Technical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction:
|
|
- Brent Fields
- 6 years ago
- Views:
Transcription
1 Technical Note GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison Introduction: Affymetrix has launched a new 3 IVT PLUS Reagent Kit which creates hybridization ready target from total RNA samples for gene expression profiling analysis optimized for GeneChip 3' Expression Arrays. The kit is designed for sample types such as fresh or frozen tissues, cell lines and globin-reduced whole blood. It generates amplified and biotinylated complementary RNA (crna, also known as arna) from poly(a) RNA in a total RNA sample. RNA amplification is based upon linear amplification and employs T7 in vitro transcription (IVT) technology. The kit does not require any up-front removal of ribosomal RNA due to the oligo-d(t) priming strategy which primes the poly(a) tail, similar to the 3 IVT Express Kit. The 3 IVT PLUS Kit is comprised of reagents and a protocol for preparing hybridization-ready targets from 50 to 500 ng of total input RNA. Experimental Results: The experimental data presented herein is a comparison of the new 3 IVT PLUS Reagent Kit (P/N ) against the previous 3 IVT Express Reagent Kit (P/N ). We show performance equivalency for crna yields, technical reproducibility, signal correlation, and foldchange correlation (MAQC A and B samples only) using Affymetrix GeneChip Human Genome U133 Plus 2.0 (HG-U133 Plus 2.0) Arrays. Hybridization targets from both kits were prepared from the commercial total RNA samples listed in Table 1. Figure 1 shows the Agilent Bioanalyzer profiles and RNA Integrity Numbers (RIN) for each of the samples. The minimum input mass amount of 50 ng of total RNA and technical triplicates assays and arrays were performed. Following purification, crna yields were calculated based on concentration measurements from a Nanodrop spectrophotometer and crna size distributions were analyzed using an Agilent 2100 Bioanalyzer RNA 6000 Nano Kit. U133 Plus 2.0 arrays were hybridized with 50 ng/µl labeled targets per recommendations from both protocols. The resulting CEL files were quantile-normalized as a group in Expression Console 3.1 using the RMA algorithm for probeset summarization. The MAS 5.0 algorithm was used to calculate percent present (%P). Table 1: Total RNA samples used in this study RNA Description Vendor Part # MAQC A Universal Human Reference RNA Agilent MAQC B Human Brain Reference RNA Life Technologies AM6050 HeLa HeLa Cell Line Total RNA Life Technologies AM7852 LNCaP LNCaP Cell Line Total RNA Jinfiniti Biosciences LNCaP h. brain Human Brain Total RNA Life Technologies AM7962 h. liver Human Liver Total RNA Life Technologies AM7960 h. muscle Human Muscle Total RNA Life Technologies AM7982 h. placenta Human Placenta Total RNA Life Technologies AM7950
2 Average Total crna Yield (µg) Figure 1: Bioanalyzer images and RINs for the total RNA samples used in this study As seen in Figure 2, both kits generated similar crna yields from the 50 ng minimum input amount of total RNA which was sufficient for the 49- format array hybridization threshold for all samples. As seen in Table 2, the average technical reproducibility from the triplicates were greater than 0.97 and % Median Coefficient of Variation (% CV) were less than 10% which indicates excellent precision in the data. Also, % Present (% P) differed by less than 1% between kits which indicates similar detection sensitivity. Signal correlations plots for all probesets are shown in Figure 3. The signal correlations for all samples were greater than 0.95 which indicates excellent agreement between the two assays ' IVT PLUS 3' IVT Express MAQCA MAQCB HeLa LNCaP h. brain h. liver h. muscle h. placenta 50 ng Total RNA Input 16 hours IVT Incubation Figure 2: crna Yields
3 Table 2: Technical reproducibility, % Present, and % Median Coefficient of Variation Pairwise Replicate Signal Correlation (average ± standard deviation) 3' IVT 3' IVT PLUS Express %Present (average ± standard deviation) % Median CV Assay 3' IVT 3' IVT 3' IVT 3' IVT PLUS Express PLUS Express MAQC A ± ± ± ± % 7.43% MAQC B ± ± ± ± % 7.99% HeLa ± ± ± ± % 5.95% LNCaP ± ± ± ± % 7.37% h. brain ± ± ± ± % 7.60% h. liver ± ± ± ± % 8.51% h. muscle ± ± ± ± % 8.36% h. placenta ± ± ± ± % 7.02% Figure 3: Signal Intensity Correlation of All Probesets Each scatter plot shows the average RMA summarized probeset signal intensities (log 2 ) comparing the 50 ng input of the 3 IVT PLUS Kit (y-axis) to the 3 IVT Express Kit (x-axis). Since MAQC A and B samples represent a wide range of both signal and fold-change differences, we show a more in depth look at the data in the analyses that follow. As seen in Figure 4, crna lengths from the new 3 IVT PLUS Kit were slightly longer than the 3 IVT Express Kit. This gives one confidence in the data integrity since 3 IVT arrays have probesets which are, by design, closer to the 3 -end of transcripts. Summary of the metrics derived from Expression Console analysis is shown in Table 3. Overall, %P and CV metrics were comparable between the two assays while the Actin 3 /5 bias ratio is higher for 3 IVT Express Kit, in agreement with the Bioanalyzer profiles.
4 Figure 5 shows the scatter plot of average fold-change values [log(maqc A/B)] comparing the 50 ng input of the 3 IVT PLUS Kit (y-axis) to the 3 IVT Express Kit (x-axis). The Pearson Correlation Coefficient (r) calculated without filtering is and the fold-change discordance (significant p- value < and fold change > 1) is 0.44%. This demonstrates that not only were the absolute signal intensities from both assays in good agreement (Figure 3) but the ability to detect meaningful gene-level differences between two samples remains very similar. Figure 4: Assay-derived crna profiles from MAQC A and B samples Average size nucleotide [nt] was determined from 50% of the total area with region start size at 60 nt. Table 3: Expression Console analysis summary Kit 3 IVT PLUS 3 IVT Express RNA Input 50ng MAQCA 50ng MAQCB 50ng MAQCA 50ng MAQCB average ± stdev average ± stdev average ± stdev average ± stdev % Median CV 6.43% 7.29% 7.43% 7.99% % Present (MAS5) ± ± ± ± 0.50 Actin 3 /5 Ratio 1.30 ± ± ± ± 0.70 GAPDH 3 /5 Ratio 0.97 ± ± ± ± 0.08 Poly-A 3 Detection all P all P all P all P Poly-A Ratio r 2 * *3 signal intensities vs. relative ratio for each of the Poly-A Controls
5 Pearson r = Figure 5: MAQC A/B Fold-Change Correlation Conclusion: The 3 IVT PLUS and 3 IVT Express comparison data shows very high concordance on all the performance metrics for the two kits. The protocol and the workflow aspects for both the kits are extremely similar which will allow easy implementation of the new assay. This should enable users to seamlessly convert to the 3 IVT PLUS assay for their 3 Expression analysis target preparation needs.
GeneChip Expression 3 - Amplification Reagents
GeneChip Expression 3 - Amplification Reagents Two-Cycle Target Labeling Assay and Two-Cycle cdna Synthesis Kit July 2004 Outline Overview Procedural modifications Technical performance compared with a
More informationGene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit
Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit Application Note Authors Nilanjan Guha and Becky Mullinax Abstract Agilent s Low Input Quick Amp Labeling WT (LIQA WT)
More informationPerformance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System
TECHNICAL REPORT Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System FFPE specimens are routinely collected in clinical environments and are a rich source of well documented
More informationStandardized Assays and Reagents for GeneChip Expression Analysis
Standardized Assays and Reagents for GeneChip Expression Analysis Tools to take you as far as your vision. Ensure Robust, Reproducible Results with Standardized GeneChip Assays and Reagents Standardized,
More informationGeneChip Eukaryotic Small Sample Target Labeling Assay Version II *
GENE EXPRESSION MONITORING TECHNICAL NOTE GeneChip Eukaryotic Small Sample Target Labeling Assay Version II * Introduction There is an overwhelming and continuing demand for a well characterized protocol
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationThe Agilent Total RNA Isolation Kit
Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation
More informationTECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationHigh Performance Labeling Kits for cdna and Oligo Microarrays
Agilent in Life Sciences > Genomics > Proteomics > Drug Discovery > Development > QA/QC High Performance Labeling Kits for cdna and Oligo Microarrays Get more from one experiment Agilent has perfected
More informationOptimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.
Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.
More informationValidate with confidence Move forward with reliable master mixes
Validate with confidence Move forward with reliable master mixes Gene expression VeriQuest qpcr & qrt-pcr Master Mixes Genotyping NGS Cytogenetics FFPE Now validate your results with VeriQuest qpcr and
More informationALLEN Human Brain Atlas
TECHNICAL WHITE PAPER: MICROARRAY PLATFORM SELECTION FOR THE ALLEN HUMAN BRAIN ATLAS INTRODUCTION This document describes the process and rationale by which the Allen Institute for Brain Science selected
More informationAffymetrix Gene Expression Service Lab Report
Report file for #1 1 st QC of RNA quality Affymetrix Gene Expression Service Lab Report Assigned no Number we assigned Threshold User User name N/A User Sample ID Sample name that user give N/A Sample
More informationRNA Sample Quality Assessment Test for the WT-Ovation FFPE System
RNA Sample Quality Assessment Test for the WT-Ovation FFPE System TECHNICAL REPORT Introduction Gene expression analysis of clinical samples is challenging due to sample availability, amount, and integrity.
More informationComparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics
TM Comparative Analysis using the Illumina DASL assay with FFPE tissue Wendell Jones, PhD Vice President, Statistics and Bioinformatics Background EA has examined several protocol assay possibilities for
More informationAgilent RNA Spike-In Kit
Agilent RNA Spike-In Kit Agilent RNA Spike-In Kit Product Number 5188-5279 Introduction The Agilent RNA Spike-In Kit was developed to provide positive controls for monitoring the microarray workflow from
More informationValidation Study of FUJIFILM QuickGene System for Affymetrix GeneChip
Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810
More informationA Novel Process for Gene Expression Profiling of Rat and Mouse Tissues from Formalin-Fixed Paraffin-Embedded Sections Using Microarrays
A Novel Process for Gene Expression Profiling of Rat and Mouse Tissues from Formalin-Fixed Paraffin-Embedded Sections Using Microarrays Abstract This application note describes a method for extracting
More informationDownloaded from and current as of 02/01/2008
Downloaded from http://www.moleculardevices.com and current as of 02/01/2008 A Novel Process for Gene Expression Profiling of Rat and Mouse Tissues from Formalin-Fixed Paraffin-Embedded Sections Using
More informationGeneChip Eukaryotic Small Sample Preparation Technical Note
GENE EXPRESSION MONITORING TECHNICAL NOTE GeneChip Eukaryotic Small Sample Preparation Technical Note Introduction The standard GeneChip eukaryotic target labeling protocol has been used by Affymetrix
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationMicroarray Experiment Design
Microarray Experiment Design Samples used, extract preparation and labelling: AML blasts were isolated from bone marrow by centrifugation on a Ficoll- Hypaque gradient. Total RNA was extracted using TRIzol
More informationGeneChip TM 3' IVT PLUS Reagent Kit
GeneChip TM 3' IVT PLUS Reagent Kit Manual Target Preparation for GeneChip TM 3' Expression Arrays User Guide For Research Use Only. Not for use in diagnostic procedures. Information in this document is
More informationComparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05)
Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05) Purpose: to compare 3 of the commercially available
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationEvaluation with RNA ScreenTape Assays
Technical Overview Evaluation with RNA ScreenTape Assays Author Eva Graf Agilent Technologies, Inc. Waldbronn, Germany Abstract The success of library preparation for RNA sequencing workflows depends highly
More informationNew Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays
GENE EXPRESSION MONITORING TECHNICAL NOTE New Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays Introduction Affymetrix has designed new algorithms for monitoring GeneChip
More informationGene Expression Analysis with Pathway-Centric DNA Microarrays
Gene Expression Analysis with Pathway-Centric DNA Microarrays SuperArray Bioscience Corporation George J. Quellhorst, Jr. Ph.D. Manager, Customer Education Topics to be Covered Introduction to DNA Microarrays
More informationMicroarray pipeline & Pre-processing
Microarray pipeline & Pre-processing Solveig Mjelstad Olafsrud J Express Analysis Course November 2010 Some slides adapted from Christine Stansberg thank you Christine! The microarray pipeline The goal
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationRNA quality control using the Agilent 2200 TapeStation system Assessment of the RIN e quality metric
RNA quality control using the Agilent 2200 TapeStation system Assessment of the quality metric Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies Inc. Bangalore, India
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationTECH NOTE Stranded NGS libraries from FFPE samples
TECH NOTE Stranded NGS libraries from FFPE samples Robust performance with extremely degraded FFPE RNA (DV 200 >25%) Consistent library quality across a range of input amounts (5 ng 50 ng) Compatibility
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationPurification of Concentrated, High-Quality RNA from Cells and Tissues
Purification of Concentrated, High-Quality RNA from Cells and Tissues ReliaPrep RNA Cell and Tissue Miniprep Systems Don Smith, Promega Corporation Products Featured: ReliaPrep RNA Cell Miniprep System
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationUsing Lower Amounts of RNA for GE Microarray Experiments
Welcome to our E-Seminar: Using Lower Amounts of RNA for GE Microarray Experiments Chairperson: Rita Willis Slide 1 Labeling RNA for Microarray Experiments Outline Introduction Labeling, Amplification
More informationImage Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology
Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationGeneChip TM WT PLUS Reagent Kit Manual Target Preparation for GeneChip TM Whole Transcript (WT) Expression Arrays
GeneChip TM WT PLUS Reagent Kit Manual Target Preparation for GeneChip TM Whole Transcript (WT) Expression Arrays UserGuide For support visit thermofisher.com/support or email techsupport@lifetech.com
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationVolume 37, No. 5 November, Linear mrna amplification from as little as 5 ng total RNA for global gene expression analysis
BioTechniques The Journal of Laboratory Technology for Bioresearch Volume 37, No. 5 November, 2004 Linear mrna amplification from as little as 5 ng total RNA for global gene expression analysis Alan Dafforn,
More informationRNA extraction from tissue - using Bioruptor (Standard/Plus) and RNA extraction kit
RNA extraction from tissue - using Bioruptor (Standard/Plus) and RNA extraction kit Introduction Isolation of intact RNA is essential for many techniques used in gene expression analysis. Efficient disruption
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationRAPID, ROBUST & RELIABLE
Roche Sample Prep Solutions for RNA-Seq Sequence what matters RAPID, ROBUST & RELIABLE Sample P le Samp Quant ifi /QC tion ca As the first step in the NGS workflow continuum, sample prep holds the key
More informationIntegrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
More informationUser Manual. GeneChip WT PLUS Reagent Kit Manual Target Preparation for GeneChip Whole Transcript (WT) Expression Arrays
User Manual GeneChip WT PLUS Reagent Kit Manual Target Preparation for GeneChip Whole Transcript (WT) Expression Arrays For Research Use Only. Not for use in diagnostic procedures. P/N 703174 Rev. 2 Trademarks
More informationNormalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612
Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression
More informationSTATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
More informationBiology 644: Bioinformatics
Measure of the linear correlation (dependence) between two variables X and Y Takes a value between +1 and 1 inclusive 1 = total positive correlation 0 = no correlation 1 = total negative correlation. When
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationNGS Sample QC with the Agilent 2200 TapeStation. Rainer Nitsche Application Engineer Agilent Technologies, Inc.
NGS Sample QC with the Agilent 2200 TapeStation Rainer Nitsche Application Engineer Agilent Technologies, Inc. The Agilent 2100 Bioanalyzer First commercially available Lab-on-a-Chip product Introduced
More informationReal-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation
Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation
More informationMessageAmp II-Biotin Enhanced Kit
MessageAmp II-Biotin Enhanced Kit Single Round arna Amplification Kit Part Number AM1791 MessageAmp II-Biotin Enhanced Kit (Part Number AM1791) Protocol I. Introduction.......................................................
More informationSensationPlus FFPE Amplification and 3 IVT 1 Labeling Protocol
SensationPlus FFPE Amplification and 3 IVT 1 Labeling Protocol Protocol performed using the SensationPlus FFPE Amplification and 3 IVT Labeling Kit (902039 12 rxn) Dilution of Poly-A Controls Requires
More informationA Systematic Approach to Optimize Real-Time Quantitative RT-qPCR Experiments with the Agilent 2200 TapeStation System
Systematic pproach to Optimize Real-Time Quantitative RT-qPCR Experiments with the gilent TapeStation System pplication Note Nucleic cid nalysis uthor runkumar Padmanaban gilent Technologies, Inc. angalore,
More informationThe essentials of microarray data analysis
The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering
More informationAim of lecture:to get an overview of the whole process of microarrays, from study design to publication
Microarray pipeline Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Rita Holdhus Intoduction to Microarray technology September 2010 Many of the
More informationSensationPlus FFPE Amplification and WT 1 Labeling Protocol
SensationPlus FFPE Amplification and WT 1 Labeling Protocol Protocol performed using the SensationPlus FFPE Amplification and WT Labeling Kit (902042 12 rxn) Dilution of Poly-A Controls Requires the Affymetrix
More informationThe Agilent 2100 Bioanalyzer. RNA Integrity Number (RIN) A standardized approach for RNA integrity assessment. qpcr Symposium
The Agilent 2100 Bioanalyzer RNA Integrity Number (RIN) A standardized approach for RNA integrity assessment qpcr Symposium Leipzig, 2005 Marc Valer RNA LabChip kits Analysis of Total RNA Integrity 11
More informationImpact of gdna Integrity on the Outcome of DNA Methylation Studies
Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA
More informationUSER GUIDE. Encore Biotin Module Part NO. 4200
USER GUIDE Encore Biotin Module Part NO. 4200 Patents, Licensing and Trademarks 2009 2012 NuGEN Technologies, Inc. All rights reserved. The Ovation and Applause families of products and methods are covered
More informationSection 2: Eukaryotic Sample and Array Processing Rev. 3
Section 2: Eukaryotic Sample and Array Processing 701024 Rev. 3 Section 2 Contents Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2.1.3 Eukaryotic Chapter 2 Eukaryotic
More informationTechnical Note. Affymetrix GeneChip Array Evolution
GeneChip Epression Platform AFFYMETRIX PRODUCT FAMILY > RNA ARRAYS AND REAGENTS > Technical Note GeneChip Epression Platform: Comparison, Evolution, and Performance Advances in scanner technology, array
More informationAgilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
More informationThe first and only fully-integrated microarray instrument for hands-free array processing
The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining
More informationEfficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
More informationKAPA RNA HyperPrep Workflow: Recommendations and Expectations for RNA-sequencing Using Degraded Inputs
Application Note RNA-sequencing using degraded inputs KAPA RNA HyperPrep Workflow: Recommendations and Expectations for RNA-sequencing Using Degraded Inputs AUTHORS Nancy Nabilsi Senior Applications Scientist
More informationPre processing and quality control of microarray data
Pre processing and quality control of microarray data Christine Stansberg, 20.04.10 Workflow microarray experiment 1 Problem driven experimental design Wet lab experiments RNA labelling 2 Data pre processing
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationOptimizing real-time quantitative PCR experiments with the Agilent 2100 bioanalyzer. Application Note. Steffen Mueller. Abstract
Optimizing real-time quantitative PCR experiments with the Agilent 2100 bioanalyzer Application Note Steffen Mueller Abstract Agilent Equipment: Agilent 2100 bioanalyzer Stratagene Mx3005P QPCR system
More informationIncreased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit
be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality
More informationTechnical Note. Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip Scanner Introduction
GeneChip AutoLoader AFFYMETRIX PRODUCT FAMILY > > Technical Note Performance Review of the GeneChip AutoLoader for the Affymetrix GeneChip ner 3000 Designed for use with the GeneChip ner 3000, the GeneChip
More informationFunctional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq
Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste
More informationGeneChip WT Pico Reagent Kit
GeneChip WT Pico Reagent Kit Manual Target Preparation for GeneChip Whole Transcript (WT) Expression Arrays User Guide For Research Use Only. Not for use in diagnostic procedures. Information in this document
More informationSimple, Complete Workflows for Gene Expression Analysis without RNA Purification
Product Bulletin SYBR Green Cells-to-Ct Kits SYBR Green Cells-to-Ct Kits Simple, Complete Workflows for Gene Expression Analysis without RNA Purification 7 10 min total 5x 5' 5' 3' 3' 3' mrna 5' RT primer
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationReceived: 15 July 2004 Accepted: 06 October 2004
BMC Cienomics () BioMed Central Methodology article Evaluation of sense-strand mrna amplification by comparative quantitative per Loyal A Goffl, Jessica Bowers 2, Jaime Schwalm 2, Kevin Howerton 2, Robert
More informationExpression summarization
Expression Quantification: Affy Affymetrix Genechip is an oligonucleotide array consisting of a several perfect match (PM) and their corresponding mismatch (MM) probes that interrogate for a single gene.
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationTech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count
ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from
More informationHigh sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip
More informationHigh sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip
More informationIsolation of total RNA with the illustra RNAspin 96 Isolation Kit
GE Healthcare Application note 28-4070-87 AA Isolation of total RNA with the illustra RNAspin 96 Isolation Kit RNA isolation Key words: illustra total RNA microarray quantitative reverse transcription
More informationConsistency Analysis of Redundant Probe Sets on Affymetrix Three-Prime Expression Arrays and Applications to Differential mrna Processing
Consistency Analysis of Redundant Probe Sets on Affymetrix Three-Prime Expression Arrays and Applications to Differential mrna Processing Xiangqin Cui 1, Ann E. Loraine 2 * 1 Section on Statistical Genetics,
More informationGuidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationMicroarray Sample Submission - Order Form
Microarray Center Bio-Synthesis, Inc. 612 E. Main Street Lewisville, Texas 75057 800.227.0627 www.biosyn.com Microarray Sample Submission - Order Form This form is not configured for online submission,
More informationIt s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue
It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue Douglas Horejsh January 2015 Discussion Outline Non-coding RNA General Overview mirna What is it? The Future
More informationProtein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationMeasuring gene expression
Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq
More informationIsolation of High-Purity Total Cellular RNA from Muscle Tissues Using the Agilent Total RNA Isolation Mini Kit Application
Isolation of High-Purity Total Cellular RNA from Muscle Tissues Using the Total RNA Isolation Mini Kit Application Genomics Author Christopher Rizzo Technologies, Inc. 2850 Centerville Road Wilmington,
More informationreverse transcription! RT 1! RT 2! RT 3!
Supplementary Figure! Entire workflow repeated 3 times! mirna! stock! -fold dilution series! to yield - copies! per µl in PCR reaction! reverse transcription! RT! pre-pcr! mastermix!!!! 3!!! 3! ddpcr!
More informationStandard Data Analysis Report Agilent Gene Expression Service
Standard Data Analysis Report Agilent Gene Expression Service Experiment: S534662 Date: 2011-01-01 Prepared for: Dr. Researcher Genomic Sciences Lab Prepared by S534662 Standard Data Analysis Report 2011-01-01
More informationEvaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control
Evaluating the Agilent TapeStation System for High Throughput Sequencing Quality Control Application Note Nucleic Acid Analysis Authors Elisa Viering, Laura-Jane Behl, Stefan Pinkert, and Stephan Wolf
More information