02/2017 Bruker Confidential 2 nm mm mm Outline Elastic-Plastic vs. Viscoelastic Materials Response nanodma
More informationAn Evaluation of the SMART Paratransit Phone Reservation System
An Evaluation of the SMART Paratransit Phone Reservation System Presented at the 1998 ITS America Annual Meeting Thomas B. Reed Assistant Research Scientist, ITS Research Laboratory 215 Engineering Programs
More informationFlow Induced Vibration A Review of Current Assessment Methods
Flow Induced Vibration A Review of Current Assessment Methods David Fielding, Matt Straw (Norton Straw Consultants) Alex Graham, Phil Shorter (CD-adapco) Introduction Presenting a joint study into flow-induced
More informationSections 5 & 6. Site Characterization and Lines of Evidence. Steve Posten
Sections 5 & 6 Site Characterization and Lines of Evidence Steve Posten Overview Section 5 Site Characterization Conceptual site model Aquifer characteristics Hydraulic conductivity/gradient Porosity Organic
More informationImpact Tester. Ball Drop Easy operating falling dart instrument according ASTM D 1709 and ISO Instruments for mechanical testing.
Ball Drop Easy operating falling dart instrument according ASTM D 1709 and ISO 7765-1 This testing instrument covers the determination of the energy that causes plastic film to fail under specified conditions
More informationSI8000 Live Cell Imaging System
SI8000 Live Cell Imaging System Sony Biotechnology Inc. SI8000 Cell Motion Imaging System The Sony SI8000 Live Cell Imaging System detects and quantifies cellular motion using proprietary video processing
More informationPerformance Assessment of Corrosion Prevention Compounds Using Laboratory Tests
Performance Assessment of Corrosion Prevention Compounds Using Laboratory Tests L. B. Simon 1, R. G. Kelly 2, F. Gui 2, J. M. Williams 3, K. Furrow 3 1 S & K Technologies, Dayton, OH 2 University of Virginia,
More informationMethods of Characterizing Neural Networks
Methods of Characterizing Neural Networks Ashley Nord University of Minnesota Minneapolis, MN 55414 Advisors: Katsushi Arisaka, Adrian Cheng University of California Los Angeles Los Angeles, CA 90024 September
More informationUniversity of Groningen
University of Groningen by Recruiting Tubulin Dimers to the Microtubule Bassam, Jawdat Al-; Kim, Hwajin; Brouhard, Gary; van Oijen, Antonius; Harrison, Stephen C.; Chang, Fred Published in: Developmental
More informationVisco-elastic model of the fuzz growth (P64B)
Visco-elastic model of the fuzz growth (P64B) S. I. Krasheninnikov* University California San Diego, La Jolla, CA 92093, USA PACS numbers: 47.55.dd, 52.40.Hf Abstract The visco-elastic model of fuzz growth
More informationIntroduction to N-STORM
Introduction to N-STORM Dan Metcalf Advanced Imaging Manager Outline Introduction Principles of STORM Applications N-STORM overview Biological Scale Mitochondrion Microtubule Amino Acid 1Å Kinesin 1nm
More informationBackground Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy
Background Correction and Normalization Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Feature Level Data Outline Affymetrix GeneChip arrays Two
More informationSeparate and Quantify Rituximab Aggregates and Fragments with High-Resolution SEC
Separate and Quantify Rituximab Aggregates and Fragments with High-Resolution SEC The Agilent 126 Infinity Bio-Inert Quaternary LC System and the AdvanceBio SEC 3Å, 2.7 µm Column Application Note Biologics
More informationReading for lecture 11
Reading for lecture 11 1. Optical Tweezers, Myosin 2. Atomic Force Microscopy (AFM) 3. Single-Molecule Fluorescence Microscopy 4. Patch-Clamp 5. Genetic Techniques Key references are included in italics
More informationA systems approach to biology
A systems approach to biology SB200 Lecture 2 18 September 2008 Jeremy Gunawardena jeremy@hms.harvard.edu I do not hold formal office hours. Please send me an e-mail if you have questions or would like
More informationXPM: High Speed Nanoindentation and Mechanical Property Mapping. Eric Hintsala, Ph.D
XPM: High Speed Nanoindentation and Mechanical Property Mapping Eric Hintsala, Ph.D. 2017-10-05 2 Table of Contents 1. Introduction: Brief overview of nanoindentation and nanomechanical property mapping
More informationSupporting Information
Supporting Information Velocity of DNA during translocation through a solid state nanopore Calin Plesa, Nick van Loo, Philip Ketterer, Hendrik Dietz, Cees Dekker Department of Bionanoscience, Kavli Institute
More informationValidation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed
Validation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed TYLER LEFEVRE ADVISOR: DR. TAMI SIVY 1 Overview Introduction to fecal coliforms Current
More informationMaterials and Methods
Key Engineering Materials Vols. 284-286 (2005) pp 333-336 Online available since 2005/Apr/15 at www.scientific.net (2005) Trans Tech Publications, Switzerland doi:10.4028/www.scientific.net/kem.284-286.333
More informationMolecular Communication: Simulation of a Molecular Motor Communication System
Molecular Communication: Simulation of a Molecular Motor Communication System Michael Moore, Akihiro Enomoto, Tadashi Nakano, Tatsuya Suda Department of Computer Science Donald Bren School of Information
More informationMovement at the Molecular Level
Movement at the Molecular Level Diffusion: = 6 D t (D 6 π µ a) Typical numbers: 10 nm protein in water D= 10-10 m 2 /s.in cells D= 10-12 m 2 /s (D= 10-14 m 2 /s lipids) [] 1/2 =1 µm, t ~0.2
More informationCENTER FOR BRAIN EXPERIMENT
CENTER FOR BRAIN EXPERIMENT Section of Brain Structure Associate Professor: ARII, Tatsuo, PhD 1967 Graduated from Tohoku University, Faculty of Science. Completed the doctoral course in Engineering, Nagoya
More informationSize exclusion chromatography (SEC) with superficially porous (core-shell) particles
Size exclusion chromatography (SEC) with superficially porous (core-shell) particles Mark R. Schure, Inc. Blue Bell, Pennsylvania Robert E. Moran, Stephanie A. Schuster, Brian M. Wagner, Conner W. McHale
More informationIntegrated Pest Management 1: Sampling. Matthew J. Grieshop PhD Department of Entomology Michigan State University
Integrated Pest Management 1: Sampling Matthew J. Grieshop PhD Department of Entomology Michigan State University Integrated Pest Management "A decision support system for the selection and use of pest
More informationTime-resolved Measurements Using the Agilent Cary Eclipse Fluorescence Spectrophotometer A Versatile Instrument for Accurate Measurements
Time-resolved Measurements Using the Agilent Cary Eclipse Fluorescence Spectrophotometer A Versatile Instrument for Accurate Measurements Technical Overview Authors Dr. Fabian Zieschang, Katherine MacNamara,
More informationMassPREP On-Line Desalting Cartridge
CONTENTS I. INTRODUCTION II. INSTALLING THE MASSPREP ON-LINE DESALTING CARTRIDGE INTO THE SENTRY.1 X 1 MM GUARD COLUMN HOLDER III. RECOMMENDED LC/MS SYSTEM CONFIGURATION TO MINIMIZE MS SOURCE CONTAMINATION
More informationFibrin Clots Are Equilibrium Polymers That Can Be Remodeled Without Proteolytic Digestion
Supplementary Information Fibrin Clots Are Equilibrium Polymers That Can Be Remodeled Without Proteolytic Digestion Irina N. Chernysh 1, Chandrasekaran Nagaswami 1, Prashant K. Purohit 2 and John W. Weisel
More information