RNA-Seq Analysis. August Strand Genomics, Inc All rights reserved.
|
|
- Hillary Malone
- 5 years ago
- Views:
Transcription
1 RNA-Seq Analysis August 2014 Strand Genomics, Inc All rights reserved.
2 Contents Introduction... 3 Sample import... 3 Quantification... 4 Novel exon... 5 Differential expression Differential Splicing
3 RNA-Seq Analysis in Strand NGS Introduction For this demo, we created a RNA-Seq experiment based on the data from the paper Detection of single nucleotide variations in expressed exons of the human genome using RNA-Seq. Nucleic Acids Res; 37(16) (2009), by Chepelev I, Wei G, Tang Q and Zhao K. This experiment was conducted to find differences between CD4+ T cells from a healthy donor and Jurkat T cells, a line of T lymphocytic cells established from the peripheral blood of a 14 year old boy with T cell leukemia. At this point, we assume that Strand NGS is installed and that the steps listed in the Getting Started tutorial have been completed. Sample import The samples were aligned against the hg19 assembly. You can create the appropriate RNA-Seq analysis experiment with UCSC annotations. Other meta data selected for this experiment is shown in figure 1. A new experiment can be done either from the Project menu or from the icon in the tool bar (fourth from the left). This would launch the new experiment wizard. Figure 1: RNA-Seq experiment creation While loading samples, make sure to change the names to CD4 and Jurkat as shown below. 3
4 Figure 2: Renaming the samples It would be good to see how many reads are there in each of the samples. We can get this information by double-clicking the All Aligned Reads list. Both samples contain around 4.5 million reads. Since it is non-directional RNA-Seq, there should be an approximately equal number of +ve and -ve aligned reads. The spreadsheet in the reads list inspector contains this information as well. Quantification Quantification is an important step in a RNA-Seq experiment as it helps us in collating the raw counts of the gene to arrive at a normalized expression value. This step can be accessed from the Quantification tab in the workflow navigator. We can run quantification with the default options. At the quantification step, the user is given an option to turn on novel gene detection, choose either RPKM/DESeq/TMM as the normalization option and also the baselining options. More information about these methods can be found in the Strand NGS reference manual. 4
5 Figure 3: Quantification Workflow The navigator after quantification will look like this: Figure 4: Post-quantification navigator To aid further analysis, four gene lists are output at the end of this analysis (one containing the list of new genes found if any, one containing a list of known genes for which new partitions have been identified, one containing a list of known genes which are untouched by novel discoveries and a union of all 3 lists). Novel exon Expressed regions that do not overlap exons (of the chosen transcript model) are shown in the Novel 5
6 Detection Report. It is important that we prioritize these regions. In general, regions with decent conservation sufficient number of reads can be considered to be of higher confidence. Finding a conservation threshold The median conservation value of the known exons could be a reasonable threshold. We first need to create only the exonic regions (Utilities -> Find Genic Parts). Figure 5: Exonic Regions We can then annotate these regions with the conservation track as shown in figure 6. Then we need to create a subset of this with only chr1 exons as shown in figure 6 (using Utilities Region List Operations and the Chromosome filter) (24543 regions) Then the median conservation value can be found through the Summary statistics of the newly created region list (0.78). 6
7 Figure 6: Annotate with conservation value 7
8 Figure 7: Exonic Regions from chr1 Find the total number of reads aligned against the novel regions The novel regions already indicate the number of reads aligning against them in each sample. We need to add up these two numbers by creating a new column in Region List Operation. We can then use the filters to retain only those which have conservation at least 0.8, total reads at least 10, and are neither ambiguous nor low RPKM. 8
9 Figure 6: Invoking the new column creator 9
10 Figure 7: Filtering the novel regions We can also look at other attributes like location (internal, upstream, downstream), nature (extension, stand-alone) etc. Known gene quantification results We can look at the normalized values associated with the genes (View -> Normalized Signal values). Also isoform quantification is a part of the same quantification step and hence one can also examine the raw counts, drilled-down to the level of individual exonic regions. 10
11 Figure 8: Raw counts table We can also launch a variety of plots on these normalized values from the tool bar. Figure 9: Icon Bar Figure 10: Scatter Plot and Box Whisker Plot for Normalized values 11
12 Differential expression Before we can continue with differential expression, we need to classify the samples. This can be done using the Experimental Setup -> Experiment Grouping workflow link where we can specify the parameters for the samples. Figure 11: Sample parameters We can then create an interpretation based on this parameter from Experimental Setup -> Create Interpretation. Use Quantification -> Filter by Expression to retain only those genes which have at least 20 reads mapping to them in any one of the two conditions. 12
13 Figure 12: Filter by expression Only 1541 (of 40k) genes have this property. Fold change analysis (Expression Analysis Fold Change) can be used to find the subset having more than 2 fold change difference etc. 13
14 Figure 13: Fold change analysis Genes with more than 2 fold change, can be saved and GO analysis (Results Interpretation GO Analysis) can be used on the resulting entity list to find processes/pathways which are different between the two cell lines. Differential Splicing Differential splicing analysis can be run on the 1541 entities with reasonable number of reads in at least one sample (Expression Analysis Differential Splicing). This is based on the EM algorithm which computes the proportion of a gene s count that can be ascribed to a particular transcript. If the proportion for a particular transcript changes substantially across conditions, the gene is said to be differentially spliced Some of the genes which are differentially spliced could have the major contributor be an isoform that is not in the transcript model. The novel isoform could either be a combination of known exons, or it might involve novel exons. As a first step, we can try to ignore the genes which have novel exons and which are differentially spliced. We can save this list by clicking the Create entity list from selection button after selecting the blue area. 14
15 Figure 14: Genes which have novel exons and are differentially spliced We can then launch the gene view on the 219 gene set (Right-click menu) and view each of the genes and all the tabs in the gene view to get familiar. The gene LDLRAP1 is a good example. We can check only the partition densities and guess which transcripts are contributing to the gene expression in each sample. Check the transcript proportion tab to confirm (or re-guess). This is a very brief overview of the RNA-Seq experiment in Strand NGS. For more details or clarifications, please revert back (sales@strandngs.com or support@strandngs.com) and we will address your queries. 15
Introduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationThe first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.
Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationAnalysis of a Tiling Regulation Study in Partek Genomics Suite 6.6
Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6 The example data set used in this tutorial consists of 6 technical replicates from the same human cell line, 3 are SP1 treated, and 3
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationSeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:
More informationGene-Level Analysis of Exon Array Data using Partek Genomics Suite 6.6
Gene-Level Analysis of Exon Array Data using Partek Genomics Suite 6.6 Overview This tutorial will demonstrate how to: Summarize core exon-level data to produce gene-level data Perform exploratory analysis
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationFigure 1. FasterDB SEARCH PAGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- By
1 2 3 Figure 1. FasterD SERCH PGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- y keywords (ENSEML ID, HUGO gene name, synonyms or
More informationAnnotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
More informationIntroduction to RNAseq Analysis. Milena Kraus Apr 18, 2016
Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data
More informationNovel Variant Discovery Tutorial
Novel Variant Discovery Tutorial Release 8.4.0 Golden Helix, Inc. August 12, 2015 Contents Requirements 2 Download Annotation Data Sources...................................... 2 1. Overview...................................................
More informationTutorial. Bisulfite Sequencing. Sample to Insight. September 15, 2016
Bisulfite Sequencing September 15, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Bisulfite
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationChapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6
Chapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6 Overview ChIP-Sequencing technology (ChIP-Seq) uses high-throughput DNA sequencing to map protein-dna interactions across the entire genome.
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
More informationMAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES.
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES. Table of Contents Examples 1 Sample Analyses 5 Examples: Introduction to Examples While these examples can be followed
More informationAnnotation of a Drosophila Gene
Annotation of a Drosophila Gene Wilson Leung Last Update: 12/30/2018 Prerequisites Lecture: Annotation of Drosophila Lecture: RNA-Seq Primer BLAST Walkthrough: An Introduction to NCBI BLAST Resources FlyBase:
More informationSmall Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
More informationMODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
More informationAssemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz
Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure
More informationMODULE TSS1: TRANSCRIPTION START SITES INTRODUCTION (BASIC)
MODULE TSS1: TRANSCRIPTION START SITES INTRODUCTION (BASIC) Lesson Plan: Title JAMIE SIDERS, MEG LAAKSO & WILSON LEUNG Identifying transcription start sites for Peaked promoters using chromatin landscape,
More informationUsing the Genome Browser: A Practical Guide. Travis Saari
Using the Genome Browser: A Practical Guide Travis Saari What is it for? Problem: Bioinformatics programs produce an overwhelming amount of data Difficult to understand anything from the raw data Data
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationBriefly, this exercise can be summarised by the follow flowchart:
Workshop exercise Data integration and analysis In this exercise, we would like to work out which GWAS (genome-wide association study) SNP associated with schizophrenia is most likely to be functional.
More informationTranscription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
More informationAbout Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
More informationRNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
More informationSequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
More informationHow to view Results with Scaffold. Proteomics Shared Resource
How to view Results with Scaffold Proteomics Shared Resource Starting out Download Scaffold from http://www.proteomes oftware.com/proteom e_software_prod_sca ffold_download.html Follow installation instructions
More informationHow to view Results with. Proteomics Shared Resource
How to view Results with Scaffold 3.0 Proteomics Shared Resource An overview This document is intended to walk you through Scaffold version 3.0. This is an introductory guide that goes over the basics
More informationRNA-Seq analysis using R: Differential expression and transcriptome assembly
RNA-Seq analysis using R: Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 12/7/2016 Agenda Brief about RNA-seq and experiment design Gene oriented analysis Gene quantification
More informationMODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
More informationAgilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
More informationVision Municipal Solutions. How To Guide. Payroll
Vision Municipal Solutions Payroll Shane O Neill 12/7/2010 Organizational Groups Posting Paychecks Invoices Nacha Run Banking Services Employee Paychecks Vendor Checks Direct Deposit Checks Forms Issue
More informationSystematic evaluation of spliced alignment programs for RNA- seq data
Systematic evaluation of spliced alignment programs for RNA- seq data Pär G. Engström, Tamara Steijger, Botond Sipos, Gregory R. Grant, André Kahles, RGASP Consortium, Gunnar Rätsch, Nick Goldman, Tim
More informationTSSpredator User Guide v 1.00
TSSpredator User Guide v 1.00 Alexander Herbig alexander.herbig@uni-tuebingen.de Kay Nieselt kay.nieselt@uni-tuebingen.de June 3, 2013 1 Getting Started TSSpredator is a tool for the comparative detection
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationDe Novo Transcript Discovery using Long and Short Reads
De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationDesigning TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationTargeted RNA sequencing reveals the deep complexity of the human transcriptome.
Targeted RNA sequencing reveals the deep complexity of the human transcriptome. Tim R. Mercer 1, Daniel J. Gerhardt 2, Marcel E. Dinger 1, Joanna Crawford 1, Cole Trapnell 3, Jeffrey A. Jeddeloh 2,4, John
More informationGo to Bottom Left click WashU Epigenome Browser. Click
Now you are going to look at the Human Epigenome Browswer. It has a more sophisticated but weirder interface than the UCSC Genome Browser. All the data that you will view as tracks is in reality just files
More informationNature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.
Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP
More information10/06/2014. RNA-Seq analysis. With reference assembly. Cormier Alexandre, PhD student UMR8227, Algal Genetics Group
RNA-Seq analysis With reference assembly Cormier Alexandre, PhD student UMR8227, Algal Genetics Group Summary 2 Typical RNA-seq workflow Introduction Reference genome Reference transcriptome Reference
More informationAnalyzing an individual sequence in the Sequence Editor
BioNumerics Tutorial: Analyzing an individual sequence in the Sequence Editor 1 Aim The Sequence editor window is a convenient tool implemented in BioNumerics to edit and analyze nucleotide and amino acid
More informationLab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity
More informationProteogenomics. Kelly Ruggles, Ph.D. Proteomics Informatics Week 9
Proteogenomics Kelly Ruggles, Ph.D. Proteomics Informatics Week 9 Proteogenomics: Intersection of proteomics and genomics As the cost of high-throughput genome sequencing goes down whole genome, exome
More informationKnowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
More informationAnalysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
More informationCS313 Exercise 1 Cover Page Fall 2017
CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationMotif Discovery in Drosophila
Motif Discovery in Drosophila Wilson Leung Prerequisites Annotation of Transcription Start Sites in Drosophila Resources Web Site FlyBase The MEME Suite FlyFactorSurvey Web Address http://flybase.org http://meme-suite.org/
More informationRuns of Homozygosity Analysis Tutorial
Runs of Homozygosity Analysis Tutorial Release 8.7.0 Golden Helix, Inc. March 22, 2017 Contents 1. Overview of the Project 2 2. Identify Runs of Homozygosity 6 Illustrative Example...............................................
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationResult Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic
More informationHands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
More informationAnalyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek
Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek This example data set consists of 20 selected HapMap samples, representing 10 females and 10 males, drawn from a mixed ethnic population of
More informationKnetMiner USER TUTORIAL
KnetMiner USER TUTORIAL Keywan Hassani-Pak ROTHAMSTED RESEARCH 10 NOVEMBER 2017 About KnetMiner KnetMiner, with a silent "K" and standing for Knowledge Network Miner, is a suite of open-source software
More informationMODULE TSS2: SEQUENCE ALIGNMENTS (ADVANCED)
MODULE TSS2: SEQUENCE ALIGNMENTS (ADVANCED) Lesson Plan: Title MEG LAAKSO AND JAMIE SIDERS Identifying the TSS for a gene in D. eugracilis using sequence alignment with the D. melanogaster ortholog Objectives
More information3 Ways to Improve Your Targeted Marketing with Analytics
3 Ways to Improve Your Targeted Marketing with Analytics Introduction Targeted marketing is a simple concept, but a key element in a marketing strategy. The goal is to identify the potential customers
More informationOncomine cfdna Assays Part III: Variant Analysis
Oncomine cfdna Assays Part III: Variant Analysis USER GUIDE for use with: Oncomine Lung cfdna Assay Oncomine Colon cfdna Assay Oncomine Breast cfdna Assay Catalog Numbers A31149, A31182, A31183 Publication
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationAnalysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
More informationOr, from the View and Manage RFx(s) page, click the Create RFx button. Create New RFx - Use this button to create an RFQ from scratch.
Request for Quote How to Create Create an RFQ To create any RFx (RFI, RFQ, RFP, Auction or Buyer Survey), from the View and Manage RFx(s) page, click on the Create RFx button. Follow the steps below to
More informationBI Travel Report: Pending Travel Requests by Budget Period
Table of Contents Overview... 2 Objectives... 2 Enterprise Roles... 2 Procedure... 3 A. Navigation... 3 B. Report Prompts... 5 C. Export to Excel and Analysis Example... 7 D. Error Message... 10 *Please
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationRNA standards v May
Standards, Guidelines and Best Practices for RNA-Seq: 2010/2011 I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable properties for quantification,
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationAgenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
More informationHomework 4. Due in class, Wednesday, November 10, 2004
1 GCB 535 / CIS 535 Fall 2004 Homework 4 Due in class, Wednesday, November 10, 2004 Comparative genomics 1. (6 pts) In Loots s paper (http://www.seas.upenn.edu/~cis535/lab/sciences-loots.pdf), the authors
More informationAgenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018
Agenda Annotation of Drosophila January 2018 Overview of the GEP annotation project GEP annotation strategy Types of evidence Analysis tools Web databases Annotation of a single isoform (walkthrough) Wilson
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationAnnotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
More informationFinding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
More informationFinding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationOncoMD User Manual Version 2.6. OncoMD: Cancer Analytics Platform
OncoMD: Cancer Analytics Platform 1 Table of Contents 1. INTRODUCTION... 3 2. OVERVIEW OF ONCOMD... 3 3. ORGANIZATION OF INFORMATION IN ONCOMD... 3 4. GETTING STARTED... 6 4.1 USER AUTHENTICATION... 6
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Development of conditions to convert 4-thiouridine (s 4 U) into a convertible nucleoside. Development of conditions to convert 4-thiouridine (s 4 U) into a convertible nucleoside.
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationA tutorial introduction into the MIPS PlantsDB barley&wheat database instances
transplant 2 nd user training workshop Poznan, Poland, June, 27 th, 2013 A tutorial introduction into the MIPS PlantsDB barley&wheat database instances TUTORIAL ANSWERS Please direct any questions related
More informationOutline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
More informationFast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation
More informationPRIMEGENSw3 User Manual
PRIMEGENSw3 User Manual PRIMEGENSw3 is Web Server version of PRIMEGENS program to automate highthroughput primer and probe design. It provides three separate utilities to select targeted regions of interests
More informationTaqMan Residual DNA Detection Kit Chinese Hamster Ovary v2 Protocol
TaqMan Residual DNA Detection Kit Chinese Hamster Ovary v2 Protocol Setting up the Real-Time PCR Reaction. Thaw the0x TaqMan Assay Mix Tube (0X TAM) from 20 C storage. Take out the 2X Environmental TaqMan
More informationApplications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
More informationTraining materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
More informationAlmyta Control System Goods Replenishment Contents
Almyta Control System Goods Replenishment Contents Almyta Control System Goods Replenishment... 1 Creating the demo company... 2 Finished Goods Replenishment... 3 Raw Materials Replenishment... 9 Creating
More informationObject Groups. SRI International Bioinformatics
Object Groups 1 SRI International Bioinformatics Object Groups Collect and save lists of genes, metabolites, pathways Transform, filter, and analyze them Share groups with colleagues Use groups in conjunction
More informationRNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
More informationCopy Number Analysis in Partek Genomics Suite 6.6
Copy Number Analysis in Partek Genomics Suite 6.6 Introduction At a simple level, copy number analysis can be thought of as a gene dosage question: where are the regions of the genome that have altered
More informationTABLE OF CONTENTS DOCUMENT HISTORY
TABLE OF CONTENTS DOCUMENT HISTORY 5 UPDATE 17D 5 Revision History 5 Overview 5 Optional Uptake of New Features (Opt In) 6 Update Tasks 6 Feature Summary 7 Demand Management 9 Forecast Unique Demand Segments
More informationOverview of the next two hours...
Overview of the next two hours... Before tea Session 1, Browser: Introduction Ensembl Plants and plant variation data Hands-on Variation in the Ensembl browser Displaying your data in Ensembl After tea
More informationQIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
More information