INNOVAPI WP3 Activity 3 Health Parameters
|
|
|
- Evangeline Campbell
- 5 years ago
- Views:
Transcription
1 Harmonization of methods for measuring viral load and bio-markers of aging Stage1 : Quality check of extracted RNA in Torino A qpcr on 18S gene showed that the extracted samples also contain genomic DNA. to remind for primer design on honey bee genes! Stage 2 : Preliminary assays of cdna synthesis and qpcr with primers targeting the five honey bee viruses Substitution of one pair of primers (ABPV complex) that showed aspecificity.
2 Embrun, 9 & 10 October 2017 Harmonization of methods for measuring viral load and bio-markers of aging Stage 3 : Cross-Tests Bees Origin : INRA France UR406 (17/08/2017). 1 Sample = 40 bees 8 samples (FR-1 to FR-6) 8 samples (FR-10 to FR-17) For each laboratory RNA Extraction 4 samples traited with Qiacube Robot and 4 samples traited without Qiacube Robot RNA Concentrations and Ratios are good and similar with the two methods in the two laboratories.
3 Harmonization of methods for measuring viral load and bio-markers of aging Stage 3 : Cross-Tests RT-PCR : waiting for orders, to follow qpcr : waiting to orders, to follow... Visit INRA to DISAFA : 21 and 22 august Visit DIFASA to INRA : planned in october or november 2017.
4 Harmonization of methods for measuring viral load and bio-markers of aging Stage 4 :Production of Positive Controls Infected samples from Avignon were used as template to clone the virus sequences and to prepare the standard DNA Selection of 7 positive samples for DWV, BQCV, ABPV, CBPV and SBV Production of cdna (RT-PCR) Production of probes for qpcr by cloning Ok on the 2 october 2017
5 1. Primer design on sequences of virus genomes external to the target regions 2. Amplification of cdna, verification on gel electrophoresis and purification of the PCR products DWV (470 bp) SBV (890 bp) BQCV (845 bp) CBPV (925 bp) APBV (118 bp)
6 3. Ligation of the inserts (=purified PCR products) into pgem-t Easy vector by T4 ligase DWV (470 bp) SBV (890 bp) ABPV (118 bp) CBPV (925 bp) BQCV (845 bp)
7 4. Transformation of Escherichia coli DH5α competent cells by heat shock 5. Blue/White screening after overnight growth (37 C) on LB + amp + IPTG + X-Gal BLUE = no insert WHITE = insert interrupting LacZ operon
8 6. Colony PCR on white colonies for selection of transformed clones DWV SBV SBV ABPV BQCV CBPV 7. Minipreps of plasmid DNA from the selected colonies
9 8. Sequencing of the inserts Plasmids correctly integrated the five fragments in their entire sequences Some mismatches in the target sequences of the primers chosen for the detection of BQCV, CBPV and SBV, however not at the 3 end
10 9. Realtime qpcr assays with serial dilutions of plasmid DNA: Deformed Wing Virus DWV (primers: F8688, B8794; amplicon size = 143)
11 9. Realtime qpcr assays with serial dilutions of plasmid DNA: Black Queen Cell Virus ABPV complex (primers: F6099, B6164; amplicon size = 104)
12 9. Realtime qpcr assays with serial dilutions of plasmid DNA: Black Queen Cell Virus BQCV (primers: qf7893, qb8150; amplicon size = 291)
13 9. Realtime qpcr assays with serial dilutions of plasmid DNA: Black Queen Cell Virus CBPV (primers: qf1818, qb2077; amplicon size = 296)
14 9. Realtime qpcr assays with serial dilutions of plasmid DNA: Black Queen Cell Virus SBV (primers: qf3164, B3461; amplicon size = 335)
15 To Summarize : Four dilutions/standard DNA are enough to have good calibration curves : Each dilution tested has been divided in two parts and shared with Avignon lab
16 RNA concentration (ng/µl) Embrun, 9 & 10 October Biological Replicats for each field sample The Samples In Italy RNA extraction from the samples collected in July and September Quantity 3,00 Quality , MANUAL (n=53) QIACUBE (n=210) 1,00 0,00 260/ /230 MANUAL (n=53) QIACUBE (n=210)
17 2 Biological Replicats for each field sample 90 samples RNA extracts The Samples In France 1st Sampling nd sampling 2017 Code Sample Sample Date Nb Sample BM Sample Date Nb Sample BM Remarks FA17 (1 to 15) 17 08/08/ /09/ FB17 (1 to 15) 17 08/08/ /09/ FC17 (1 to 15) 17 18/08/ /09/ or 28 1 dead colony + 1 dying colony FD17 (1 to 15) 17 18/08/ /09/ dead colonies + 1 non sampled colony FE17 (1 to 7) 17 10/08/ /09/ FF17 (1 to 7) 17 10/08/ /09/ Questions and Discussion What are we doing with samples where there are not enough bees? - 1 replicat with 40 bees/bag or less than 40 bees/bag? - no analyzes of viral load? Do the dying colonies and/or not sampled colonies must be sampled to have a value of viral load just before the wasting?
18
pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions
pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu
SUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Development of Positive Control for Hepatitis B Virus
Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,
Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
Mighty TA-cloning Kit
Cat. # 6028 For Research Use Mighty TA-cloning Kit Product Manual Table of Contents I. Introduction... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage... 3 V. Vector Map...
Molecular cloning: 6 RBS+ arac/ laci
Molecular cloning: 6 RBS+ arac/ laci Resource: 6 RBS: from the parts: B0030, B0032, B0034, J61100, J61107, J61127; renamed as RBS1 RBS2 RBS6; arac: C0080 laci: C0012 July 6 th Plasmid mini prep: 6 RBS;
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
Chapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
STANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).
STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat
Title: Understanding the impact of orientation on gene expression of lux operon in pkn800 transformation into Escherichia coli DH5α
Seim - 1 Name: Darian Seim Title: Understanding the impact of orientation on gene expression of lux operon in pkn800 transformation into Escherichia coli DH5α Date: April 12 th, 2016 April 18 th, 2016
Selected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
Polymerase Chain Reaction
Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during
Ready_to_use Fast Seamless Cloning Kit. User Manual
For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com
Design. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
THE UNIVERSITY OF NEWCASTLE- DISCIPLINE OF MEDICAL BIOCHEMISTRY. STANDARD OPERATING PROCEDURE PROCEDURE NO: GLP 084 MOD: 1st Issue Page: 1 of 11
Page: 1 of 11 1. Risk Assessment: This Risk Assessment is to be used as a general guide and as such, cannot accommodate all the varying factors that may be encountered when using this procedure. Therefore,
MOLECULAR BIOLOGY GREATEST HITS. Marketplace. Essentials Tour molecular biology. thermofisher.com/marketplace
molecular biology Marketplace MOLECULAR BIOLOGY GREATEST HITS Special offers on Thermo Scientific products: Cloning kits Restriction and modifying enzymes IPTG and X-Gal DNA ladders Agarose tablets Nucleic
Lab Book igem Stockholm Lysostaphin. Week 6
Lysostaphin Week 6 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary
Bootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
Hetero-Stagger PCR Cloning Kit
Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer
DNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
PrimePCR Assay Validation Report
Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Peptidyl-glycine alpha-amidating monooxygenase Peptidylglycine alpha-hydroxylating
PrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending)
peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) Cloning PCR products for E Coli expression of N-term GST-tagged protein Cat# Contents Amounts Application IC-1004 peco-t7-ngst vector built-in
igem2013 Microbiology BMB SDU
igem2013 Microbiology BMB SDU Project type: USER PCR Project title: USER PCR of Lac promoter-dxs (E. coli) without reporter gene Sub project: Creation date: 23.07.13 Written by: SF Performed by: SIS, SF,
Supplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
Data Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
PrimePCR Assay Validation Report
Gene Information Gene Name keratin associated protein 9-2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRTAP9-2 Human This protein is a member of the keratin-associated
Table of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3
Table of contents I. Flowchart of blunt end cloning of PCR products...2 II. Description...3 III. Kit Components...3 IV. Reagents and Instruments Required...3 V. Storage...3 VI. About puc118 Hinc II/BAP...4
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of
Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin
PrimePCR Assay Validation Report
Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major
Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual
Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.
Executive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
Chapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
HE Swift Cloning Kit
HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100
Roche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
GenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
PrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
Efficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
Mighty Cloning Reagent Set (Blunt End)
Cat. # 6027 For Research Use Mighty Cloning Reagent Set (Blunt End) Product Manual Table of Contents I. Flowchart of blunt end cloning of PCR products...3 II. Description...4 III. Components...4 IV. Materials
Percent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 21 December 2012. Published. Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio
Chapter 13: Biotechnology
Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,
10X ligation buffer ligase 1 vector DNA insert DNA H 2 O. 10 µl Total Volume. 10X ligation buffer ligase 1 vector DNA insert DNA
Biol/Chem 475 S07 Study problems for quiz 1 See also questions posed in lab handouts including ligase handout Answers to questions 1&2 included at the end of this document. 1. You plan to clone a 1.0 kb
Mighty Cloning Reagent Set (Blunt End)
Cat. # 6027 For Research Use Mighty Cloning Reagent Set (Blunt End) Product Manual Table of Contents I. Flowchart of blunt end cloning of PCR products...3 II. Description...4 III. Components...4 IV. Materials
Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:
Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)
pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl
www.smobio.com Product Information GetClone PCR Cloning Vector CV1000 20 RXN pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl Storage -20 C for 24 months Features
DNA PURIFICATION KITS PLASMID DNA ISOLATION
LIST -NEW v.01-02- DNA PURIFICATION KITS PLASMID DNA ISOLATION Plasmid Mini ultrapure, high and medium copy number plasmid DNA isolation from 1.5-3 ml of bacteria culture PURIFICATION TECHNOLOGY SM 020-50
Roche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
Fun with DNA polymerase
Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase
Product Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months
www.smobio.com Product Information GetClone PCR Cloning Vector II CV1100 20 RXN pget II Vector (25 ng/μl) pget-for Primer (10 μm) pget-rev Primer (10 μm) Storage -20 C for 24 months 23 μl 100 μl 100 μl
BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
PrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 RDM Exam Study Questions 7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
PrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
Lab Book igem Stockholm Lysostaphin. Week 8
Lysostaphin Week 8 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary
Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
NZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
Table of contents. I. Description II. Kit Components III. Reagents and Instruments Required IV. Storage V. Protocols...
Table of contents I. Description... 2 II. Kit Components... 2 III. Reagents and Instruments Required... 2 IV. Storage... 2 V. Protocols... 3 VI-1. Procedure... 3 VI-2. Note... 4 VI. Control experiment...
B. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
E. 1 Isolation of smmo genes form M. capsulatus
E. 1 Isolation of smmo genes form M. capsulatus Standard Protocols: QuikChange II Site-Directed Mutagenesis Kit In order to isolate all subunit encoding genes of the smmo from M. capsulatus colony PCR
CHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
Petra, Tamannae. Made new 1:10 dilutions of P001 and P ul primer to 18 ul water
20.7.2015 MONDAY, 7/20 Petra, Tamannae Made new 1:10 dilutions of P001 and P015. 2 ul primer to 18 ul water Made new 1 ng/µl template dilution of CAR part 1. 2 µl DNA stock and 18 µl H2O Gradient PCR for
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products
igem2013 Microbiology BMB SDU
igem2013 Microbiology BMB SDU Project type: USER cloning Project title: USER cloning of DXS GFP reporter system Sub project: Creation date: 13.07.24 Written by: PRA, MHK Performed by: PRA, MHK 1. SOPs
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by
Chapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
Project: Construction of ptale Library
mcatnip Project: Construction of ptale Library Team: GreatBay_China Date: 2018-4-28 to 2018-10-04 mcatnip SUNDAY, 2018-6-24 1. Transformation of psb1a2-bba_e0240 form 2017 plate 4, 11N. Adding 10μl ddh2o
Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 5 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT5 Human The protein encoded by this gene is a member of the keratin
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
Chapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
Protocols for cell lines using CRISPR/CAS
Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable
KOD -Plus- Mutagenesis Kit
Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes