Supplementary Figure 1. Comparison of RNA yield between kits.

Transcription

1 Supplementary Figure 1 Comparison of RNA yield between kits. 1µg DNA was used for RNA synthesis according to each manufacturer s protocol. The RNA samples in lanes 1 and 2 were synthesized using kits from two different vendors. 1% of the eluates, from purification using the MEGAclear columns, were loaded. This figure illustrates that kits can vary in their efficiencies. It should be noted that the identity of the products is not an important point: we have observed a little better performance of a different batch from vendor 1, and somewhat poorer performance of another batch of kit from vendor 2.

2 Supplementary Figure 2 Comparison of cdna yield among different kits. cdnas (ssdna) were synthesized using reverse transcriptases from three different vendors (1 to 3). 1.7µg RNA was used for cdna synthesis according to each manufactures protocol and 50% of the reaction volumes were loaded. The cdna yield from all three transcriptases are comparable.

3 Supplementary Figure 3 Comparison of cdna synthesis parameters. 1.7µg (lane 1 and 2) or 5µg (lanes 3 and 4) of RNA was used for cdna synthesis and the reactions were incubated for 10 minutes (lanes 1 and 3) or 2 hours (lanes 2 and 4). 15% of the reaction volume was loaded. The band intensities suggest that 5µg RNA input produces optimal yields of cdna.

4 Supplementary Figure 4 Gel extraction of bands from cdna preparations. (a) Typical smear-like appearance of the cdna (ssdna) preparations in an agarose gel showing a prominent band (box # 1) and a less prominent band (box # 2). (b and c) Gel slices excised for DNA extraction. (d) The purified ssdnas loaded in another gel showing both bands migrate similarly. Either of the gel preparations (1 or 2) can be used for microinjection, or both preparations can be pooled before use.

5 Supplementary Figure 5 Verification of ssdna using S1 nuclease. About 150 ng of ~0.5kb cdna was incubated with or without S1 nuclease at 37 C for 15 minutes.

6 Supplementary Table 1. The polarity of guides and the ssdna donor strands with respect to the genomic loci, in the previously published genome engineering projects using Easi-CRISPR Locus Guide RNA Guide Cleavage location (# of nucleotides away from the desired insertion site) Guide Orientation Donor Orientation (ref) Col12a1 LEFT: TGACTTCCATGGTTCCACAA RIGHT:CACAGCACTGTACAGAATAG 1 Ambra1 LEFT: CCTTCATTGCTGGTGTCTAC RIGHT: GTCTACCAGTCCTAACAAAG 0 1 Pitx1 LEFT: GTAAGAGCCATGTAGTCGCC RIGHT: GGGGCTTGCAGTAGCTCCTG 0 1 Ubr5 LEFT: ACATCAACCTTGGTGGTGAC RIGHT: GGATGAATGATCAACCAAAG 1 PPP2r2a LEFT: TCAAAGCCATTCAACCAATC RIGHT: AGAGGTCAACTTATTACTGA 0 Sense 1 Syt1 LEFT: GTGGCATGTAGTATACATAG RIGHT: TGAAGCCACACCTCGTTGTG Sense 1 Syt9 LEFT: TTTCTGGGAGGGGGCAAAAC RIGHT: TATCCTATCTTTGGAGGGGT Sense Sense 1 Fgf8 AGCTGGGCGAGCGCCTATCG 0 Sense 1 Slc26a5 CCACCACCCCCGAGGCATAA Sense 1 Mafb TCTGTGAGTCCTGGCGGGTC +13 Sense Sense 1 Otoa ACTTAACTGCAGGATGTCTC +4 Sense Sense 1 Mmp9 AAGAAGGAGCCCTAGTTCAA +2 1 Mmp13 AGATGCTTAACACCACAATA -8 1 Ddc AATGAAAGCAGAGCTGCTTC +15 Sense 2 eef2 GGGAGCGACTTCCCAAGGCT 0 3 References 1. Quadros, R. M. et al. Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long ssdna donors and CRISPR ribonucleoproteins. Genome Biol. 18, (2017). 2. Jacobi, A. M. Simplified CRISPR tools for efficient genome editing and streamlined protocols for their delivery into mammalian cells and mouse zygotes. Methods (2017). 3. Miura, H. CRISPR/Cas9-based generation of knockdown mice by intronic insertion of artificial microrna using longer single-stranded DNA. Sci Rep 5, (2015).