Effective Placement of. Raymond J. Peterson, Ph.D.
|
|
- Noel Briggs
- 5 years ago
- Views:
Transcription
1 Effective Placement of LNA into Q-PCR Q Probes Raymond J. Peterson, Ph.D.
2 Why Use LNA in Q-PCR? Q Proper design enables stable & specific hybridization for primers & probes Goals: Ensure sufficient signal by achieving desired T M Avoid self-structure structure Avoid primer dimers and other mis-hybridizations Use to target poor sequence and for difficult designs AT- rich gene region, avoid repeats, other bad context Gene features: splice sites, splice site variants Unique sequence detection: pseudogene,, pathogens Multiplex
3 Where Should LNA Be Placed? 5,, 3, 3, interior, multiple? Depends on function of oligonucleotide: PCR or other amplification primer Hybridization probe: TaqMan, MB, Scorpions SNP probe Gene silencing: sirna, antisense T M is usually integral to decision Therefore, need ability to predict T M
4 DNA & RNA Nearest-Neighbor Neighbor Example Example: GCTATGAT CGATACTA ΔH = Σ ΔH ( GC )+ΔH ( CT )+...+ΔH ( AT ) CG GA TA ΔS = Σ ΔS ( GC )+ΔS ( CT )+...+ΔS ( AT ) CG GA TA T M = +ΔS (initiation)+δs (symmetry) ΔH ΔS +Rln(C T )
5 How Can the Nearest-Neighbor Neighbor Model Be Extended to LNA? For example, single internal incorporation: DNA & RNA have 10 unique dinucleotides LNA has 32 And there will be different parameter values: ΔS and ΔH may both be altered due to conformational entropy, base stacking, & other effects
6 LNA Thermodynamic Databases Systematic approach Internal single match & mismatches: PM, MM Termini and penultimate with and without mismatches: 5TP, 5PP, 3TP, 3TM, 3PP, 3PM All-LNA with and without mismatches: AL, AM Multiple internal incorporations (spacing) ~ 1,600 melt curves
7 Experimental Steps Determine model Design duplexes Melt DNA:DNA and LNA:DNA duplexes Fit Van t Hoff equation to estimate ΔH & ΔS Assemble ΔΔ design matrices & result vectors Perform regression analysis (SVD) to estimate model parameters and errors
8 UV Absorbance Melts "Melting Curve": Increase in Absorbance with Temperature ΔH = -50 kcal/mole, ΔS = -124 e.u. T M = 56 C ΔH = -75 kcal/mole, ΔS = -200 e.u Temperature (C) Derivative Plot of Same Data Temperature (C)
9 Tabulate Thermodynamic Values Training Data Set Oligonucleotides Results from Absorbance Melting Curves Changes due to LNA substitution Name Sequence (5 to 3 ) Length, ΔH ΔG ΔS (e.u.) 37 T M ΔT M ΔΔH ΔΔS ΔΔG 37 Trinuc. (kcal/ mol) (kcal/mol) ( C) ( C) (kcal/mol) (e.u.) (kcal/mol) D1 GTCGAACAGC ± ± ± L1a GTCG L AACAGC CG L A -74.2± ± ± ± ± ±0.16 L1b GTCGA L ACAGC GA L A -76.2± ± ± ± ± ±0.12 L1c GTCGAA L CAGC AA L C -77.2± ± ± ± ± ±0.11 L1d GTCGAAC L AGC AC L A -75.5± ± ± ± ± ±0.11 D2 ATCTATCCGGC ± ± ± L2a ATCT L ATCCGGC CT L A -79.3± ± ± ± ± ±0.18 L2b ATCTA L TCCGGC TA L T -76.8± ± ± ± ± ±0.13 L2c ATCTAT L CCGGC AT L C -73.9± ± ± ± ± ±0.16 L2d ATCTATC L CGGC TC L C -74.0± ± ± ± ± ±0.10 L2e ATCTATCC L GGC CC L G -76.6± ± ± ± ± ±0.08 D3 CGCTGTTACGC ± ± ± L3a CGCT L GTTACGC CT L G -82.9± ± ± ± ± ±0.13 L3b CGCTG L TTACGC TG L T -81.0± ± ± ± ± ± altogether, to cover all trinucleotides Test Data Set Oligonucleotides Results from Absorbance Melting Curves Changes due to LNA substitution Name Sequence (5 to 3 ) Length, ΔH ΔS ΔG 37 T M ΔT M ΔΔH ΔΔS ΔΔG 37 Trinuc. (kcal/ mol) (e.u.) (kcal/ mol) ( C) ( C) (kcal/mol) (e.u.) (kcal/mole) DT1 GTGGATCTTTA ± ± ± LT1a GTG L GATCTTTA TG L G -69.2± ± ± ± ± ±0.08 LT1b GTGGAT L CTTTA AT L C -63.7± ± ± ± ± ±0.09 LT1c GTGGATCTT L TA TT L T -63.6± ± ± ± ± ±0.12 DT2 ACTGGCATCTG ± ± ± LT2a ACT L GGCATCTG CT L G -77.0± ± ± ± ± ± altogether, to test predictions for all 32 nearest neighbors
10 Regression Analysis (SVD)
11 ΔΔ Values for Primer Design 32 Nearest Neighbor Parameter Set Nearest neighbors H (kcal/mole) S (cal/mole K) G 37 (kcal/mole) 5 ALA ± ± ± ALC ± ± ± TLG ± ± ± TLT ± ± ± AAL ± ± ± ACL ± ± ± TGL ± ± ± TTL ± ± ± Uncertainties are the estimated errors in the value of the parameter from SVD analysis, not a standard deviation over a population.
12 Rules of Thumb: Single Internal ΔT M ranges from -1.0 to +8.0 C LNA-A A confers the least additional stability LNA-T T and LNA-C C provide the most Sequence context is important Accuracy ± 2.0 C C of the actual T M
13 LNA Improves Mismatch Discrimination
14 Mismatch Improvement Is Sequence-Dependent
15 Rules of Thumb: Mismatches LNA generally improves discrimination The properties of DNA:DNA and LNA:DNA mismatches are similar G L :T decreases discrimination (Owczarzy( Owczarzy) A L :G, G L :A or G L :G increase discrimination Otherwise, substantial sequence-dependence
16 Rules of Thumb: Others LNA at termini: 5 end makes little difference 3 stabilizes less than internal LNA Penultimate LNA: Effect depends on inside base Decreased entropic improvement All-LNA molecules are so stable that their self- structure can be a serious problem for probes
17 5 LNA Improves Sequencing Trace
18 LNA 5 5 Helps Q-PCRQ
19 Contribution to NN Followed accepted protocol Determined thermodynamics of representative oligonucleotides Contribution is that LNA has more sequence contexts: 10 DNA PM versus 32 LNA PM We spent time worrying about which model would be best NN gave best results
20 LNA Applications Q-PCR: any method, any primer or probe Pathogen detection (DNA or RNA), homology Sequencing primers PCR primers SNP hybridization probes Microarrays Gene silencing (antisense/sirna) therapeutics
21 Acknowledgements Jason D. Kahn, University of Maryland Meinrado F. Samala Joshua D. Levin Dean E. Fiala, Celadon Laboratories Patricia M. McTigue Satya Medicherla
CHAPTER 3 PRIMER DESIGN CRITERIA
CHAPTER 3 PRIMER DESIGN CRITERIA In this chapter, we will discuss five basic elements of primer design criteria. The first section is melting temperature. In PCR experiment, there are three temperaturedependent
More informationPosition-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
Published online 28 October 2006 Nucleic Acids Research, 2006, Vol. 34, No. 20 e142 doi:10.1093/nar/gkl756 Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers Joshua
More informationOnly for teaching purposes - not for reproduction or sale
PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP in real time PCR Relative
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationStability and Mismatch Discrimination of Locked Nucleic Acid DNA Duplexes
pubs.acs.org/biochemistry Stability and Mismatch Discrimination of Locked Nucleic Acid DNA Duplexes Richard Owczarzy,* Yong You, Christopher L. Groth, and Andrey V. Tataurov Department of Molecular Genetics
More informationStability and Mismatch Discrimination of Locked Nucleic Acid DNA Duplexes
pubs.acs.org/biochemistry Stability and Mismatch Discrimination of Locked Nucleic Acid DNA Duplexes Richard Owczarzy,* Yong You, Christopher L. Groth, and Andrey V. Tataurov Department of Molecular Genetics
More informationDNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases
1 DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases Adenine, Guanine, Cytosine and Thymine whereas in RNA
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More information1. The AGI (Arabidospis Genome Initiative) convention gene names or AtRTPrimer ID should
We will show how users can select their desired types of primer-pairs, as we explain each of forms indicated by the blue-filled rectangles of Figure 1. Figure 1 Front-end webpage for searching desired
More informationProblem Set No. 3 Due: Thursday, 11/04/10 at the start of class
Department of Chemical Engineering ChE 170 University of California, Santa Barbara Fall 2010 Problem Set No. 3 Due: Thursday, 11/04/10 at the start of class Objective: To understand and develop models
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationTranscription factor binding site prediction in vivo using DNA sequence and shape features
Transcription factor binding site prediction in vivo using DNA sequence and shape features Anthony Mathelier, Lin Yang, Tsu-Pei Chiu, Remo Rohs, and Wyeth Wasserman anthony.mathelier@gmail.com @AMathelier
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationOligo. Version 6 for Macintosh. Primer Analysis Software. DEMO Guide. Wojciech Rychlik. 1999, Molecular Biology Insights, Inc.
Oligo Primer Analysis Software Version 6 for Macintosh DEMO Guide Wojciech Rychlik Molecular Biology Insights, Inc. 8685 Hwy 24 Cascade, CO 889 Phone: (8) 747-462 (79) 684 7988 Fax: (79) 684 7989 www.oligo.net
More informationReal-time PCR Product Selection Guide
Real-time PCR Product Selection Guide Taqman Probe SYBR Green RealMOD Green AP 5x RealMOD Probe HP 5x Cat.No. 25448 / 250 rxn. / Cat.No. 25349 / 250 rxn. / RECOMMEND RealMOD Green W² 2x Real-time PCR RECOMMEND
More informationCOMP598: Advanced Computational Biology Methods & Research
COMP598: Advanced Computational Biology Methods & Research Introduction to RNA secondary structure prediction Jérôme Waldispühl School of Computer Science, McGill RNA world In prebiotic world, RNA thought
More information601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>
BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they
More informationPCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA
PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE-452017 INDIA BIOINFORMATICS Bioinformatics is considered as amalgam of biological sciences especially Biotechnology with
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationRoche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
More informationqpcr course Alyona Minina Department of Plant Biology SLU
qpcr course Alyona Minina Department of Plant Biology SLU 2014 What do you want to know? Data Analysis and interpretation Statistical analysis of qpcr How qpcr works Application of qpcr Basics Normalization
More informationHRM Powered by Precision Melt Analysis Software
HRM Powered by Precision Melt Analysis Software Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Overview Introduction to High Resolution
More informationJournal of Diabetes & Metabolic Disorders 2014, 13:26
Journal of Diabetes & Metabolic Disorders This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon.
More informationamplification High Resolution Melt Parameter Considerations for Optimal Data Resolution tech note 6009
amplification tech note 6009 High Resolution Melt Parameter Considerations for Optimal Data Resolution Carl Fisher, Ray Meng, Francisco Bizouarn, and Rachel Scott Gene Expression Division, Bio-Rad Laboratories,
More informationRapid Cycle PCR, Real Time Analysis, and Hi-Res Melting
Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Carl Wittwer Department of Pathology University of Utah ARUP Idaho Technology AMP, Oct. 31, 2008 Impatient, Lazy, and Cheap Rapid Cycle PCR Fast
More informationQPCR ASSAYS FOR MIRNA EXPRESSION PROFILING
TECH NOTE 4320 Forest Park Ave Suite 303 Saint Louis, MO 63108 +1 (314) 833-9764 mirna qpcr ASSAYS - powered by NAWGEN Our mirna qpcr Assays were developed by mirna experts at Nawgen to improve upon previously
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationDNA, PCR primer design, FastPCR and WEB tools
DNA, PCR primer design, FastPCR and WEB tools Ruslan Kalendar e-mail: ruslan.kalendar@helsinki.fi http://www.helsinki.fi/people/ruslan.kalendar/ PCR primer design is a critical step in all types of PCR
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More information2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire
2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic
More informationSuccessful gene expression studies using validated qpcr assays. Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015
Successful gene expression studies using validated qpcr assays Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015 Agenda Requirements for high quality qpcr assays Approaches for qpcr assay validation
More informationSequence Design for DNA Computing
Sequence Design for DNA Computing 2004. 10. 16 Advanced AI Soo-Yong Shin and Byoung-Tak Zhang Biointelligence Laboratory DNA Hydrogen bonds Hybridization Watson-Crick Complement A single-stranded DNA molecule
More informationPCR Amplifies Targeted Sequence
PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome P C R PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for
More informationPrimeTime Pre-designed qpcr Assays
PrimeTime Pre-designed qpcr Assays nuclease assays for human, mouse, and rat PrimeTime qpcr Assays IDT now offers PrimeTime Pre-designed qpcr Assays that are guaranteed to work for human, mouse, and rat
More informationCOVER PAGE SAMPLE DNA GENOTYPING FINAL REPORT. Date. Month XX, 20XX. Reviewed & approved by: Steve Granger, Ph.D, Chief Scientific Officer
5962 La Place Court, Suite 275, Carlsbad, CA 92008 USA Tel 800.790.2258 Fax 760.448.5397 www.salimetrics.com COVER PAGE Project Name XXXXXXXXXXXXX Document Final Report Analysis Genotyping Researcher Name
More informationTripleHyb real time PCR for detection of single nucleotide polymorphisms in the VEGF promoter region
TripleHyb real time PCR for detection of single nucleotide polymorphisms in the VEGF promoter region S. Fuessel 1, S. Unversucht 1, A. Lohse 1, S. Tomasetti 1, A. Rost 2, A. Edelmann 2, M.P. Wirth 1, A.
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationDNA multiplex hybridization on microarrays and thermodynamic stability in solution: a direct comparison
Published online 1 October 7 Nucleic Acids Research, 7, Vol. 3, No. 21 7197 7 doi:.93/nar/gkm DNA multiplex hybridization on microarrays and thermodynamic stability in solution: a direct comparison Daniel
More informationPolymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr
Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase
More informationPrimer Design Ameer Effat M. Elfarash
Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing
More informationEvaluation of glass forming ability of alloys
Vol. 2 No. 1, Feb. 2005 CHINA FOUNDRY Evaluation of glass forming ability of alloys *Anhui CAI, Ye PAN, Guoxiong SUN ( Department of Materials Science and Engineering, Southeast University, Nanjing 210096,
More informationArtificial Nucleic Acids -Their Developments and Recent Applications
Artificial Nucleic Acids -Their Developments and Recent Applications Bioorganic Chemistry Laboratory D2 Kenichiro Ito Organic Seminar 2012/5/7 1 Nucleic acids play central roles in life Replication Transcription
More informationSynthesis of spin-labeled riboswitch RNAs using convertible nucleosides and DNA-catalyzed RNA ligation
Supporting information for Bioorg. Med. Chem.; C. Höbartner and coworkers page S1 Supporting information Synthesis of spin-labeled riboswitch RNAs using convertible nucleosides and DNA-catalyzed RNA ligation
More informationDISSERTATIONES BIOLOGICAE UNIVERSITATIS TARTUENSIS 242
DISSERTATIONES BIOLOGICAE UNIVERSITATIS TARTUENSIS 242 DISSERTATIONES BIOLOGICAE UNIVERSITATIS TARTUENSIS 242 LAURIS KAPLINSKI The application of oligonucleotide hybridization model for PCR and microarray
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationDNA sequence and chromatin structure. Mapping nucleosome positioning using high-throughput sequencing
DNA sequence and chromatin structure Mapping nucleosome positioning using high-throughput sequencing DNA sequence and chromatin structure Higher-order 30 nm fibre Mapping nucleosome positioning using high-throughput
More informationTable of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...
Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationPHYS 498 HW3 Solutions: 1. We have two equations: (1) (2)
PHYS 498 HW3 Solutions: 1. We have two equations: (1) (2) Where Conc is the initial concentration of [B] or [SA] Since [B] = [SA], the second equation simplifies to: (3) Using equation (1) and (3), we
More informationp53 exon 8 mutations tested for enrichment via COLD-PCR 210 bp 210 bp 87 bp 87 bp Kras codons 12/13 mutations tested for enrichment via COLD-PCR
21 bp 21 bp 167 bp 87 bp 87 bp 167 bp T m ( o C) 95 9 85 8 p53 exon 8 mutations tested for enrichment via a bck d e f g h i j del 3-7bp Kras codons 12/13 mutations tested for enrichment via a. MDA-MB435:
More informationReal-Time PCR Principles and Applications
Real-Time PCR Principles and Applications Dr Esam Ibraheem Azhar (BSc, MSc, Ph.D Molecular Medical Virology) Asst. Prof. Medical Laboratory Technology Department Objectives Real-Time PCR Principles and
More informationLe linee guida MIQE. Paola Scaruffi. S. S. Oncologia Traslazionale Pediatrica Istituto Nazionale per la Ricerca sul Cancro (IST) Genova
Le linee guida MIQE Paola Scaruffi S. S. Oncologia Traslazionale Pediatrica Istituto Nazionale per la Ricerca sul Cancro (IST) Genova Technology 1997 Legacy PCR Qualitative assay Novelty free-for-all Biology
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationSNPWizard User Guide
SNPWizard User Guide About SNPWizard There are many situations in which one wishes to amplify a small segment of DNA where otherwise identical strands may differ. Such segments may consist of a single
More informationExecutive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
More informationGuidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationqpcr course Alyona Minina Department of Plant Biology SLU
qpcr course Alyona Minina Department of Plant Biology SLU 2014 What do you want to know? Data Analysis and interpretation Lecture 2 Statistical analysis of qpcr How qpcr works Lecture 2 Application of
More informationSupplementary table 1: List of sequences of primers used in sequenom assay
Supplementary table 1: List of sequences of primers used in sequenom assay SNP_ID 2nd-PCRP Sequence 1st-PCRP Sequence Allele specific (iplex) iplex primer primer Direction ROCK2 1 rs978906 ACGTTGGATGATAAAGCTCTCTCGGCAGTC
More informationUniversal Labeling of 5 -Triphosphate RNAs by Artificial RNA Ligase Enzyme with Broad Substrate Specificity
Universal Labeling of 5 -Triphosphate RNAs by Artificial RNA Ligase Enzyme with Broad Substrate Specificity John C. Haugner III and Burckhard Seelig* Department of Biochemistry, Molecular Biology and Biophysics
More informationNature Genetics: doi: /ng Supplementary Figure 1. The pedigree information for American upland cotton breeding.
Supplementary Figure 1 The pedigree information for American upland cotton breeding. The integrated figure was modified from Fig. 1 to 10 in Calhoun, Bowman & May (1994). The accessions with blue color
More informationDesigning Real-Time Assays on the SmartCycler II System
Designing eal-time Assays on the SmartCycler II System Cepheid Technical Support Overview This document provides general guidelines for the design of real-time experiments on the Cepheid SmartCycler II
More informationClones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.
Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used
More informationOptimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationUse of a neural network to predict normalized signal strengths from a DNA-sequencing microarray
www.bioinformation.net Volume 13(9) Hypothesis Use of a neural network to predict normalized signal strengths from a DNA-sequencing microarray Charles Chilaka 1, 5, Steven Carr 2, 3, *, Nabil Shalaby 3,
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationDetecting Rare Genomic Copies or Events
Detecting Rare Genomic Copies or Events Integrated DNA Technologies Nick Downey, PhD Common Diagnostics Challenges Detecting targets early with accuracy Detecting different strains (e.g., antibiotic resistance)
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationExcimer-Monomer Switching Molecular Beacon: The Study on Synthetic Cryptosporidum DNA Detection, Thermodynamics, and Magnesium Effects
Utah State University DigitalCommons@USU All Graduate Theses and Dissertations Graduate Studies 5-214 Excimer-Monomer Switching Molecular Beacon: The Study on Synthetic Cryptosporidum DNA Detection, Thermodynamics,
More informationExperiment (5): Polymerase Chain Reaction (PCR)
BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationE-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA
E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationNear Patient Testing. Paul Debenham LGC
Near Patient Testing Paul Debenham LGC Genetic diagnostics at point-of-care: An added value vision Technology platform designed to empower health professional - not DIY genetics DNA-based definition means
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationLightScanner. Systems. Get There Faster. Achieve High Throughput Mutation Discovery and Genotyping.
LightScanner Systems Get There Faster Achieve High Throughput Mutation Discovery and Genotyping www.idahotech.com Hi-Res Melting Perfected Hi-Res Melting is a post PCR technique for homogenous mutation
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationMultiplex PCR Assay Kit Ver.2
Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex
More informationVicinal abasic site Impair processing of Tg:G Mismatch and 8- Oxoguanine Lesions in Three-Component Bistranded Clustered DNA Damage
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Vicinal abasic site Impair processing of Tg:G Mismatch and 8- Oxoguanine Lesions in Three-Component
More informationTwisted Intercalating Nucleic Acid (TINA) a novel group of molecules with improved performance in PCR and qpcr applications
Twisted Intercalating Nucleic Acid (TINA) a novel group of molecules with improved performance in PCR and qpcr applications Dr. Rainer Schubbert, Eurofins Medigenomix 19.03.2013 www.eurofins.de Topics
More informationHuman genetic variation
Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants
More informationQUICK-Clone TM User Manual. cdna
QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example
More informationPrimePCR Assay Validation Report
Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs
More informationInsights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays
Slide 1 of 38 Insights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays Jan Hellemans, PhD CEO Biogazelle qpcr & NGS 2013 Freising, Germany March 19, 2013 Biogazelle
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Amplified Binding-Induced Homogeneous Assay through Catalytic
More informationLatest Developments in the Area. of Detection Methods
Latest Developments in the Area of Detection Methods Enrico Noli LaRAS, University of Bologna Global status of Commercialized Biotech Crop: 2007 Source: (ISAAA) Who needs GMO detection methods Those who
More informationUF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services
UF Center for Pharmacogenomics Explanation of Services Services are provided either as a price per sample or price per project, depending on the specific needs of the researcher. Basic a la carte services,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationSpreadsheet Software for Thermodynamic Melting Point Prediction of Oligonucleotide Hybridization with and without Mismatches
Spreadsheet Software for Thermodynamic Melting Point Prediction of Oligonucleotide Hybridization with and without Mismatches BioTechniques 27:1218-1224 (December 1999) Ekkehard Schütz and Nicolas von Ahsen
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More information