Simple Deletion: a vector- and marker-free method to generate and isolate site-directed

Size: px
Start display at page:

Download "Simple Deletion: a vector- and marker-free method to generate and isolate site-directed"

Transcription

1 Electronic supplementary materials Simple Deletion: a vector- and marker-free method to generate and isolate site-directed deletion mutants Yasuhiro Inoue 1, Seiji Tsuge 2 1 National Agriculture and Food Research Organization, National Agricultural Research Center, Tsukuba, Ibaraki, , Japan 2 Graduate School of Agriculture, Kyoto Prefectural University, Kyoto, Japan Corresponding author: Yasuhiro Inoue 1

2 Fig. S1 PCR amplification test to generate Xanthomonas campestris pv. campestris mutants with a kanamycin-resistance gene instead of the 20.4-kb hrp gene cluster. Kanamycin-resistant clones and the parental strain were used as templates for PCR analyses with primers 7 and 8 (a), 9 and 10 (b), and 5 and 6 (c). Lanes 1 10, kanamycin-resistant clones; M, 1 kb Plus DNA ladder (Invitrogen, Carlsbad, CA, USA); P, parental strain. In clones containing an ectopic mutation, a 24.4-kb fragment derived from the wild-type hrp region was expected to be amplified by PCR using primers 5 and 6, but it was not produced under the condition tested (c, lanes 1 7) 2

3 Fig. S2 Effect of DNase I on elimination of the inoculum DNA in culture. One microgram pdhrp was added to 1 ml of Xanthomonas campestris pv. campestris culture with (lanes 4 6) or without (lanes 1 3) 35 units DNase I. One microlitre of the culture was used for PCR with primers 7 and 8. The arrow indicates the 574-bp fragment derived from the inoculum DNA 3

4 Generating of deletion mutants by using the Simple Deletion method Construction of DNA fragments for homologous recombination The DNA fragments used in the homologous recombination experiment to obtain hrpg and hrpg-hrpx deletion mutants of Xanthomonas campestris pv. campestris and an hrpf-hrpc deletion mutant of Ralstonia solanacearum were constructed as follows. Xanthomonas campestris pv. campestris (Xcc) strain H7601 (MAFF ) and Ralstonia solanacearum (Rs) strain 8242 (MAFF107633) were used. Primers were arranged in a similar manner to those used for the Xcc deletion mutant of the hrp genes cluster (Fig. 1). Primer sequences are listed in Table S1. Bacterial suspensions (5 µl) were heated for 2 min at 98 C and used as templates for PCR amplification. Because of the high GC content of the sequences flanking the hrpg-hrpx region of Xcc and the hrpf-hrpc region of Rs, we tried various kinds of DNA polymerases (as described below) to achieve optimal amplification of each DNA fragment from each template. In the case of Xcc mutants, the upstream and the downstream regions were both amplified using LA Taq DNA polymerase with 2 GC buffer I (Takara Bio, Otsu, Japan) and the reaction solution recommended by the manufacturer. The PCR conditions were as follows: 2 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 60 C, and 90 s at 72 C; and a final incubation for 7 min at 72 C. Amplified fragments were annealed with each other and then subjected to DNA extension and PCR amplification by using iproof High-Fidelity DNA polymerase (Bio-Rad, Hercules, CA) with primers 1 and 4, according to the manufacturer s instructions under the following conditions: 30 s at 98 C; 30 cycles of 15 s at 98 C, 15 s at 62 C, and 105 s at 72 C; and a final incubation for 5 min at 72 C. 4

5 For PCR amplification from Rs, KAPA2G Robust HotStart DNA Polymerase (KAPA Biosystems, Woburn, MA) was used according to the manufacturer s instructions under the following conditions: 3 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 57.5 C, and 90 s at 72 C; and a final incubation for 5 min at 72 C. Fragments were annealed with each other and then subjected to DNA extension and PCR by using Pyrobest DNA polymerase (Takara Bio) with primers 1 and 4, according to the manufacturer s instructions under the following conditions: 2 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 57.5 C, and 2 min at 72 C; and a final incubation for 5 min at 72 C. (Note: In these cases, primers 5 and 2 and primers 3 and 6 were used to amplify the region flanking the 5 end of the target (upstream region) and the region flanking the 3 end of the target (downstream region), respectively. When the fragments were connected with each other, a pfu-based enzyme was used with primers 1 and 4. These procedures decreased nonspecific amplification and made it possible to omit the T4 DNA polymerase treatment.) PCR conditions for sib selection to detect and isolate deletion mutants The nested PCRs using KAPA2G Robust HotStart DNA Polymerase (KAPA Biosystems) with GC buffer were performed according to the manufacturer s instructions. The primary PCR was performed under the following conditions: 3 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 57.5 C; and 33 s (for detection of the Xcc hrpg deletion mutant) or 50 s at 72 C (for detection of the Xcc hrpg-hrpx deletion mutant and Rs hrpf-hrpc deletion mutant); and a final incubation for 5 min at 72 C. The secondary PCR was performed under the following conditions: 3 min at 95 C; 30 cycles of 30 s at 95 C, 30 s 5

6 at 57.5 C; and a final incubation for 5 min at 72 C. The numbers of mutant-containing cultures detected at each step are listed in Table S2. Generation and isolation of the mutant was confirmed by performing PCR analyses (Fig. S3). 6

7 Table S1. Primers used for deletion of the hrpg gene and the hrpg-hrpx region of Xanthomonas campestris pv. campestris and the hrpf-hrpc region of Ralstonia solanacearum For 685-bp deletion of hrpg gene of Xcc Primer Position on AE a Sequence CACTGGCCGAGAAGACGA , TCGTACTGACGCACCTTCCAAGGGCATGAC , GCCCTTGGAAGGTGCGTCAGTACGAATGCC AAGCCGAAGATGTCTCCA TTGCGATGGGTGAGAAGG TTGGCCTGGCAATACTCG CGCCGTTGTCGTTTATGGG GGTCTACACCTGCACGTTG GCGCAGCTTGTAGATGTG ACTTGCTGGCCTGGTATC For 2963-bp deletion of hrpg-hrpx region of Xcc Position on AE a CACTGGCCGAGAAGACGA , TCCATCGGCGCTACCTTCCAAGGGCATGAC , GCCCTTGGAAGGTAGCGCCGATGGAAACCCT GAGCAACATGCCACGCAA TTGCGATGGGTGAGAAGG TTCGGAGAGTGCGTGTTG CGCCGTTGTCGTTTATGGG TGCGAGCCGGAAAGGATAG GCGCAGCTTGTAGATGTG ACTTGCTGGCCTGGTATC For 2545-bp deletion of hrpf-hrpc region of Rs Position on AL b ATGCCGGATCAGGCAGACAC , CTGGTATCGAACCAGGCATCGTTGGCGTCCTTGATGAG , CTCATCAAGGACGCCAACGATGCCTGGTTCGATACCAG CGCAACCGCGTTCATATCGG TCATGATCCAGGGTCCGAC GCGTCCTGCATGTAGGTC CGGTTCCCTCGATCTATCC GGAGACGTTGTCGATGAGG AGGACGAAGACGCCGTATC GTGCGATCTCGTCAAGCAG a GenBank accession number of the genome sequence of Xcc ATCC b GenBank accession number of the mega plasmid sequence of Rs GMI

8 Table S2. PCR-based sib selection to isolate hrpg and hrpg-hrpx deletion mutants of Xanthomonas campestris pv. campestris and a hrpf-hrpc deletion mutant of Ralstonia solanacearum Sib selection step 685 bp of hrpg gene of Xcc 2963 bp of hrpg-hrpx region of Xcc 2545 bp of hrpf-hrpc region of Rs 1 3/96 a) 6/96 4/96 2 1/48 5/48 4/48 3 1/48 3/48 3/48 4 5/48 10/44 7/72 5 3/48 17/48 1/48 6 7/48 1/48 NT b) a) Numbers of samples containing mutants per numbers of samples tested are shown. b) After step 5, single colonies were isolated. Expected ratios of mutants to total bacteria in each sample are 1:10 6 (step 1), 1:10 5 (step 2), 1:10 4 (step 3), 1:10 3 (step 4), 1:10 2 (step 5) and 1:10 1 (step 6). 8

9 a b c Fig. S3 PCR amplification test for mutants. PCR analysis was used to detect Xanthomonas campestris pv. campestris (Xcc) mutants with a deletion of the hrpg gene (a), Xcc mutants with a deletion of the hrpg-hrpx genes (b), and Ralstonia solanacearum (Rs) mutants with a deletion of the hrpf-hrpc genes (c). Two mutants and the parental strain were used as templates for each PCR using primers 5 and 6 (lanes 1 3), 7 and 8 (lanes 4 6), or 9 and 10 (lanes 7 9). Lanes 1, 2, 4, 5, 7 and 8 correspond to the mutant strain; lanes 3, 6, 9 correspond to the parental strain; and M corresponds to the 1 kb Plus DNA ladder. Arrows mark expected fragments. In the parental strain of Xcc, a 6.23-kb fragment was expected to be amplified by PCR using primers 5 and 6, but it was not produced under our conditions (b; lane 3). Also in the parental strain of Rs, a 6.53-kb fragment was expected to be amplified by PCR using primers 5 and 6, but it was not produced under the conditions that we used (c; lane 3). 9

NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network

NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network NEW PARADIGM of BIOTECHNOLOGY - GENET BIO GeNet Bio Global Gene Network GENET BIO DNA AMPLIFICATION PRODUCTS GUIDE Keynote of Products Prime TaqTM DNA Polymerase Prime TaqTM Premix ExPrime TaqTM DNA Polymerase

More information

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department

More information

KAPA HiFi HotStart ReadyMix PCR Kit

KAPA HiFi HotStart ReadyMix PCR Kit KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%

More information

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version

More information

Application Notes

Application Notes Application Notes Superior Performance and Flexibility In order to minimize errors in DNA replication during PCR, it is essential to choose a high-fidelity DNA polymerase enzyme. The introduction of errors

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

Some types of Mutagenesis

Some types of Mutagenesis Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine

More information

Factors affecting PCR

Factors affecting PCR Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the

More information

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

FastGene Optima. Products for PCR. proof-reading. ReadyMix. cdna SNP. routine PCR. polymerase. optimized blend complex templates. N gene knock out B O

FastGene Optima. Products for PCR. proof-reading. ReadyMix. cdna SNP. routine PCR. polymerase. optimized blend complex templates. N gene knock out B O Products for PCR www.nippongenetics.eu efficiency polymerase convenience endpoint PCR incl. loading dye direct PCR incl. dntps engineered enzyme archeal type B polymerase high GC content FastGene tissuebest

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

SpeedSTAR HS DNA Polymerase

SpeedSTAR HS DNA Polymerase Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...

More information

FAQs: PCR Polymerases from Takara Bio

FAQs: PCR Polymerases from Takara Bio FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly

More information

The plasmid for the HLY production was constructed by using the MutliSite Gateway TM

The plasmid for the HLY production was constructed by using the MutliSite Gateway TM Supplementary methods and table The plasmid for the HLY production 1 1 1 The plasmid for the HLY production was constructed by using the MutliSite Gateway TM system (Mabashi et al. 00). The HLY gene was

More information

Our new breed is the center of attention.

Our new breed is the center of attention. AMPLIFICATION CELL BIOLOGY CLONING MICROARRAYS NUCLEIC ACID ANALYSIS PROTEIN FUNCTION & ANALYSIS QUANTITATIVE PCR SOFTWARE SOLUTIONS Our new breed is the center of attention. II enzyme for highest fidelity

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

Combinatorial Evolution of Enzymes and Synthetic pathways Using

Combinatorial Evolution of Enzymes and Synthetic pathways Using Supplementary data Combinatorial Evolution of Enzymes and Synthetic pathways Using One-Step PCR Peng Jin,, Zhen Kang,,, *, Junli Zhang,, Linpei Zhang,, Guocheng Du,, and Jian Chen, The Key Laboratory of

More information

Supporting Information

Supporting Information Supporting Information Kilian et al. 10.1073/pnas.1105861108 SI Materials and Methods Determination of the Electric Field Strength Required for Successful Electroporation. The transformation construct

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.

More information

CSS451 Spring 2010 Polymerase Chain Reaction Laboratory

CSS451 Spring 2010 Polymerase Chain Reaction Laboratory CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis *

Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis * Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis * Laboratory of Pediatric Infectious Diseases, Department of Pediatrics and Laboratory of Medical Immunology,

More information

MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION

MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION ICBAA2017-30 MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION Mohd Shahrul Nizwanshah Karim and Siti Nor Akmar Abdullah Laboratory

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Figure S1. Study of mgtl translation in vitro. (A) Detection of 5 LR RNA using wild-type and anti-sd (91-95) substituted templates in a transcription-translation

More information

Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19

Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 IVANA KOMLJENOVIC Department of Microbiology and Immunology,

More information

Thermo Scientific Extensor Long Range PCR Enzyme Mix

Thermo Scientific Extensor Long Range PCR Enzyme Mix Thermo Scientific Etensor Long Range PCR Enzyme Mi Description: Kit Contents: The Etensor Long Range PCR Enzyme Mi is a blend of ThermoPrime Taq DNA Polymerase and a proprietary proofreading enzyme. The

More information

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...

Table of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture... Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.

More information

amplification of the 5 flanking region of CAT1 with a tail for the geneticin resistance gene cassette fusion CAT1-3F

amplification of the 5 flanking region of CAT1 with a tail for the geneticin resistance gene cassette fusion CAT1-3F Supplementary materials Table S1. Primer list. Primer Sequence a (5-3 ) Description CAT1-5F CAT1-5R ATACGGATAAGGAAGCGATAGCAGCA gcacaggtacacttgtttagagagcgatccggattttaagtgaacg amplification of the 5 flanking

More information

PrimeSTAR Max DNA Polymerase

PrimeSTAR Max DNA Polymerase Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.

More information

Supplementary Information

Supplementary Information Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA

More information

Enhanced Arginase production: rocf

Enhanced Arginase production: rocf Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria

More information

A new Strategy for Gene Deletion in Campylobacter jejuni

A new Strategy for Gene Deletion in Campylobacter jejuni Roumanian Biotechnological Letters Vol. 14, No. 3, 2009, pp. 4381-4389 Copyright 2008 Bucharest University Printed in Romania. All rights reserved Roumanian Society of Biological Sciences ORIGINAL PAPER

More information

Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR

Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR WHITE PAPER Platinum II Taq Hot-Start DNA Polymerase Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR Abstract The advances in thermal cycler technology permit a substantial increase in

More information

4. Analysing genes II Isolate mutants*

4. Analysing genes II Isolate mutants* .. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual

More information

Procomcure Biotech. PCR Reagents

Procomcure Biotech. PCR Reagents Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR

More information

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase H. Liu, R. Ye and Y.Y. Wang Department of Medical Microbiology and Parasitology, School of

More information

MightyAmp DNA Polymerase Ver.3

MightyAmp DNA Polymerase Ver.3 Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...

More information

7.02/ RECOMBINANT DNA METHODS EXAM KEY

7.02/ RECOMBINANT DNA METHODS EXAM KEY MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 RECOMBINANT DNA METHODS EXAM KEY Regrade requests are due to the instructor in the 7.02 teaching lab by the

More information

Amplification Products for PCR and RT-PCR

Amplification Products for PCR and RT-PCR Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format

More information

Next Generation Polymerase Chain Reaction

Next Generation Polymerase Chain Reaction Next Generation Polymerase Chain Reaction Developed by Nobel laureate Kary Mullis in the 1980s, Polymerase Chain Reaction (PCR) is a molecular technology that allows fast and in vitro. It has since become

More information

Construction of Glycine Oxidase Mutant Libraries by Random Mutagenesis, Site Directed Mutagenesis and DNA Shuffling Tao Zhan1, 2*

Construction of Glycine Oxidase Mutant Libraries by Random Mutagenesis, Site Directed Mutagenesis and DNA Shuffling Tao Zhan1, 2* Construction of Glycine Oxidase Mutant Libraries by Random Mutagenesis, Site Directed Mutagenesis and DNA Shuffling Tao Zhan1, 2* 1 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences,

More information

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm.

Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm. MosTIC (Mos1 excision induced Transgene Instructed gene Conversion) Valérie Robert (vrobert@biologie.ens.fr) and Jean-Louis Bessereau (jlbesse@biologie.ens.fr) (November 2006) Introduction: MosTIC (Robert

More information

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003 PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed

More information

PCR KIT/REAGENTS/BUFFERS/PRIMERS

PCR KIT/REAGENTS/BUFFERS/PRIMERS PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all

More information

Supplementary Methods pcfd5 cloning protocol

Supplementary Methods pcfd5 cloning protocol Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC Preparing Plasmid Constructs to Investigate the Characteristics of Thiol Reductase and Flavin Reductase With Regard to Solubilizing Insoluble Proteinase Inhibitor 2 in Bacterial Protein Overexpression

More information

CHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract

CHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract CHAPTER FOUR Characterization of parasporal genes in Paenibacillus popilliae and Paenibacillus lentimorbus Abstract The parasporal gene, cry18aa1, was cloned and sequenced by Zhang et al. (4) from the

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Regulatory Mechanism of Mycotoxin Tenuazonic Acid Production in Pyricularia oryzae

Regulatory Mechanism of Mycotoxin Tenuazonic Acid Production in Pyricularia oryzae 1 Supporting Information 2 3 4 5 6 Regulatory Mechanism of Mycotoxin Tenuazonic Acid Production in Pyricularia oryzae Choong-Soo Yun, Takayuki Motoyama, and Hiroyuki Osada* Chemical Biology Research Group,

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD FX 1108 F0935K KOD FX KFX-101 200 U 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol

More information

Chapter 10 (Part II) Gene Isolation and Manipulation

Chapter 10 (Part II) Gene Isolation and Manipulation Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

HE Swift Cloning Kit

HE Swift Cloning Kit HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100

More information

Multiplex PCR Assay Kit Ver.2

Multiplex PCR Assay Kit Ver.2 Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

E.Z.N.A. Microorganism Direct PCR Kit

E.Z.N.A. Microorganism Direct PCR Kit E.Z.N.A. Microorganism Direct PCR Kit TQ3100-00 TQ3100-01 TQ3100-02 20 preps 100 preps 500 preps June 2013 E.Z.N.A. Microorganism Direct PCR Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

DNA Amplification RNA Amplification Real-Time PCR Customized PCR

DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA Amplification RNA Amplification Real-Time PCR Customized PCR Selection Guide Overview AccuPower PreMix series is an innovative PCR master mix product range designed to make your PCR, reverse transcription

More information

10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea

10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) CERTIFICATE OF ANALYSIS (1603-V01R03) Contents HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) Cat. No. HT250/HT250N HT500/HT500N HT2500/HT2500N Hot-Taq (2.5 units/μl)

More information

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3: Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)

More information

Ready_to_use Fast Seamless Cloning Kit. User Manual

Ready_to_use Fast Seamless Cloning Kit. User Manual For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com

More information

Creating pentr vectors by BP reaction

Creating pentr vectors by BP reaction Creating pentr vectors by BP reaction Tanya Lepikhova and Rafael Martinez 15072011 Overview: 1. Design primers to add the attb sites to gene of interest 2. Perform PCR with a high fidelity DNA polymerase

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

RTS Wheat Germ LinTempGenSet, His 6 -tag Manual

RTS Wheat Germ LinTempGenSet, His 6 -tag Manual RTS Wheat Germ LinTempGenSet, His 6 -tag Manual For rapid production of linear expression templates using PCR RTS Wheat Germ LinTempGenSet, His6-tag, April, 2015 2015 biotechrabbit, all rights reserved.

More information

Table of content. 1. Description Component Specification Optimization of parameters Extension time...

Table of content. 1. Description Component Specification Optimization of parameters Extension time... Table of content 1. Description... 2 2. Component... 2 3. Specification... 2 4. Optimization of parameters... 3 4-1. Extension time... 3 4-2. Enzyme concentration... 3 4-3. Template DNA... 3 4-4. Primer...

More information

Efficient Multi-site-directed Mutagenesis directly from Genomic Template.

Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis

More information

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen

More information

MgCl 2 (25 mm) 1.6 ml 1.6 ml 1.6 ml 1.6 ml

MgCl 2 (25 mm) 1.6 ml 1.6 ml 1.6 ml 1.6 ml Technical Data Sheet KAPA2G Fast PCR Kit Kit components KK 5008 Product codes KK 5010 KK 5009 KK 5011 KAPA2G Fast DNA polymerase (5 U/μl) 100 U 100 U 250 U 250 U 1. Production Description The KAPA2G Fast

More information

BRED: Bacteriophage Recombineering with Electroporated DNA

BRED: Bacteriophage Recombineering with Electroporated DNA Phagehunting Program BRED: Bacteriophage Recombineering with Electroporated DNA Introduction We have developed a system for generating mutations in lytically replicating mycobacteriophages that we have

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

RTS 100 E. coli LinTempGenSet, Histag

RTS 100 E. coli LinTempGenSet, Histag RTS 100 E. coli LinTempGenSet, Histag Manual For rapid production of linear expression templates using PCR RTS 100 E. coli LinTempGenSet, His-tag Manual, October, 2009 2009 5 PRIME, all rights reserved.

More information

Supporting Information

Supporting Information Supporting Information Transition Metal Dichalcogenide Nanosheets for Visual Monitoring PCR Rivaling a Real-Time PCR Instrument Liu Wang 1,2, Zhicheng Huang 2, Rui Wang 1, Yibo Liu 2, Cheng Qian 1, Jian

More information

Xcc strains 8004, ATCC33913, B100 and B Rectangular squares indicate the

Xcc strains 8004, ATCC33913, B100 and B Rectangular squares indicate the Supplementary information Title: Characterization of the GntR family regulator HpaR1 of the crucifer black rot pathogen Xanthomonas campestris pathovar campestris. Authors: Hui-Zhao Su, Liu Wu, Yan-Hua

More information

Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA

Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

AmpliTaq 360 DNA Polymerase

AmpliTaq 360 DNA Polymerase Product Bulletin AmpliTaq 360 AmpliTaq 360 360 Coverage for a Full Range of Targets AmpliTaq 360 Benefits Optimized for the broadest range of targets (

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2 9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Generation of gene knockout vectors for Dictyostelium discoideum

Generation of gene knockout vectors for Dictyostelium discoideum Generation of gene knockout vectors for Dictyostelium discoideum Instruction manual Last date of revision April 2012 2015 Version PR29-0001 PR29-0003 www.stargate.com This manual can be downloaded under

More information

In this edition of Marketplace Special offers on Thermo Scientific products:

In this edition of Marketplace Special offers on Thermo Scientific products: In this edition of Marketplace Special offers on Thermo Scientific products: Cloning Enzymes and Kits FastDigest Enzymes GeneJET Nucleic Acid Purification Kits TopVision Agarose Tablets PCR Plastic Consumables

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual for KOD -Multi & Epi- 1612 F1440K KOD -Multi & Epi- KME-101 200 U 200 reactions Store at 20 C Contents [1] Introduction [2] Components [3] Primer design [4] Template [5] Cloning of PCR

More information

BRED: Bacteriophage Recombineering with Electroporated DNA

BRED: Bacteriophage Recombineering with Electroporated DNA BRED: Bacteriophage Recombineering with Electroporated DNA Introduction We have developed a system for generating mutations in lytically replicating mycobacteriophages that we have termed BRED: Bacteriophage

More information

PlantDirect TM Multiplex PCR System

PlantDirect TM Multiplex PCR System PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

TABLE S1. Sequences of the primers used for RT-PCR and PCR

TABLE S1. Sequences of the primers used for RT-PCR and PCR TABLE S1. Sequences of the primers used for RT-PCR and PCR Primer Sequence (5 to 3 ) Purpose Cloning: posuprtid-1 & posuprtid-2 deletion plasmids DM01 AGCTCCAGCGGGTCGCCGGGGTTGGCC DM02 CCAGCGGGTCGCCGGGGTTGGCC

More information

Supplementary Material

Supplementary Material Supplementary Material Gene Inactivation Study on gntk, a Putative C-methyltransferase Gene in Gentamicin Biosynthesis from Micromonospora echinospora Suman Karki Jin-Yong Kim Si-Hyung Park Hyung-Jin Kwon

More information

KOD -Plus- Mutagenesis Kit

KOD -Plus- Mutagenesis Kit Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.

More information

Chapter 4. Recombinant DNA Technology

Chapter 4. Recombinant DNA Technology Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon

More information

DNA fragments generated with the KAPA Plant PCR Kits are A-tailed and suitable for use with TA cloning vectors.

DNA fragments generated with the KAPA Plant PCR Kits are A-tailed and suitable for use with TA cloning vectors. KAPA Plant PCR Kit Technical Data Sheet Product description Amplification of plant-derived DNA is a challenging application due to the diversity of plant tissue types and the potent PCR inhibitors contained

More information