Isolation and Characterisation of Putative Ovarian Germ Line Stem Cells
|
|
- Emory Smith
- 6 years ago
- Views:
Transcription
1
2 Isolation and Characterisation of Putative Ovarian Germ Line Stem Cells Prof. Evelyn E Telfer Institute of Cell Biology and Centre for Integrative Physiology University of Edinburgh
3 Disclosures Evelyn E Telfer is a receipt of a MRC research grant and a research grant from OvaScience
4 Store of resting primordial follicles utilized throughout reproductive life Primordial Preantral Decreasing numbers with development Late Preantral Increasing levels of apoptosis Antral Does the ovary have any capacity for regeneration?
5 Fast developing field of adult stem cells Skeletal Muscle Skeletal Muscle Smooth muscle Bone Cartilage Fat Heart Brain Brain Nerves Blood cells Muscle All tissues Bone Marrow Marrow Bone Cartilage Tendon Muscle Fat Liver Brain/Nerve Blood cells Heart All Tissues Cornea Retina Skin Heart Lung Pancreas Liver Spermatogonia Peripheral Blood Bone Marrow Blood cells Nerves Fat Cells Bone Cartilage Muscle Gastrointestinal Esophagus Stomach Small Intestine Large Intestine Placenta CORD BLOOD Bone Various Tissue Cartilage Muscle Nerve Bone Marrow Tendon Blood vessel It is likely that the ovary has stem cells for all ovarian cell components
6 Putative Human Oogonial Stem Cells (OSCs) isolated from adult woman ovarian tissue Fluorescent Activated Cell Sorting (FACS) approach DDX4:BrdU DDX4 DDX4:BrdU double staining human cultured OSCs: DDX4=germ cell marker BrdU=incorporates into proliferating cells
7 OSCs are unipotent progenitor germ cells Characteristic Stem Cell Progenitor Cell OSCs In vivo self-renewal Unlimited; lifetime Limited; transient Limited; transient In vitro self-renewal Unlimited Limited Limited Potentiality Pluripotent Unipotent Unipotent Adapted from Seaburg 2003
8 Putative human OSCs form oocyte like structures Isolation of OSCs based on DDX4 protein being extracellular Telfer & Albertini, 2012
9 Testing the potential of putative OSCs isolated from human ovaries Can human ovarian tissue support the formation of follicles from putative OSCs in vitro?
10 In Vitro Growth of Human Oocytes / Follicles: Three Step Process Step 1: Micro-cortex culture Step 2: Culture isolated follicles Follicles prior to isolation Antral development from in vitro grown human primordial follicles within 10 days Step 3: Cumulus complex culture (oocyte maturation) Telfer et al., 2008 Remove oocyte and surrounding cells
11
12 GFP-positive cells in different stages of development Type I Type II GFP+ GFP+ GFP+ Type III Type IV GFP+ GFP+ Telfer et al., unpublished Scale bar 50 µm
13 Only oocyte like structures are GFP positive GFP-ve GFP +ve Telfer et al, unpublished Positive and negative GFP Oocyte like structures in same sections is an indication that the injected cells are forming structures and recruiting somatic cells
14 Human putative OSCs form follicles within 6 days and are multilaminar structures within days C Cells that are capable of recruiting somatic cells and forming oocyte like follicles have been isolated from human ovaries in the Tilly lab Initial culture stages A 6 days and 12 days of culture C B D Need to independently isolate cells: How reproducible is this? Telfer et al, unpublished
15 Isolation of putative OSCs from human ovarian tissue using FACs based sorting in our lab Marie McLaughlin, Yvonne Clarkson, Paul Skehel, Martin Waterfall, Cheryl Dunlop, Hamish Wallace, Richard Anderson and Evelyn Telfer
16 Fluorescence Activated Cell Sorting Disaggregated Ovarian Cortex Sample OSC Fluorescent Tag Secondary Antibody Primary Antibody DDX4 Nozzle Cells pass through in single file Forward Scatter (FS) = cell size Side Scatter (SS) = Granularity Sort cells on basis of DDX-4 on cell surface and cell size Adapted from Woods & Tilly, 2013
17 PCR analysis of human FACS sorted cells GERM LINE MARKERS a) Positive control b) DDX4 positive cells P2 c) DDX4 positive cells P3 d) DDX4 positive cells P1 e) DDX4 negative cells f) Negative control STEM CELL MARKERS FOLLICLE/OOCYTE MARKERS P1 P3 Dunlop, Clarkson, McLaughlin, Waterfall, Skehel, Anderson & Telfer (Unpublished) HOUSEKEEPING DDX4 P2
18 McLaughlin, Clarkson, Waterfall, Dunlop, Skehel, Anderson, Telfer (unpublished) DDX4 protein is present in FACS sorted positive cells but not in negative cells
19 DDX4 cells can be observed in human ovaries DDX4 positive cells in the ovary Negative controls Telfer et al, unpublished Scale bar 25 µm
20 Controversy on DDX4 localisation RNA helicase FACS sorted DDX4 +ve cells with external epitope Meikar et al., 2011 Hernandez et al., 2015
21 C-terminus of DDX4 detected on cell surface Myc + Cy2 Myc + Cy2 Myc-Vap- B DDX4 Non-permeabilised Permeabilised Scale bar 20 µm Clarkson, Liao, McLaughlin, Skehel, Anderson, Telfer (unpublished)
22 Testing the potential of putative OSCs isolated in our lab (bovine) Chimeric ovary experiments Combine putative OSCs (bovine) with murine somatic cells Transplant under kidney capsule of SCID mouse PhD student Kelsey Grieve in collaboration with Williams lab Oxford 22
23 Chimeric ovary studies: Mouse somatic cells only Isolated mouse somatic cells transplanted under kidney capsule of SCID mouse (no follicles observed)
24 Chimeric ovary studies: Bovine putative OSCs combined with mouse somatic cells Follicle Follicle Follicle Follicle Bovine putative OSCs combined with mouse somatic cells, and transplanted to SCID mouse oocyte / follicle structures formed
25 Functional oocyte development In vivo Oocyte Growth 19-30µm 40-80µm 80-90µm µm µm primordial primary preantral Early antral Mid antral Pre-ovulatory Growth / Meiotic Arrest Acquisition of Meiotic Competence Acquisition of Developmental Competence Transcription / Transcriptional Repression Genomic imprinting
26 What does this mean? The menopause happens! But cells with germ and stem cell markers can be isolated from ovaries of women and prepubertal girls Useful model of human germ cell development / maturation Potential Clinical Applications: Fertility preservation / restoration. In vivo and in vitro
27 The future The field of germ line stem cells is new Concentration of effort has been on doubting their existence Putative OSCs have been identified in a range of species (bats, cows, pigs, rats, rhesus monkey, Lemur) Time to concentrate on defining the populations of cells that reside within the mature ovary Applying cell based strategies to infertility treatment and fertility preservation
28 Acknowledgements Marie McLaughlin Yvonne Clarkson Cheryl Dunlop Kelsey Grieve Paul Skehel Martin Waterfall John Binnie Joan Creiger Richard Anderson Hamish Wallace David Albertini (IVG work) Jon Tilly (Boston) Suzanne Williams (Oxford) All the patients who kindly donate their ovarian tissue and the clinical teams that support this
Stem Cells & Neurological Disorders. Said Ismail Faculty of Medicine University of Jordan
Stem Cells & Neurological Disorders Said Ismail Faculty of Medicine University of Jordan Outline: - Introduction - Types & Potency of Stem Cells - Embryonic Stem Cells - Adult Stem Cells - ipscs -Tissue
More informationCharacteristics. Capable of dividing and renewing themselves for long periods of time (proliferation and renewal)
STEM CELLS (p 2-8) Overview The body is made up of about 200 different kinds of specialised cells, such as muscle cells, nerve cells, fat cells and skin cells. Cells with the capacity to give rise to the
More informationStem Cells. Part 1: What is a Stem Cell? STO Stem cells are unspecialized. What does this mean?
STO-120 Stem Cells Part 1: What is a Stem Cell? Stem cells differ from other kinds of cells in the body. When a stem cell divides by mitosis, each new cell has the potential to either remain a stem cell
More informationStem Cel s Key Words:
Stem Cells Key Words: Embryonic stem cells, Adult stem cells, ips cells, self-renewal, differentiation, pluripotent, multipotent, Inner cell mass, Nuclear transfer (Therapeutic cloning), Feeder cells,
More informationANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)
ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent
More informationLesson 7A Specialized Cells, Stem Cells & Cellular Differentiation
Lesson 7A Specialized Cells, Stem Cells & Cellular Differentiation Learning Goals I can explain the concept of cell differentiation and cell specialization. I can explain how the cell structure relates
More informationGenetics Lecture 19 Stem Cells. Stem Cells 4/10/2012
Genetics Lecture 19 Stem Cells Stem Cells Much of the excitement about stem cells in the scientific and medical communities comes from their largely untapped and unproven potential for treating human conditions)
More informationANAT 2341 Embryology Lecture 18 Stem Cells
ANAT 2341 Embryology Lecture 18 Stem Cells 29 September 2010 Dr Antonio Lee Neuromuscular & Regenera
More informationhpsc Growth Medium DXF Dr. Lorna Whyte
hpsc Growth Medium DXF Dr. Lorna Whyte 27.06.2014 Training from Heidelberg Overview Background: Stem Cells Introduction: Human Pluripotent Stem Cells (hpsc) vs. Adult Stem Cells Promise of PSC Research
More informationLecture 24 Differentiation and stem cells
Lecture 24 Differentiation and stem cells *Stem cells and differentiation in plants Totipotency Stem cells in animals Therapeutic use Cloning Therapeutic Reproductive Therapeutic cloning in humans Stem
More informationNPTEL Biotechnology Tissue Engineering. Stem cells
Stem cells S. Swaminathan Director Centre for Nanotechnology & Advanced Biomaterials School of Chemical & Biotechnology SASTRA University Thanjavur 613 401 Tamil Nadu Joint Initiative of IITs and IISc
More informationCases of Academic Misconduct. Core Components
Cases of Academic Misconduct May 2015 Examination Session Core Components Extended Essay / Biology Infringement: Plagiarism Pages 1-6 show no evidence of plagiarism. Comments A significant portion of the
More informationTHE THERAPEUTIC REALITIES OF STEM CELLS
Ferghana Partners Group is a Life Sciences investment banking house with offices in London and New York. We specialise in creating and executing effective strategic transactions for pharmaceutical, chemical,
More informationDes cellules-souches dans le poumon : pourquoi faire?
Des cellules-souches dans le poumon : pourquoi faire? Karl-Heinz Krause Dept. of Pathology and Immunology, Medical Faculty Dept. of Genetic and Laboratory Medicine, University Hospitals Geneva, Switzerland
More informationANAT 3231 Cell Biology Lecture 21 Stem Cells
ANAT 3231 Cell Biology Lecture 21 Stem Cells Outline What are Stem Cells? Totipotency - Pluripotency - Multipotency What are different sources of Stem Cells? Embryonic vs Adult Pros and Cons for each type
More informationMolecular Medicine. Stem cell therapy Gene therapy. Immunotherapy Other therapies Vaccines. Medical genomics
Molecular Medicine Molecular Medicine Stem cell therapy Gene therapy Tumor therapy Immunotherapy Other therapies Vaccines Genetic diagnostics Medical genomics Medication Diagnostics medicine: old desire
More informationBME 177. Engineering stem cells. Gayatri Pal Lecturer Biomolecular Engineering
BME 177 Engineering stem cells Gayatri Pal Lecturer Biomolecular Engineering Introduction Graduated from MCD Biology (Yeast Cell Cycle) -CIRM classes (Introduction to stem cell biology) Post-doc training
More information3.4 DNA sequencing: the Sanger method
3.4 DNA sequencing: the Sanger method Four separate polymerization reactions are performed 1 3.4 DNA sequencing: the Sanger (dideoxy) method 2 3.4 The polymerase chain reaction 3 3.5 Centrifugation can
More information5.5. Multicellular Life. Multicellular organisms depend on interactions among different cell types.
5.5 Multicellular Life VOCABULARY tissue organ organ system cell differentiation stem cell Key Concept Cells work together to carry out complex functions. MAIN IDEAS Multicellular organisms depend on interactions
More informationStem Cells: Introduction and Prospects in Regenerative Medicine.
Stem Cells: Introduction and Prospects in Regenerative Medicine www.gothamgazette.com/.../stemcell/stem_cell.jpg Ode to a Stem Cell, Part II by VCW There once was stem cell stuck in the hood Dividing endlessly,
More information5.5. Multicellular Life. Multicellular organisms depend on interactions among different cell types.
5.5 Multiular Life VOCABULARY tissue organ organ system differentiation stem 5b, 5c, 5B examine specialized s, including roots, stems, and leaves of plants; and animal s such as blood, muscle, and epithelium;
More informationAccelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
More informationPresenter: Teresa Holm
Slides are from Level 3 Biology Course Content Day, 7 th November 2012 Presenter: Teresa Holm Teachers are free to use these for teaching purposes with appropriate acknowledgement Human Stem cells Dr Teresa
More informationStem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division
Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division stem cell stem cell skin muscle nerve Properties of STEM cells Plasticity
More informationWill Stem Cells Finally Deliver Without Controversy?
Will Stem Cells Finally Deliver Without Controversy? Keith Gary, Ph.D. Director of Program Development Kansas City Area Life Sciences Institute Olathe North Life Sciences 1 February 2012 What s the Buzz?
More informationFrom Stem Cell to Any Cell
sciencenewsforkids.org http://www.sciencenewsforkids.org/2005/10/from-stem-cell-to-any-cell-2/ From Stem Cell to Any Cell By Emily Sohn / October 11, 2005 For maybe a day, about 9 months before you were
More informationDirected differentiation of human embryonic stem cells
Directed differentiation of human embryonic stem cells TECAN Symposium 2008 Biologics - From Benchtop to Production Wednesday 17 September 2008 Andrew Elefanty Embryonic Stem Cell Differentiation Laboratory,
More informationShould Embryonic Stem Cell Research be Permitted to Continue? Over the past few years a debate has been going on over the moral implications of
Courtesy of Christopher Waits. Used with permission. Waits 1 Should Embryonic Stem Cell Research be Permitted to Continue? Over the past few years a debate has been going on over the moral implications
More informationChapter 8 Healthcare Biotechnology
Chapter 8 Healthcare Biotechnology Outline: 8.1 Introduction 8.2 Biopharming 8.3 Models of Human Disease 8.4 Detecting and Diagnosing Human Disease 8.5 Monoclonal Antibodies 8.6 Gene Therapy 8.7 Tissue
More informationSouth Carolina Donor Registry Q & A
South Carolina Donor Registry Q & A How do I become a registered organ and tissue donor? There are several ways to register your legal consent to be a donor: 1.) At any SCDMV office or on the SCDMV web
More informationCloning genes into animals. Transgenic animal carries foreign gene inserted into its genome.
Cloning genes into animals Transgenic animal carries foreign gene inserted into its genome. Transgenic goats Ch. 10 pg. 281 Produce human protein (drug) in milk Pharming Transgenic animals to produce human
More informationFundamental properties of Stem Cells
Stem cells Learning Goals: Define what a stem cell is and describe its general properties, using hematopoietic stem cells as an example. Describe to a non-scientist the current progress of human stem cell
More informationTransgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission
Transgenic Mice Transgenesis Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission integrates into all cells including sperm or egg Knockin mice DNA
More informationAvailable through Online
ISSN: 0975-766X CODEN: IJPTFI Available through Online Review Article www.ijptonline.com STEM CELLS-MODERN APPROACH IN MEDICINE Kameshwar Sharma YVR* 1, Prasidhi Tyagi 2 and Samarth Kulshrestha 3 * 1 Department
More informationDifferentiation. Ahmed Ihab Abdelaziz MD, PhD Associate Prof. Of Molecular Medicine NewGiza University (NGU)
Differentiation Ahmed Ihab Abdelaziz MD, PhD Associate Prof. Of Molecular Medicine NewGiza University (NGU) 1 Developmental Genetics Objectives: Explain how a differentiated cell achieves and maintains
More informationANNOUNCEMENTS. HW1 is due Thursday 1/28 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Wednesday 9:45 10:15 (ECCH 134)
ANNOUNCEMENTS HW1 is due Thursday 1/28 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Wednesday 9:45 10:15 (ECCH 134) Lecture 5: Kinetics of Cell Growth in Culture Phenomenological mathematical
More informationStem cells in Development
ANAT 2341 Embryology Lab 10 8 Oct 2009 Therapeutic Use of Stem Cells Practical Hurdles & Ethical Issues Stem cells in Development Blastocyst Cord blood Antonio Lee PhD Neuromuscular & Regenerative Medicine
More informationStem cells in Development
ANAT 2341 Embryology Lab 10 8 Oct 2009 Therapeutic Use of Stem Cells Practical Hurdles & Ethical Issues Stem cells in Development Blastocyst Cord blood Antonio Lee PhD Neuromuscular & Regenerative Medicine
More informationFuture of Stem Cell Engineering. Jaeseung Jeong, Ph.D Department of Bio and Brain Engineering KAIST
Future of Stem Cell Engineering i Jaeseung Jeong, Ph.D Department of Bio and Brain Engineering KAIST Keywords of Stem Cell Engineering g Embryo and Fetus (Foetus) Adult stem cells and embryonic stem cells
More informationClip 1: Hip dysplasia Clip 2: Vet-Stem s Dr. Harman
Stem Cells Many breeds of large dogs are affected by hip dysplasia. This degenerative disease affects their hind legs, hindering mobility. Watch as scientists at Vet-Stem explain how stem cells are used
More informationBIOTECHNOLOGY. Unit 8
BIOTECHNOLOGY Unit 8 PART 1 BASIC/FUNDAMENTAL SCIENCE VS. APPLIED SCIENCE! Basic/Fundamental Science the development and establishment of information to aid our understanding of the world.! Applied Science
More informationAdult Stem Cells for Chronic Pain. Dr. John Hughes, DO January 24 th, 2018
Adult Stem Cells for Chronic Pain Dr. John Hughes, DO January 24 th, 2018 Dr. John Hughes, DO Doctor of Osteopathy From Georgia Arizona College of Osteopathic Medicine - 2007 Aspen Integrative Medicine
More informationUnderstanding Stem Cells The Conference 1 Basics. 1 Basics
Understanding Stem Cells The Conference 1 Basics 1 Basics Teacher Comments i In this module, the students work on the basics of stem cell research. As participants in a scientific conference, they prepare
More informationStem Cells: A Primer National Institutes of Health
Stem Cells: A Primer National Institutes of Health I. INTRODUCTION Research on stem cells is advancing knowledge about how an organism develops from a single cell and how healthy cells replace damaged
More informationStem Cell Research 101
Stem Cell Research : A promising type of bioscience research The Stem Cell debate and the impact of the induced pluripotent stem cell procedure Why Is Vocabulary Important? Key terms frame the debate Mature
More informationLisa Griffin (BSc Hons Biology), David Hughes August 2013
Title Authors Contact Target level Publication date Lisa Griffin (BSc Hons Biology), David Hughes Maggy.fostier@manchester.ac.uk KS4 science, GCSE August 2013 Activity Length Content related to the GCSE
More informationChapter 8 Cell Diversity
Chapter 8 Cell Diversity Mr. C. Biology 1 Future? Chapter 8 Cell Diversity Cells, Tissues, Organs and Systems Cells have different shapes because they have different jobs to do. A nerve cell is very different
More informationSNC2D BIOLOGY 3/31/2013. TISSUES, ORGANS & SYSTEMS OF L Stem Cells & Meristematic Cells (P.40-41) Specialized Cells. Stem Cells
SNC2D BIOLOGY TISSUES, ORGANS & SYSTEMS OF L & Meristematic Cells (P.40-41) Specialized Cells The cell theory states that all cells come from pre-existing cells. Every cell that makes up an animal s body
More informationJohn Gurdon was testing the hypothesis of genomic equivalence or that when cells divide they retain a full genomic compliment.
1. (15 pts) John Gurdon won the 2012 Nobel Prize in Physiology or Medicine for work he did in the 1960 s. What was the major developmental hypothesis he set out to test? What techniques did he development
More informationMid-term review. Recitation5 03/31/2014. Stem Cell Biology and Function W4193 1
Mid-term review Recitation5 03/31/2014 Stem Cell Biology and Function W4193 1 What to expect in the midterm2 It will be all so far but mainly whatever was NOT covered by the previous mid-term- not a huge
More informationSTEM CELLS BONE FRACTURE
BIOLOGY UNIT 2 MRS. CATHERINE JACKSON STEM CELLS BONE FRACTURE By AYESHA SYED 10C 2 Stem Cell (Introduction) Stem cells are undifferentiated cells that have not yet become a specialised cell, with a specific
More informationStem Cells for the Future Treatment of Parkinson's Disease
Home Stem Cell Basics Stem Cell Basics I. Introduction II. III. IV. What are the unique properties of all stem cells? What are embryonic stem cells? What are adult stem cells? V. What are the similarities
More information1. Which process decreases when the human body temperature decreases? D. Shivering (Total 1 mark) D. Liver (Total 1 mark)
1. Which process decreases when the human body temperature decreases? A. Blood flow to the internal organs B. Secretion of sweat C. Secretion of insulin D. Shivering 2. Which organ secretes enzymes that
More informationUnit 1: DNA and the Genome. Sub-Topic (1.4) Cellular Differentiation
Unit 1: DNA and the Genome Sub-Topic (1.4) Cellular Differentiation Duncanrig 2016 Unit 1: DNA and the Genome Sub-Topic (1.4) Cellular Differentiation On completion of this subtopic I will be able to Cellular
More informationDec 04, 2013
Stem Cells Junfeng Ji ( 纪俊峰 ), PhD Professor Research Center of Stem Cell and Developmental Biology School of Medicine Zhejiang University Email: jijunfeng@zju.edu.cn Dec 04, 2013 Totipotent Pluripotent
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationTowards a stem cell based therapy for Parkinson s Disease
Stem cell based therapies for Parkinson s Disease Towards a stem cell based therapy for Parkinson s Disease MALIN PARMAR NYSCF Robertson Investigator Lund University, Sweden INTR, Port Douglas, Sept 13-16,
More informationSupplementary information
Supplementary information Rho kinase inhibitor enables cell-based therapy for corneal endothelial dysfunction Naoki Okumura 1, Yuji Sakamoto 2, Keita Fujii 1, Junji Kitano 1, Shinichiro Nakano 1, Yuki
More informationMicroRNAs Modulate Hematopoietic Lineage Differentiation
Chen et al., page 1 MicroRNAs Modulate Hematopoietic Lineage Differentiation Chang-Zheng Chen, Ling Li, Harvey F. Lodish, David. Bartel Supplemental Online Material Methods Cell isolation Murine bone marrow
More information3/9/04 Cloning/Stem Cells
3/9/04 Cloning/Stem Cells 1 Meet (left to right): Rainbow, Allie and cc (carbon copy) who is a genetic clone of Rainbow. Allie is cc s surrogate mom 2 To see entire article: http://fire.biol.wwu.edu/trent/trent/2.14.02nytcat.pdf
More informationHow You Can Use Stem Cells
How You Can Use Stem Cells Dr. Ralph T Bright Macquarie Cosmetic Medicine 21B Bathurst Street Liverpool NSW 2170 www.cosmeticmedicine.com.au (02) 9824 3044 Stem Cell Transfer Many of the people in this
More informationWHAT IS EMBRYONIC STEM CELLS
31 March, 2018 WHAT IS EMBRYONIC STEM CELLS Document Filetype: PDF 436.17 KB 0 WHAT IS EMBRYONIC STEM CELLS Explore Current Stem Cell Treatments. Embryonic stem cells - Embryonic stem cells include those
More informationSupplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
More informationRegenerative Medicine and Stem Cell Therapies
Regenerative Medicine and Stem Cell Therapies Regenerative Medicine Major component of successful regenerated / tissue engineered organs Scaffolds A critical element is the binding of the repopulating
More informationUnderstanding brain diseases from stem cells to clinical trials
Understanding brain diseases from stem cells to clinical trials Alan Mackay Sim Griffith Institute for Drug Discovery Griffith University Brisbane, QLD Making ES cells Fertilise an egg Put in a dish Embryonic
More informationDifferentiation = Making specialized cells. Self-renewal = copying. What is a stem cell?
Differentiation = Making specialized cells What is a stem cell? What the photo shows A lump of metal and lots of different kinds of screws that can be made from it. Things to think about What is a specialized
More informationTherapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota
Therapeutic Cell Replacement Steven McLoon Department of Neuroscience University of Minnesota 1 Neuronal Death Neurons are lost due to four main causes: Trauma Toxin Hypoxia (typically loss of air or blood
More informationStem Cell. Running head: STEM CELL RESEARCH. Stem Cell Research. Student s Name. University Affiliation
1 Running head: STEM CELL RESEARCH Stem Cell Research Student s Name University Affiliation 2 Stem Cell Research Stem cell research is the subject of many current researches and studies all over the world.
More informationInduced Pluripotent Stem Cell
Induced Pluripotent Stem Cell When eventually mastered, the processes involved in the obtaining, cultivating and differencing ESC into cells of clinical interest, another practical limitation should be
More informationTherapeutic Cell Replacement. Steven McLoon Department of Neuroscience University of Minnesota
Therapeutic Cell Replacement Steven McLoon Department of Neuroscience University of Minnesota 1 Course News Coffee Hour Wednesday (Dec 13) Thursday (Dec 14) Friday (Dec 15) 9:00-10:00am Surdyk s Café in
More informationRadiation Effects in Tissues & Cells
Radiation Effects in Tissues & Cells Module 4 10-526-197 Rhodes Neural Cell Cluster of Human embryonic stem cells. Zhang-UWMadison Determinist effects Stochastic Effects Effects of Fetal Irradiation Review
More informationSupplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.
kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis
More informationKieran McGourty, PhD. Short BIO. Long BIO
Kieran McGourty, PhD Lecturer in Biochemistry and Cell Biology, Department of Chemical Sciences University of Limerick, Ireland Short BIO Kieran did his PhD and his Post-Doctoral scientific training in
More informationSUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
More informationThe Role of Adult Stem Cells in Personalized and Regenerative Medicine
The Role of Adult Stem Cells in Personalized and Regenerative Medicine Christopher J. Neill, Director of Corporate Operations American CryoStem Corporation Objective To illustrate the potential benefits
More informationCloning. 1. What is cloning: Natural and artificial 2. Cloning of what? 3. Embryonic development of multi-cellular organisms:
Cloning 1. What is cloning: Natural and artificial 2. Cloning of what? 3. Embryonic development of multi-cellular organisms: cell division, morphogenesis, differentiation 2. Plant cloning 3. Animal cloning
More informationTransplantation Society. Transplantation Building Bridges to Excellence. World Wide Transplantation. Outline 9/28/2016
Transplantation Society Transplantation Building Bridges to Excellence How can we use our collective wisdom/education to optimize transplantation outcomes? development of the science and clinical practice
More informationWelcome to the. 1 st workshop: Drawing lessons from stem cells and animal models outside the radiation field
Welcome to the 1 st workshop: Drawing lessons from stem cells and animal models outside the radiation field Context of the workshop Long-term animal studies have played fundamental roles for studies on
More informationAt the conclusion of this lesson you should be able to:
Learning Objectives At the conclusion of this lesson you should be able to: Understand the key terms and definitions regarding stem cells Differentiate between the adult and embryonic stem cells Differentiate
More informationKEY Reproductive cloning Therapeutic cloning
1. (20 pts) Define Reproductive and Therapeutic cloning. Make sure your descriptions clearly distinguish the critical differences between them. Describe an example of each. Reproductive cloning refers
More informationSTEM CELL RESEARCH PRIMER
STEM CELL RESEARCH PRIMER WHAT YOU NEED TO KNOW ABOUT STEM CELLS AND STEM CELL RESEARCH What Stem Cells Are And Why They Are Important Stem cells are the body s very own internal repair system. They are
More informationBackground. Background. Background. Background. Background 3/4/2013
3/4/213 Human Very Small Embryonic-like Stem Cells (s) Capacity to Regenerate Bone Tissue: A Potential Cell-based Therapy for Autogenous Bone Grafting Aaron M. Havens, DMD Need to discover an improved
More informationTable S1. Primers used in the study
Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping
More informationScience Dialogue. By: Dr. Ahmed Hegab, PhD Dr. Hiroshi Kubo, MD, PhD. Hachinohe-Kita High School
Science Dialogue at Hachinohe-Kita High School By: Dr. Ahmed Hegab, PhD Dr. Hiroshi Kubo, MD, PhD Department of Geriatric and Respiratory Medicine, Tohoku University School of Medicine Topics of today
More informationTissue Engineering. Mesenchymal Stem Cells for. Tissue Engineering
Tissue Engineering Mesenchymal Stem Cells for Tissue Engineering Reference: Culture of Cells for Tissue Engineering (Culture of Specialized Cells), Chapter 2 Shu-Ping Lin, Ph.D. Date: 03.20.2012 Institute
More informationAssuring Pluripotency of ESC and ipsc Lines
Assuring Pluripotency of ESC and ipsc Lines Introduction Compared to other cell types, stem cells have the unique ability to self-renew their populations by dividing into identical daughter stem cells
More informationMouse Embryo : 10mM Tris-HCl (ph8.0), 1mM EDTA. : One year from date of receipt under proper storage condition.
1st strand cdna Mouse Embryo 10.5 Product type Catalog No. Species Tissue type : 1st strand cdna : CSR-MDE-02 : Mouse : C57BL/6N CrlCr : Normal, Embryo (10.5-day) Tissue name : - Concentration Volume Size
More informationLets regenerate! The exci0ng life of a stem cell. Deepa Subramanyam, PhD Na0onal Centre for Cell Science, Pune. Slides adapted from CIRM
Lets regenerate! The exci0ng life of a stem cell Deepa Subramanyam, PhD Na0onal Centre for Cell Science, Pune Slides adapted from CIRM Our body is made up of different cells and organs. how are these made?
More informationUNIT CELL PROCESSES UNDERLYING TISSUE ENGINEERING AND REGENERATIVE MEDICINE
Massachusetts Institute of Technology Harvard Medical School Brigham and Women s Hospital VA Boston Healthcare System 2.79J/3.96J/20.441/HST522J UNIT CELL PROCESSES UNDERLYING TISSUE ENGINEERING AND REGENERATIVE
More informationAdult Stem Cells by David A. Prentice, Ph.D.
Adult Stem Cells by David A. Prentice, Ph.D. Within just a few years, the possibility that the human body contains cells that can repair and regenerate damaged and diseased tissue has gone from an unlikely
More informationDennis M. Sullivan, MD, MA (Ethics) Professor of Biology Director, Center for Bioethics Cedarville University
Dennis M. Sullivan, MD, MA (Ethics) Professor of Biology Director, Center for Bioethics Cedarville University Center Web site: www.cedarville.edu/bioethics E-mail: sullivan@cedarville.edu Cameron: The
More informationChE 125. Principles of Bioengineering
ChE 125 Principles of Bioengineering ChE 125 Instructor: Prof. Samir Mitragotri Room 3349, Engineering II Email: samir@engineering.ucsb.edu Office Hours: Tuesday 1-2 pm Teaching Assistant: Aaron Anselmo
More informationStem cells and motor neurone disease
Stem cells and motor neurone disease F Stem cell research has fuelled hope of a treatment for a variety of conditions. This information sheet explains what these cells are and includes details of the current
More informationStem Cell Research From Bench to Bedside
Stem Cell Research From Bench to Bedside Stem Cell Dialogues Jan A. Nolta, Ph.D. Professor, Internal Medicine Director, UC Davis Institute for Regenerative Cures October 26, 2010 Stem Cells at UC Davis
More informationMesenchymal Progenitor Cells (MPCs) Involvement In Ectopic Fat Formation In Muscular Dystrophy
Mesenchymal Progenitor Cells (MPCs) Involvement In Ectopic Fat Formation In Muscular Dystrophy Jihee Sohn, MS 1, Ying Tang 2, Bing Wang, MD,PhD 3, Aiping Lu 4, Johnny Huard, Ph.D 5. 1 university of pittsburgh,
More informationBanking Human Neural Stem Cells for Clinical Applications. Lisa Fox Director, Cell Process Development & Operations
Banking Human Neural Stem Cells for Clinical Applications Lisa Fox Director, Cell Process Development & Operations 7 th Annual Somatic Cell Therapy Symposium September 27, 2007 Stem Cells Inc. Approach
More informationISSCR 2017 Abstract Submission Guide
ISSCR 2017 Abstract Submission Guide The International Society for Stem Cell Research (ISSCR) invites the submission of abstracts that report new research developments across the breadth of stem cell biology,
More informationXeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications
Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and
More informationGenetic Basis of Development & Biotechnologies
Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive
More informationBASIC MEDICAL SCIENCES MODULE 2016/17
BASIC MEDICAL SCIENCES MODULE 2016/17 STUDENT INFORMATION MODULE CO-ORDINATOR: Email: edged@tcd.ie DEPARTMENT OF PHYSIOLOGY, BIOMEDICAL SCIENCES INSTITUTE, TRINITY COLLEGE, PEARSE STREET, DUBLIN 2. 1 LEVEL:
More information