Simple Deletion: a vector- and marker-free method to generate and isolate site-directed
|
|
- Mary Carson
- 5 years ago
- Views:
Transcription
1 Electronic supplementary materials Simple Deletion: a vector- and marker-free method to generate and isolate site-directed deletion mutants Yasuhiro Inoue 1, Seiji Tsuge 2 1 National Agriculture and Food Research Organization, National Agricultural Research Center, Tsukuba, Ibaraki, , Japan 2 Graduate School of Agriculture, Kyoto Prefectural University, Kyoto, Japan Corresponding author: Yasuhiro Inoue 1
2 Fig. S1 PCR amplification test to generate Xanthomonas campestris pv. campestris mutants with a kanamycin-resistance gene instead of the 20.4-kb hrp gene cluster. Kanamycin-resistant clones and the parental strain were used as templates for PCR analyses with primers 7 and 8 (a), 9 and 10 (b), and 5 and 6 (c). Lanes 1 10, kanamycin-resistant clones; M, 1 kb Plus DNA ladder (Invitrogen, Carlsbad, CA, USA); P, parental strain. In clones containing an ectopic mutation, a 24.4-kb fragment derived from the wild-type hrp region was expected to be amplified by PCR using primers 5 and 6, but it was not produced under the condition tested (c, lanes 1 7) 2
3 Fig. S2 Effect of DNase I on elimination of the inoculum DNA in culture. One microgram pdhrp was added to 1 ml of Xanthomonas campestris pv. campestris culture with (lanes 4 6) or without (lanes 1 3) 35 units DNase I. One microlitre of the culture was used for PCR with primers 7 and 8. The arrow indicates the 574-bp fragment derived from the inoculum DNA 3
4 Generating of deletion mutants by using the Simple Deletion method Construction of DNA fragments for homologous recombination The DNA fragments used in the homologous recombination experiment to obtain hrpg and hrpg-hrpx deletion mutants of Xanthomonas campestris pv. campestris and an hrpf-hrpc deletion mutant of Ralstonia solanacearum were constructed as follows. Xanthomonas campestris pv. campestris (Xcc) strain H7601 (MAFF ) and Ralstonia solanacearum (Rs) strain 8242 (MAFF107633) were used. Primers were arranged in a similar manner to those used for the Xcc deletion mutant of the hrp genes cluster (Fig. 1). Primer sequences are listed in Table S1. Bacterial suspensions (5 µl) were heated for 2 min at 98 C and used as templates for PCR amplification. Because of the high GC content of the sequences flanking the hrpg-hrpx region of Xcc and the hrpf-hrpc region of Rs, we tried various kinds of DNA polymerases (as described below) to achieve optimal amplification of each DNA fragment from each template. In the case of Xcc mutants, the upstream and the downstream regions were both amplified using LA Taq DNA polymerase with 2 GC buffer I (Takara Bio, Otsu, Japan) and the reaction solution recommended by the manufacturer. The PCR conditions were as follows: 2 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 60 C, and 90 s at 72 C; and a final incubation for 7 min at 72 C. Amplified fragments were annealed with each other and then subjected to DNA extension and PCR amplification by using iproof High-Fidelity DNA polymerase (Bio-Rad, Hercules, CA) with primers 1 and 4, according to the manufacturer s instructions under the following conditions: 30 s at 98 C; 30 cycles of 15 s at 98 C, 15 s at 62 C, and 105 s at 72 C; and a final incubation for 5 min at 72 C. 4
5 For PCR amplification from Rs, KAPA2G Robust HotStart DNA Polymerase (KAPA Biosystems, Woburn, MA) was used according to the manufacturer s instructions under the following conditions: 3 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 57.5 C, and 90 s at 72 C; and a final incubation for 5 min at 72 C. Fragments were annealed with each other and then subjected to DNA extension and PCR by using Pyrobest DNA polymerase (Takara Bio) with primers 1 and 4, according to the manufacturer s instructions under the following conditions: 2 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 57.5 C, and 2 min at 72 C; and a final incubation for 5 min at 72 C. (Note: In these cases, primers 5 and 2 and primers 3 and 6 were used to amplify the region flanking the 5 end of the target (upstream region) and the region flanking the 3 end of the target (downstream region), respectively. When the fragments were connected with each other, a pfu-based enzyme was used with primers 1 and 4. These procedures decreased nonspecific amplification and made it possible to omit the T4 DNA polymerase treatment.) PCR conditions for sib selection to detect and isolate deletion mutants The nested PCRs using KAPA2G Robust HotStart DNA Polymerase (KAPA Biosystems) with GC buffer were performed according to the manufacturer s instructions. The primary PCR was performed under the following conditions: 3 min at 95 C; 30 cycles of 30 s at 95 C, 30 s at 57.5 C; and 33 s (for detection of the Xcc hrpg deletion mutant) or 50 s at 72 C (for detection of the Xcc hrpg-hrpx deletion mutant and Rs hrpf-hrpc deletion mutant); and a final incubation for 5 min at 72 C. The secondary PCR was performed under the following conditions: 3 min at 95 C; 30 cycles of 30 s at 95 C, 30 s 5
6 at 57.5 C; and a final incubation for 5 min at 72 C. The numbers of mutant-containing cultures detected at each step are listed in Table S2. Generation and isolation of the mutant was confirmed by performing PCR analyses (Fig. S3). 6
7 Table S1. Primers used for deletion of the hrpg gene and the hrpg-hrpx region of Xanthomonas campestris pv. campestris and the hrpf-hrpc region of Ralstonia solanacearum For 685-bp deletion of hrpg gene of Xcc Primer Position on AE a Sequence CACTGGCCGAGAAGACGA , TCGTACTGACGCACCTTCCAAGGGCATGAC , GCCCTTGGAAGGTGCGTCAGTACGAATGCC AAGCCGAAGATGTCTCCA TTGCGATGGGTGAGAAGG TTGGCCTGGCAATACTCG CGCCGTTGTCGTTTATGGG GGTCTACACCTGCACGTTG GCGCAGCTTGTAGATGTG ACTTGCTGGCCTGGTATC For 2963-bp deletion of hrpg-hrpx region of Xcc Position on AE a CACTGGCCGAGAAGACGA , TCCATCGGCGCTACCTTCCAAGGGCATGAC , GCCCTTGGAAGGTAGCGCCGATGGAAACCCT GAGCAACATGCCACGCAA TTGCGATGGGTGAGAAGG TTCGGAGAGTGCGTGTTG CGCCGTTGTCGTTTATGGG TGCGAGCCGGAAAGGATAG GCGCAGCTTGTAGATGTG ACTTGCTGGCCTGGTATC For 2545-bp deletion of hrpf-hrpc region of Rs Position on AL b ATGCCGGATCAGGCAGACAC , CTGGTATCGAACCAGGCATCGTTGGCGTCCTTGATGAG , CTCATCAAGGACGCCAACGATGCCTGGTTCGATACCAG CGCAACCGCGTTCATATCGG TCATGATCCAGGGTCCGAC GCGTCCTGCATGTAGGTC CGGTTCCCTCGATCTATCC GGAGACGTTGTCGATGAGG AGGACGAAGACGCCGTATC GTGCGATCTCGTCAAGCAG a GenBank accession number of the genome sequence of Xcc ATCC b GenBank accession number of the mega plasmid sequence of Rs GMI
8 Table S2. PCR-based sib selection to isolate hrpg and hrpg-hrpx deletion mutants of Xanthomonas campestris pv. campestris and a hrpf-hrpc deletion mutant of Ralstonia solanacearum Sib selection step 685 bp of hrpg gene of Xcc 2963 bp of hrpg-hrpx region of Xcc 2545 bp of hrpf-hrpc region of Rs 1 3/96 a) 6/96 4/96 2 1/48 5/48 4/48 3 1/48 3/48 3/48 4 5/48 10/44 7/72 5 3/48 17/48 1/48 6 7/48 1/48 NT b) a) Numbers of samples containing mutants per numbers of samples tested are shown. b) After step 5, single colonies were isolated. Expected ratios of mutants to total bacteria in each sample are 1:10 6 (step 1), 1:10 5 (step 2), 1:10 4 (step 3), 1:10 3 (step 4), 1:10 2 (step 5) and 1:10 1 (step 6). 8
9 a b c Fig. S3 PCR amplification test for mutants. PCR analysis was used to detect Xanthomonas campestris pv. campestris (Xcc) mutants with a deletion of the hrpg gene (a), Xcc mutants with a deletion of the hrpg-hrpx genes (b), and Ralstonia solanacearum (Rs) mutants with a deletion of the hrpf-hrpc genes (c). Two mutants and the parental strain were used as templates for each PCR using primers 5 and 6 (lanes 1 3), 7 and 8 (lanes 4 6), or 9 and 10 (lanes 7 9). Lanes 1, 2, 4, 5, 7 and 8 correspond to the mutant strain; lanes 3, 6, 9 correspond to the parental strain; and M corresponds to the 1 kb Plus DNA ladder. Arrows mark expected fragments. In the parental strain of Xcc, a 6.23-kb fragment was expected to be amplified by PCR using primers 5 and 6, but it was not produced under our conditions (b; lane 3). Also in the parental strain of Rs, a 6.53-kb fragment was expected to be amplified by PCR using primers 5 and 6, but it was not produced under the conditions that we used (c; lane 3). 9
NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network
NEW PARADIGM of BIOTECHNOLOGY - GENET BIO GeNet Bio Global Gene Network GENET BIO DNA AMPLIFICATION PRODUCTS GUIDE Keynote of Products Prime TaqTM DNA Polymerase Prime TaqTM Premix ExPrime TaqTM DNA Polymerase
More informationE-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA
E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department
More informationKAPA HiFi HotStart ReadyMix PCR Kit
KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationCalifornia Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab
Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%
More informationUser Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only
DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version
More informationApplication Notes
Application Notes Superior Performance and Flexibility In order to minimize errors in DNA replication during PCR, it is essential to choose a high-fidelity DNA polymerase enzyme. The introduction of errors
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationSupplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC
Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)
More informationCold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual
Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.
More informationFastGene Optima. Products for PCR. proof-reading. ReadyMix. cdna SNP. routine PCR. polymerase. optimized blend complex templates. N gene knock out B O
Products for PCR www.nippongenetics.eu efficiency polymerase convenience endpoint PCR incl. loading dye direct PCR incl. dntps engineered enzyme archeal type B polymerase high GC content FastGene tissuebest
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationSpeedSTAR HS DNA Polymerase
Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...
More informationFAQs: PCR Polymerases from Takara Bio
FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly
More informationThe plasmid for the HLY production was constructed by using the MutliSite Gateway TM
Supplementary methods and table The plasmid for the HLY production 1 1 1 The plasmid for the HLY production was constructed by using the MutliSite Gateway TM system (Mabashi et al. 00). The HLY gene was
More informationOur new breed is the center of attention.
AMPLIFICATION CELL BIOLOGY CLONING MICROARRAYS NUCLEIC ACID ANALYSIS PROTEIN FUNCTION & ANALYSIS QUANTITATIVE PCR SOFTWARE SOLUTIONS Our new breed is the center of attention. II enzyme for highest fidelity
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationDesigning and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive
Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are
More informationPuro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
More informationCombinatorial Evolution of Enzymes and Synthetic pathways Using
Supplementary data Combinatorial Evolution of Enzymes and Synthetic pathways Using One-Step PCR Peng Jin,, Zhen Kang,,, *, Junli Zhang,, Linpei Zhang,, Guocheng Du,, and Jian Chen, The Key Laboratory of
More informationSupporting Information
Supporting Information Kilian et al. 10.1073/pnas.1105861108 SI Materials and Methods Determination of the Electric Field Strength Required for Successful Electroporation. The transformation construct
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.
More informationCSS451 Spring 2010 Polymerase Chain Reaction Laboratory
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationGeneration of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis *
Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis * Laboratory of Pediatric Infectious Diseases, Department of Pediatrics and Laboratory of Medical Immunology,
More informationMUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION
ICBAA2017-30 MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION Mohd Shahrul Nizwanshah Karim and Siti Nor Akmar Abdullah Laboratory
More informationSupplementary Information
Supplementary Information Supplementary Figures Figure S1. Study of mgtl translation in vitro. (A) Detection of 5 LR RNA using wild-type and anti-sd (91-95) substituted templates in a transcription-translation
More informationConstruction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19
Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 IVANA KOMLJENOVIC Department of Microbiology and Immunology,
More informationThermo Scientific Extensor Long Range PCR Enzyme Mix
Thermo Scientific Etensor Long Range PCR Enzyme Mi Description: Kit Contents: The Etensor Long Range PCR Enzyme Mi is a blend of ThermoPrime Taq DNA Polymerase and a proprietary proofreading enzyme. The
More informationTable of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...
Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.
More informationamplification of the 5 flanking region of CAT1 with a tail for the geneticin resistance gene cassette fusion CAT1-3F
Supplementary materials Table S1. Primer list. Primer Sequence a (5-3 ) Description CAT1-5F CAT1-5R ATACGGATAAGGAAGCGATAGCAGCA gcacaggtacacttgtttagagagcgatccggattttaagtgaacg amplification of the 5 flanking
More informationPrimeSTAR Max DNA Polymerase
Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.
More informationSupplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
More informationEnhanced Arginase production: rocf
Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria
More informationA new Strategy for Gene Deletion in Campylobacter jejuni
Roumanian Biotechnological Letters Vol. 14, No. 3, 2009, pp. 4381-4389 Copyright 2008 Bucharest University Printed in Romania. All rights reserved Roumanian Society of Biological Sciences ORIGINAL PAPER
More informationPlatinum II Taq Hot-Start DNA Polymerase for high-throughput PCR
WHITE PAPER Platinum II Taq Hot-Start DNA Polymerase Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR Abstract The advances in thermal cycler technology permit a substantial increase in
More information4. Analysing genes II Isolate mutants*
.. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual
More informationProcomcure Biotech. PCR Reagents
Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR
More informationHighly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase
Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase H. Liu, R. Ye and Y.Y. Wang Department of Medical Microbiology and Parasitology, School of
More informationMightyAmp DNA Polymerase Ver.3
Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...
More information7.02/ RECOMBINANT DNA METHODS EXAM KEY
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 RECOMBINANT DNA METHODS EXAM KEY Regrade requests are due to the instructor in the 7.02 teaching lab by the
More informationAmplification Products for PCR and RT-PCR
Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format
More informationNext Generation Polymerase Chain Reaction
Next Generation Polymerase Chain Reaction Developed by Nobel laureate Kary Mullis in the 1980s, Polymerase Chain Reaction (PCR) is a molecular technology that allows fast and in vitro. It has since become
More informationConstruction of Glycine Oxidase Mutant Libraries by Random Mutagenesis, Site Directed Mutagenesis and DNA Shuffling Tao Zhan1, 2*
Construction of Glycine Oxidase Mutant Libraries by Random Mutagenesis, Site Directed Mutagenesis and DNA Shuffling Tao Zhan1, 2* 1 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences,
More informationFast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase
APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationMos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm.
MosTIC (Mos1 excision induced Transgene Instructed gene Conversion) Valérie Robert (vrobert@biologie.ens.fr) and Jean-Louis Bessereau (jlbesse@biologie.ens.fr) (November 2006) Introduction: MosTIC (Robert
More informationPCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003
PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed
More informationPCR KIT/REAGENTS/BUFFERS/PRIMERS
PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all
More informationSupplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationJournal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC
Preparing Plasmid Constructs to Investigate the Characteristics of Thiol Reductase and Flavin Reductase With Regard to Solubilizing Insoluble Proteinase Inhibitor 2 in Bacterial Protein Overexpression
More informationCHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract
CHAPTER FOUR Characterization of parasporal genes in Paenibacillus popilliae and Paenibacillus lentimorbus Abstract The parasporal gene, cry18aa1, was cloned and sequenced by Zhang et al. (4) from the
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationRegulatory Mechanism of Mycotoxin Tenuazonic Acid Production in Pyricularia oryzae
1 Supporting Information 2 3 4 5 6 Regulatory Mechanism of Mycotoxin Tenuazonic Acid Production in Pyricularia oryzae Choong-Soo Yun, Takayuki Motoyama, and Hiroyuki Osada* Chemical Biology Research Group,
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD FX 1108 F0935K KOD FX KFX-101 200 U 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationHE Swift Cloning Kit
HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100
More informationMultiplex PCR Assay Kit Ver.2
Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationE.Z.N.A. Microorganism Direct PCR Kit
E.Z.N.A. Microorganism Direct PCR Kit TQ3100-00 TQ3100-01 TQ3100-02 20 preps 100 preps 500 preps June 2013 E.Z.N.A. Microorganism Direct PCR Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationDNA Amplification RNA Amplification Real-Time PCR Customized PCR
DNA Amplification RNA Amplification Real-Time PCR Customized PCR Selection Guide Overview AccuPower PreMix series is an innovative PCR master mix product range designed to make your PCR, reverse transcription
More information10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea
HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) CERTIFICATE OF ANALYSIS (1603-V01R03) Contents HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) Cat. No. HT250/HT250N HT500/HT500N HT2500/HT2500N Hot-Taq (2.5 units/μl)
More informationStep 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:
Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)
More informationReady_to_use Fast Seamless Cloning Kit. User Manual
For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com
More informationCreating pentr vectors by BP reaction
Creating pentr vectors by BP reaction Tanya Lepikhova and Rafael Martinez 15072011 Overview: 1. Design primers to add the attb sites to gene of interest 2. Perform PCR with a high fidelity DNA polymerase
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationRTS Wheat Germ LinTempGenSet, His 6 -tag Manual
RTS Wheat Germ LinTempGenSet, His 6 -tag Manual For rapid production of linear expression templates using PCR RTS Wheat Germ LinTempGenSet, His6-tag, April, 2015 2015 biotechrabbit, all rights reserved.
More informationTable of content. 1. Description Component Specification Optimization of parameters Extension time...
Table of content 1. Description... 2 2. Component... 2 3. Specification... 2 4. Optimization of parameters... 3 4-1. Extension time... 3 4-2. Enzyme concentration... 3 4-3. Template DNA... 3 4-4. Primer...
More informationEfficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
More informationPurification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost
Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen
More informationMgCl 2 (25 mm) 1.6 ml 1.6 ml 1.6 ml 1.6 ml
Technical Data Sheet KAPA2G Fast PCR Kit Kit components KK 5008 Product codes KK 5010 KK 5009 KK 5011 KAPA2G Fast DNA polymerase (5 U/μl) 100 U 100 U 250 U 250 U 1. Production Description The KAPA2G Fast
More informationBRED: Bacteriophage Recombineering with Electroporated DNA
Phagehunting Program BRED: Bacteriophage Recombineering with Electroporated DNA Introduction We have developed a system for generating mutations in lytically replicating mycobacteriophages that we have
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationRTS 100 E. coli LinTempGenSet, Histag
RTS 100 E. coli LinTempGenSet, Histag Manual For rapid production of linear expression templates using PCR RTS 100 E. coli LinTempGenSet, His-tag Manual, October, 2009 2009 5 PRIME, all rights reserved.
More informationSupporting Information
Supporting Information Transition Metal Dichalcogenide Nanosheets for Visual Monitoring PCR Rivaling a Real-Time PCR Instrument Liu Wang 1,2, Zhicheng Huang 2, Rui Wang 1, Yibo Liu 2, Cheng Qian 1, Jian
More informationXcc strains 8004, ATCC33913, B100 and B Rectangular squares indicate the
Supplementary information Title: Characterization of the GntR family regulator HpaR1 of the crucifer black rot pathogen Xanthomonas campestris pathovar campestris. Authors: Hui-Zhao Su, Liu Wu, Yan-Hua
More informationMarker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA
Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationAmpliTaq 360 DNA Polymerase
Product Bulletin AmpliTaq 360 AmpliTaq 360 360 Coverage for a Full Range of Targets AmpliTaq 360 Benefits Optimized for the broadest range of targets (
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationYG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2
9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationGeneration of gene knockout vectors for Dictyostelium discoideum
Generation of gene knockout vectors for Dictyostelium discoideum Instruction manual Last date of revision April 2012 2015 Version PR29-0001 PR29-0003 www.stargate.com This manual can be downloaded under
More informationIn this edition of Marketplace Special offers on Thermo Scientific products:
In this edition of Marketplace Special offers on Thermo Scientific products: Cloning Enzymes and Kits FastDigest Enzymes GeneJET Nucleic Acid Purification Kits TopVision Agarose Tablets PCR Plastic Consumables
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual for KOD -Multi & Epi- 1612 F1440K KOD -Multi & Epi- KME-101 200 U 200 reactions Store at 20 C Contents [1] Introduction [2] Components [3] Primer design [4] Template [5] Cloning of PCR
More informationBRED: Bacteriophage Recombineering with Electroporated DNA
BRED: Bacteriophage Recombineering with Electroporated DNA Introduction We have developed a system for generating mutations in lytically replicating mycobacteriophages that we have termed BRED: Bacteriophage
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationTABLE S1. Sequences of the primers used for RT-PCR and PCR
TABLE S1. Sequences of the primers used for RT-PCR and PCR Primer Sequence (5 to 3 ) Purpose Cloning: posuprtid-1 & posuprtid-2 deletion plasmids DM01 AGCTCCAGCGGGTCGCCGGGGTTGGCC DM02 CCAGCGGGTCGCCGGGGTTGGCC
More informationSupplementary Material
Supplementary Material Gene Inactivation Study on gntk, a Putative C-methyltransferase Gene in Gentamicin Biosynthesis from Micromonospora echinospora Suman Karki Jin-Yong Kim Si-Hyung Park Hyung-Jin Kwon
More informationKOD -Plus- Mutagenesis Kit
Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.
More informationChapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
More informationDNA fragments generated with the KAPA Plant PCR Kits are A-tailed and suitable for use with TA cloning vectors.
KAPA Plant PCR Kit Technical Data Sheet Product description Amplification of plant-derived DNA is a challenging application due to the diversity of plant tissue types and the potent PCR inhibitors contained
More information