Structural Variant Detection in SMRT Link 5 with pbsv
|
|
- Emory Trevor Stewart
- 6 years ago
- Views:
Transcription
1 Structural Variant Detection in SMRT Link 5 with pbsv Aaron Wenger For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All rights reserved.
2 STRUCTURAL VARIANT = DIFFERENCE 50 BP Deletion Insertion Duplication Inversion Tandem Repeat Translocation
3 VARIATION BETWEEN TWO HUMAN GENOMES vs variants basepairs affected 5 Mb 3 Mb 10 Mb SNVs indels structural variants Huddleston et al. (2017) Genome Research 27(5):
4 STRUCTURAL VARIANTS DETECTED IN A HUMAN GENOME PacBio 20,000 Short reads 4,000 repeats + GC-rich + large insertions Huddleston et al. (2017) Genome Research 27(5): Seo et al. (2016) Nature 538: Sudmant et al. (2016) Nature 526:75-81.
5 SEQUENCING + ANALYSIS pbsv? Structural Variants Short reads Li and Durbin (2009) Bioinformatics 25: McKenna et al. (2010) Genome Research 20: BWA SNVs + Indels
6 3 COMPONENTS TO PBSV pbsv command line utility for top-level commands pbsvutil command line utility for detailed commands SMRT Link web interface
7 TOP-LEVEL PBSV COMMANDS pbsv generate-config [-h] [-o sv.cfg] (optional) Generate a configuration file to specify options for other stages. pbsv align [-h] [--cfg_fn sv.cfg] ref.fa subreads.bam ref.align.bam Map reads to a reference genome with a structural variant aware aligner. pbsv call [-h] [--cfg_fn sv.cfg] ref.fa ref.align.bam ref.sv.bed vcf Call structural variants from aligned reads.
8 TOP-LEVEL PBSV COMMANDS pbsv generate-config [-h] [-o sv.cfg] (optional) Generate a configuration file to specify options for other stages. pbsv align [-h] [--cfg_fn sv.cfg] ref.fa subreads.bam ref.align.bam Map reads to a reference genome with a structural variant aware aligner. pbsv call [-h] [--cfg_fn sv.cfg] ref.fa ref.align.bam ref.sv.bed vcf Call structural variants from aligned reads.
9 penalty PBSV ALIGN UTILIZES NGM-LR pbsvutil ngmlr sequencing errors (frequent & independent) structural variants (infrequent & correlated) gap size Rescheneder, Sedlazeck, and Schatz.
10 penalty penalty PBSV ALIGN UTILIZES NGM-LR BWA NGM-LR pbsvutil ngmlr sequencing errors sequencing errors structural variants structural variants gap size gap size
11 W PBSV ALIGN CHAINS CO-LINEAR ALIGNMENTS Reference X W Y W Z pbsvutil chain Read X Z X W Y W Z
12 TOP-LEVEL PBSV COMMANDS pbsv generate-config [-h] [-o sv.cfg] (optional) Generate a configuration file to specify options for other stages. pbsv align [-h] [--cfg_fn sv.cfg] ref.fa subreads.bam ref.align.bam Map reads to a reference genome with a structural variant aware aligner. pbsv call [-h] [--cfg_fn sv.cfg] ref.fa ref.align.bam ref.sv.bed vcf Call structural variants from aligned reads.
13 PBSV CALL: STAGED STRUCTURAL VARIANT CALLER FIND SV SIGNATURES CLUSTER SV SIGNATURES SUMMARIZE INTO SV GENOTYPE SV ANNOTATE SV CIGAR D & I 50 bp nearby with similar sequence consensus of supporting reads supporting reads / covering reads Alu, LINE, SVA, tandem repeat FILTER SV 2 and 20% reads support
14 PBSV CALL: STAGED STRUCTURAL VARIANT CALLER FIND SV SIGNATURES CLUSTER SV SIGNATURES SUMMARIZE INTO SV GENOTYPE SV ANNOTATE SV CIGAR D & I 50 bp nearby with similar sequence consensus of supporting reads supporting reads / covering reads Alu, LINE, SVA, tandem repeat FILTER SV 2 and 20% reads support
15 PBSV CALL: STAGED STRUCTURAL VARIANT CALLER FIND SV SIGNATURES CLUSTER SV SIGNATURES SUMMARIZE INTO SV GENOTYPE SV ANNOTATE SV CIGAR D & I 50 bp nearby with similar sequence consensus of supporting reads supporting reads / covering reads Alu, LINE, SVA, tandem repeat FILTER SV 2 and 20% reads support
16 PBSV CALL: STAGED STRUCTURAL VARIANT CALLER FIND SV SIGNATURES CIGAR D & I 50 bp CLUSTER SV SIGNATURES nearby with similar sequence SUMMARIZE INTO SV consensus of supporting reads 63 bp insertion 329 bp deletion GENOTYPE SV supporting reads / covering reads ANNOTATE SV Alu, LINE, SVA, tandem repeat FILTER SV 2 and 20% reads support
17 PBSV CALL: STAGED STRUCTURAL VARIANT CALLER FIND SV SIGNATURES CIGAR D & I 50 bp CLUSTER SV SIGNATURES nearby with similar sequence SUMMARIZE INTO SV consensus of supporting reads 63 bp insertion 329 bp deletion GENOTYPE SV supporting reads / covering reads heterozygous (1 of 10) heterozygous (4 of 10) ANNOTATE SV Alu, LINE, SVA, tandem repeat FILTER SV 2 and 20% reads support
18 PBSV CALL: STAGED STRUCTURAL VARIANT CALLER FIND SV SIGNATURES CIGAR D & I 50 bp CLUSTER SV SIGNATURES nearby with similar sequence SUMMARIZE INTO SV consensus of supporting reads 63 bp insertion 329 bp deletion GENOTYPE SV supporting reads / covering reads heterozygous (1 of 10) heterozygous (4 of 10) ANNOTATE SV Alu, LINE, SVA, tandem repeat - Alu FILTER SV 2 and 20% reads support
19 PBSV CALL: STAGED STRUCTURAL VARIANT CALLER FIND SV SIGNATURES CIGAR D & I 50 bp CLUSTER SV SIGNATURES nearby with similar sequence SUMMARIZE INTO SV consensus of supporting reads 63 bp insertion 329 bp deletion GENOTYPE SV supporting reads / covering reads heterozygous (1 of 10) heterozygous (4 of 10) ANNOTATE SV Alu, LINE, SVA, tandem repeat - Alu FILTER SV 2 and 20% reads support
20 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis
21 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis
22 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis chr ACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGA A PASS IMPRECISE;SVTYPE=DEL;END=904587;SVLEN=-97;SVANN=TANDEM GT:AD:DP 0/1:9:15
23 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis chr Deletion -97. GT:AD:DP 0/1:9:15 SVANN=TANDEM
24 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis
25 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis
26 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis
27 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis
28 3 COMPONENTS TO PBSV pbsv command line utility for top-level commands pbsvutil command line utility for detailed commands SMRT Link web interface
29 penalty ACKNOWLEDGMENTS Schatz Lab Michael Schatz Philipp Rescheneder Fritz Sedlazeck PacBio Yuan Li Chris Dunn Ben Lerch Jim Drake Nat Echols Aaron Klammer Mary Budagyan NGM-LR convex errors indels gap size
30 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All rights reserved. Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, SMRTbell, Iso-Seq, and Sequel are trademarks of Pacific Biosciences. BluePippin and SageELF are trademarks of Sage Science. NGS-go and NGSengine are trademarks of GenDx. FEMTO Pulse and Fragment Analyzer are trademarks of Advanced Analytical Technologies. All other trademarks are the sole property of their respective owners.
Jenny Gu, PhD Strategic Business Development Manager, PacBio
IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,
More informationRevolutionize Genomics with SMRT Sequencing. Single Molecule, Real-Time Technology
Revolutionize Genomics with SMRT Sequencing Single Molecule, Real-Time Technology Resolve to Master Complexity Despite large investments in population studies, the heritability of the majority of Mendelian
More informationSMRT Analysis Barcoding Overview
SMRT Analysis Barcoding Overview Introduction This document is for users with Sequel Systems using SMRT Link v5.0.0 or v5.0.1. This document covers: Barcoding designs, strategies and modes for preparing
More informationStatistics Output Guide
Statistics Output Guide Introduction This document describes the file sts.xml, which is produced by the Sequel System s primary analysis pipeline. This XML file contains the chip-level sample distribution
More informationGuidelines for Using the Sage Science Pippin Pulse Electrophoresis Power Supply System
Please note: the unsupported protocol described herein may not have been validated by Pacific Biosciences and is provided as-is and without any warranty. Use of this protocol is offered to those customers
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationVariant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD
Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Type Alkan et al, Nature Reviews Genetics 2011 doi:10.1038/nrg2958 Variant Type http://www.broadinstitute.org/education/glossary/snp
More informationAnalysis of Structural Variants using 3 rd generation Sequencing
Analysis of Structural Variants using 3 rd generation Sequencing Michael Schatz January 12, 2016 Bioinformatics / PAG XXIV @mike_schatz / #PAGXXIV Analysis of Structural Variants using 3 rd generation
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Read Complexity
Supplementary Figure 1 Read Complexity A) Density plot showing the percentage of read length masked by the dust program, which identifies low-complexity sequence (simple repeats). Scrappie outputs a significantly
More informationReference-quality diploid genomes without de novo assembly
Reference-quality diploid genomes without de novo assembly Michael Schatz January 16, 2018 PAG Bioinformatics Workshop @mike_schatz / #PAGVI Why NT de novo? De novo is necessary for the first genome of
More informationAssignment 9: Genetic Variation
Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationComprehensive Views of Genetic Diversity with Single Molecule, Real-Time (SMRT) Sequencing
Comprehensive Views of Genetic Diversity with Single Molecule, Real-Time (SMRT) Sequencing Alix Kieu Cruse November 2015 For Research Use Only. Not for use in diagnostics procedures. Copyright 2015 by
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationVariant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012
+ Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools
More informationNext-Generation Sequencing Services à la carte
Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
More informationA near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge
More informationProcedure & Checklist - Preparing Asymmetric SMRTbell Templates
Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Before You Begin In this procedure, PCR products are generated using two rounds of amplification. The first round uses target specific primers
More informationVariant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationSVMerge Output File Format Specification Sheet
SVMerge Output File Format Specification Sheet Document Number: 30165 Document Revision: C For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationVariation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI
Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationVariant detection analysis in the BRCA1/2 genes from Ion torrent PGM data
Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October
More informationDetection of Fusion Genes by Targeted Roche 454 Sequencing
Detection of Fusion Genes by Targeted Roche 454 Sequencing Hans-Ulrich Klein 1, Christoph Bartenhagen 1, Alexander Kohlmann 2, Vera Grossmann 2, Christian Ruckert 1, Torsten Haferlach 2, Martin Dugas 1
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationThe Sentieon Genomic Tools Improved Best Practices Pipelines for Analysis of Germline and Tumor-Normal Samples
The Sentieon Genomic Tools Improved Best Practices Pipelines for Analysis of Germline and Tumor-Normal Samples Andreas Scherer, Ph.D. President and CEO Dr. Donald Freed, Bioinformatics Scientist, Sentieon
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationHLA and Next Generation Sequencing it s all about the Data
HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public
More informationChang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang
Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationEnsembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
More informationCalling DNA Variants Steve Laurie Centro Nacional de Analisis Genomico (CNAG-CRG), Barcelona
Calling DNA Variants Steve Laurie Centro Nacional de Analisis Genomico (CNAG-CRG), Barcelona Variant Effect Predictor Training Course Heraklion, 31st October 2016 Calling DNA Variants - Overview 2 1. 2.
More informationSV-BET: Structure Variation Benchmarking and Evaluation Tool with Comparative Analysis of Split Read-Based Approaches
International Journal of Pharma Medicine and Biological Sciences Vol. 5, No. 4, October 2016 SV-BET: Structure Variation Benchmarking and Evaluation Tool with Comparative Analysis of Split Read-Based Approaches
More informationNUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING
NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING Ken Chen, Ph.D. kchen@genome.wustl.edu The Genome Center, Washington University in St. Louis The path
More informationRareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data.
RareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data. Adam Gudyś and Tomasz Stokowy October 30, 2017 Introduction The search for causative genetic variants in rare diseases
More informationAbout Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
More informationNext Generation Sequencing: Data analysis for genetic profiling
Next Generation Sequencing: Data analysis for genetic profiling Raed Samara, Ph.D. Global Product Manager Raed.Samara@QIAGEN.com Welcome to the NGS webinar series - 2015 NGS Technology Webinar 1 NGS: Introduction
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationApplications of PacBio Single Molecule, Real- Time (SMRT) DNA Sequencing
Applications of PacBio Single Molecule, Real- Time (SMRT) DNA Sequencing Stephen Turner November 5, 2014 FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Pacific
More informationThe SMRTer Way: Single Genes to Complex Genomes
The SMRTer Way: Single Genes to Complex Genomes Ulf Gyllensten, Professor Department of Immunology, Genetics and Pathology, Science for Life Laboratory, Uppsala University, Uppsala, Sweden Topics National
More information1.1 Post Run QC Analysis
Post Run QC Analysis 100 339 200 01 1. Post Run QC Analysis 1.1 Post Run QC Analysis Welcome to Pacific Biosciences' Post Run QC Analysis Overview. This training module will describe the workflow to assess
More informationSupplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
More informationGermline variant calling and joint genotyping
talks Germline variant calling and joint genotyping Applying the joint discovery workflow with HaplotypeCaller + GenotypeGVCFs You are here in the GATK Best PracDces workflow for germline variant discovery
More informationGenome Sequencing and Structural Variation
Genome Sequencing and Structural Variation Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #10 Today Structural Variation Deletions Duplications
More informationData processing and analysis of genetic variation using next-generation DNA sequencing!
Data processing and analysis of genetic variation using next-generation DNA sequencing! Mark DePristo, Ph.D.! Genome Sequencing and Analysis Group! Medical and Population Genetics Program! Broad Institute
More informationCreate a Planned Run. Using the Ion AmpliSeq Pharmacogenomics Research Panel Plugin USER BULLETIN. Publication Number MAN Revision A.
USER BULLETIN Create a Planned Run Using the Ion AmpliSeq Pharmacogenomics Research Panel Plugin Publication Number MAN0013730 Revision A.0 For Research Use Only. Not for use in diagnostic procedures.
More informationSurely Better Target Enrichment from Sample to Sequencer and Analysis
sureselect TARGET ENRIChment solutions Surely Better Target Enrichment from Sample to Sequencer and Analysis Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom
More informationGENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
More informationAnalysis of large deletions in human-chimp genomic alignments. Erika Kvikstad BioInformatics I December 14, 2004
Analysis of large deletions in human-chimp genomic alignments Erika Kvikstad BioInformatics I December 14, 2004 Outline Mutations, mutations, mutations Project overview Strategy: finding, classifying indels
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationSeqStudio Genetic Analyzer
SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationStructural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Structural variation Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Genetic variation How much genetic variation is there between individuals? What type of variants
More informationGenome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL)
Genome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL) Maria J. Monteros, Joann Mudge, Andrew D. Farmer, Nicholas P. Devitt, Diego A. Fajardo, Thiru Ramaraj, Xinbin Dai, Zhaohong
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationNature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
More informationMedSavant: An open source platform for personal genome interpretation
MedSavant: An open source platform for personal genome interpretation Marc Fiume 1, James Vlasblom 2, Ron Ammar 3, Orion Buske 1, Eric Smith 1, Andrew Brook 1, Sergiu Dumitriu 2, Christian R. Marshall
More informationTangram: a comprehensive toolbox for mobile element insertion detection
Wu et al. BMC Genomics 2014, 15:795 METHODOLOGY ARTICLE Open Access Tangram: a comprehensive toolbox for mobile element insertion detection Jiantao Wu 1,Wan-PingLee 1, Alistair Ward 1, Jerilyn A Walker
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationLong-read sequencing and de novo assembly of a Chinese genome
Received 23 Nov 2015 Accepted 26 May 2016 Published 30 Jun 2016 DOI: 10.1038/ncomms12065 Long-read sequencing and de novo assembly of a Chinese genome OPEN Lingling Shi 1,2,3, *, Yunfei Guo 4, *, Chengliang
More informationAlignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics
Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform
More informationSupplementary Material for
www.sciencemag.org/content/352/6281/aae0344/suppl/dc1 Supplementary Material for Long-read sequence assembly of the gorilla genome David Gordon, John Huddleston, Mark J.P. Chaisson, Christopher M. Hill,
More informationAlignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationPersonal Genomics Platform White Paper Last Updated November 15, Executive Summary
Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,
More informationGenomic solutions for complex disease
Genomic solutions for complex disease Power your with our genomic solutions Access a breadth of applications. Gain a depth of insights. To enhance their understanding of complex disease, researchers are
More informationLon Phan, Jeffrey Hsu, Le Quang Minh Tri, Michaela Willi, Tamer Mansour, Yan Kai 8,9, John Garner 1, John Lopez 1, Ben Busby 1
SOFTWARE TOOL ARTICLE dbvar structural variant cluster set for data analysis and variant comparison [version 2; referees: 2 approved] 1 2 3 4,5 6,7 Lon Phan, Jeffrey Hsu, Le Quang Minh Tri, Michaela Willi,
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Introducing the Ion S5 and Ion S5 XL systems Now, adopting next-generation sequencing in your lab is simpler than ever. The Ion S5
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.
Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a
More informationACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina
More informationSequence variation in the short tandem repeat system SE33 discovered by next generation sequencing
Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing Eszter Rockenbauer, MSc, PhD and Line Møller, MSc Forensic Geneticist Section of Forensic Genetics Department
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationBionano Access 1.1 Software User Guide
Bionano Access 1.1 Software User Guide Document Number: 30142 Document Revision: B For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights Reserved.
More informationImproving PacBio Long Read Accuracy by Short Read Alignment
Improving PacBio Long Read Accuracy by Short Read Alignment Kin Fai Au 1, Jason G. Underwood 2, Lawrence Lee 2, Wing Hung Wong 1 * 1 Department of Statistics, Stanford University, Stanford, California,
More informationWhy can GBS be complicated? Tools for filtering, error correction and imputation.
Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower
More informationNext Generation Sequencing and Bioinformatics Analysis Pipelines. Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala
GA N AT ION ALCTAC ATCA G ENOMI C SGT INF R A S T RU CTURE Next Generation Sequencing and Bioinformatics Analysis Pipelines Adam Ameur National Genomics Infrastructure SciLifeLab Uppsala adam.ameur@igp.uu.se
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationToward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationQuestion 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.
Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or
More informationHigh Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationFigure S1. Unrearranged locus. Rearranged locus. Concordant read pairs. Region1. Region2. Cluster of discordant read pairs, bundle
Figure S1 a Unrearranged locus Rearranged locus Concordant read pairs Region1 Concordant read pairs Cluster of discordant read pairs, bundle Region2 Concordant read pairs b Physical coverage 5 4 3 2 1
More informationLUMPY: A probabilistic framework for structural variant discovery
LUMPY: A probabilistic framework for structural variant discovery Ryan M Layer 1, Aaron R Quinlan* 1,2,3,4 and Ira M Hall* 2,4 1 Department of Computer Science 2 Department of Biochemistry and Molecular
More informationAccelerate precision medicine with Microsoft Genomics
Accelerate precision medicine with Microsoft Genomics Copyright 2018 Microsoft, Inc. All rights reserved. This content is for informational purposes only. Microsoft makes no warranties, express or implied,
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
More informationNGS technologies approaches, applications and challenges!
www.supagro.fr NGS technologies approaches, applications and challenges! Jean-François Martin Centre de Biologie pour la Gestion des Populations Centre international d études supérieures en sciences agronomiques
More informationCNV and variant detection for human genome resequencing data - for biomedical researchers (II)
CNV and variant detection for human genome resequencing data - for biomedical researchers (II) Chuan-Kun Liu 劉傳崑 Senior Maneger National Center for Genome Medican bioit@ncgm.sinica.edu.tw Abstract Common
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationStandard Services Price List
Director: Daniel G. Peterson Standard s Price List NOTES Prices for services conducted by IGBB personnel are all-inclusive (i.e., include personnel time/effort, reagents, instrument costs, shipping & handling,
More information