Cloning and characterization of the Pichia pastoris MET2 gene as a selectable marker

FEMS Yeast Research 5 (2005) 935 942 www.fems-microbiology.org Cloning and characterization of the Pichia pastoris MET2 gene as a selectable marker Der Thor a, See Xiong a, Claire C. Orazem a, An-Chun Kwan a, James M. Cregg b, Joan Lin-Cereghino a, Geoff P. Lin-Cereghino a, * a Department of Biological Sciences, University of the Pacific, 3601 Pacific Avenue, Stockton, CA 95211, USA b Keck Graduate Institute of Applied Life Sciences, 535 Watson Drive, Claremont, CA 91711, USA Received 6 January 2005; received in revised form 26 March 2005; accepted 31 March 2005 First published online 2 May 2005 Abstract We describe the isolation and characterization of a new biosynthetic gene, MET2, from the methylotrophic yeast Pichia pastoris. The predicted product of PpMET2 is significantly similar to its Saccharomyces cerevisiae counterpart, ScMET2, which encodes homoserine-o-transacetylase. The ScMET2 was able to complement the P. pastoris met2 strain; however, the converse was not true. Expression vectors based on PpMET2 for the intracellular and secreted production of foreign proteins and corresponding auxotrophic strains were constructed and tested for use in heterologous expression. The expression vectors and corresponding strains provide greater flexibility when using P. pastoris for recombinant protein expression. Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Yeast; Heterologous gene expression; Expression vector; Selectable marker; MET2 1. Introduction The methylotrophic yeast Pichia pastoris has emerged as a reliable heterologous protein expression system for both academic and industrial purposes. To date, over 500 proteins have been successfully expressed many secreted at levels over 1 g l 1 of culture medium [1 3]. The major advantages of P. pastoris relative to other systems include: its relative simplicity, its strong preference for respiratory growth, the tightly regulated and highly efficient promoter from the alcohol oxidase I gene (AOXI) used to drive heterologous gene expression, its ability to add eukaryotic post-translational modifications, such as * Corresponding author. Tel.: +1 209 946 2988; fax: +1 209 946 3022. E-mail address: glincere@pacific.edu (G.P. Lin-Cereghino). disulfide bonds, glycosylation and proteolytic processing, and the availability of a commercial kit based on this system. Besides its use as a host for recombinant protein expression, this yeast is also a useful model system to understand peroxisome biogenesis [4]. Basic and applied studies have been made possible, in part, by the ability to manipulate P. pastoris at the molecular level. A DNA transformation system based on homologous recombination allows for site-specific, stable integration of plasmid DNA into the P. pastoris genome [3]. In the majority of cases, the entire expression plasmid inserts into a yeast chromosome. Nevertheless, there are instances when a transformed cell will contain a functional marker gene but lack the portion of the plasmid containing the expression cassette, an event referred to as gene conversion [5,6]. However, the presence of engineered genes can be verified by colony PCR or Southern analysis. 1567-1356/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsyr.2005.03.009

936 D. Thor et al. / FEMS Yeast Research 5 (2005) 935 942 Several selectable marker genes are available for the molecular manipulation of P. pastoris. The most commonly used antibiotic resistance genes are the Zeocin resistance gene (Sh ble) from Streptoalloteichus hindustanus and the blasticidin S deaminase gene from Aspergillus terreus [7,8]. In addition, biosynthetic marker genes, utilized with the corresponding P. pastoris auxotrophic strains, include the HIS4 and ARG4 genes from P. pastoris and Sacchoromyces cerevisiae as well as P. pastoris ADE1, ARG4, and URA3 genes [9]. Unfortunately, there are limitations when using some of these selectable marker/strain combinations. Zeocin and blasticidin are expensive (approximately 200 dollars/gram), while the P. pastoris ura3 and ade1 strains are slow-growing and problematic even when supplied with ample amounts of appropriate nucleic acids in their growth medium. Yet, once transformed with vectors containing the complementing biosynthetic genes (i.e., ADE1 or URA3), these strains are restored to a growth rate similar to that of the wild type [9]. These limitations restrict the construction and ease of using strains with more than a few recombinant modifications, such as for the production of multi-subunit proteins [10]. Thus, more selectable markers are still needed to make this eukaryotic expression system more user-friendly. In this study, we report the cloning of the P. pastoris MET2 gene. We utilized it to generate plasmids for intracellular and secreted expression of heterologous genes. Additionally, the corresponding strains containing met2 and other auxotrophies were constructed. The addition of new MET2 vectors and strains adds more versatility to the P. pastoris expression system and offers several advantages over some marker/strain combinations that are currently available. 2. Materials and methods 2.1. Strains and media Pichia pastoris met mutant strain yjc239 was generated from the wild-type strain NRRL Y-11430 using nitrosoguanidine mutagenesis. Complementation analysis and other classical genetic manipulations of P. pastoris strains were performed as described [12]. All P. pastoris strains used or constructed in this study are listed in Table 1. S. cerevisiae strains ydl1 (MATa his3 leu2 ura3) and YNL277W BY4742 (MATa his3d1 leu2d0 lys2d0 ura3d0 DMET2, ATCC 4011167) [13] were used for cross-species complementation studies. Recombinant-DNA manipulations were performed in Escherichia coli strain TOP10 (Invitrogen Corp., Carlsbad, CA). Yeast strains were cultured in YPD medium (1% yeast extract, 2% peptone, 1% glucose) or minimal (YNB) medium (0.17% yeast nitrogen base, 0.5% ammonium sulfate) supplemented with 0.4% glucose Table 1 Strains of P. pastoris used in this work Strain yjc100 yjc220 ygs190 ygs115 yjc239 yjc254 yjc308 ydt37 ydt38 ydt39 ydt40 ydt139 ydt140 ydt141 ydt142 ydt143 ydt144 ydt240 ydt241 ydt242 ydt340 (YND) or 0.5% methanol (YNM). Amino acids were added to 50 lg ml 1 as required. E. coli strains were cultured in Lennox broth (LB) medium supplemented with either 100 lg ml 1 ampicillin or 25 lg ml 1 Zeocin (Invitrogen Corporation, Carlsbad, CA) as required. P. pastoris transformations were performed by electroporation as described previously in Cregg and Russell [11]. 2.2. Growth rate studies Growth curves of the P. pastoris wild type, ade1, arg4, his4, met2, and ura3 strains were generated by growing triplicate samples in YPD and then diluting all samples to an OD 600 of 0.1. Samples were harvested at selected time points, diluted 1:10 in water and analyzed spectrophotometrically. 2.3. Cloning of the P. pastoris MET2 gene Genotype Wild type ade1 arg4 his4 met2 ura3 ade1 arg4 his4 ura3 ade1 met2 arg4 met2 his4 met2 met2 ura3 arg4 his4 met2 arg4 met2 ura3 ade1 arg4 met2 ade1 his4 met2 ade1 met2 ura3 his4 met2 ura3 ade1 arg4 his4 met2 ade1 arg4 met2 ura3 arg4 his4 met2 ura3 ade1 arg4 his4 met2 ura3 To isolate genomic library plasmids carrying the MET2 gene, the P. pastoris host strain ydt39 (his4 met2) was generated by crossing ygs115 (his4) and yjc239 (met2) [12]. Approximately 200 ng of a P. pastoris genomic library [14] was transformed into ydt39 via electroporation, and histidine prototrophic (His + ) transformants were selected on YND plates supplemented with methionine. These transformants were then replica-plated to YND plates without any added amino acids to select for methionine-prototrophic candidates (Met + ). Four colonies were found to be both His + and Met +. Library plasmids were rescued from these candidates by DNA extraction [11,4] and then transformed by

D. Thor et al. / FEMS Yeast Research 5 (2005) 935 942 937 electroporation into One Shot Electrocomp Gene- Hogse E. coli purchased from Invitrogen (Carlsbad, CA). Plasmid minipreps [15] of library candidates were examined by restriction analysis and found to posses a common 3.8-kb region. The smallest plasmid, which contained only this 3.8-kb region, was designated pym8-8a. Both strands of the genomic insert of pym8-8a were subsequently sequenced, and an analysis of the entire sequence with software from Jellyfish (Lab- Velocity, Los Angeles, CA) indicated that the insert contained a 1.4-kb sequence corresponding to the open reading frame (ORF) of a putative MET2 gene. 2.4. Complementation of ydt39 with a minimal 2.2-kb PpMET2 fragment A 2.2-kb NotI XhoI fragment, containing 449 bp upstream and 343 bp downstream of the putative 1.4-kb MET2 coding sequence, was generated by PCR using the primers: pgccctcgagaggaagtcaaatg- CGAACTG and pcgggcggccgcagacgtcag- GTAAAATGGAG. This PCR product was digested with NotI and XhoI, cloned into the same sites in pblhis [9] and designated pdt10. After linearization with StuI and purification with the QIAprep PCR Purification Kit (Qiagen, Valencia, CA), pdt10 was transformed into electrocompetent ydt39 cells and selected on YND plates supplemented with histidine to confirm the complementation of the met2 phenotype. 2.5. Complementation of ydt39 with ScMET2 A 2.8-kb XhoI NotI fragment containing the MET2 gene from S. cerevisiae (ScMET2) was generated from S. cerevisiae ydl1 genomic DNA using standard PCR procedures and the primers: pccctcgagctcga- CCGACTGGTTGTAAT and pccgcggccgc- GCCTTGCCAGCGCTATTACT. The resulting PCR fragment was digested with XhoI and NotI and cloned into the plasmid pblhis restricted with the same enzymes. The resulting construct was linearized with NheI and transformed into the P. pastoris strain ydt39 (his4 met2). As a control, pblhis alone was also transformed into ydt39. Transformants were selected on YND plates supplemented with methionine. To test for complementation of methionine auxotrophy, these transformants were re-streaked onto YND plates supplemented with histidine. The 2.2-kb NotI XhoI fragment from pdt10 containing the MET2 gene from P. pastoris was cloned into the S. cerevisiae vector, prs425, which has the LEU2- selectable marker [16]. The resulting construct was transformed into S. cerevisiae strain YNL277W BY4742 (MAT ahis3 D1 leu2 D0 lys2 D0 ura3 D0 DMET2, ATCC 4011167). As controls, prs425 alone and prs425 containing the 2.8-kb S. cerevisiae MET2 were also introduced into this strain. The Leu2 + transformants were re-streaked onto the appropriate YND drop-out plates without methionine. 2.6. Plasmid constructions pblmet IX (Intracellular expression) and pbl- MET SX (Secreted expression) were constructed as follows. The P. pastoris MET2 gene was first amplified from pdt10 using the oligonucleotides pgccccta- GGAGGAAGTCAAATGCGAACTG and pcgg- ACTAGTAGACGTCAGGTAAAATGGAG. The resulting 2.2-kb PCR product was digested at restriction sites in the primers and used to replace the 2.1-kb SpeI AvrII fragment, containing the P. pastoris ARG4, of pblarg IX [9]. The resulting plasmid, pdt11, was then used to construct pblmet SX, the plasmid used for secreted expression. The MET2 gene from pdt11 was isolated with BcuI and ScaI digestion and then ligated to pblarg SX, digested with the same restriction enzymes. Along with the MET2 selectable marker, the resulting plasmid, pblmet SX, contains the AOX1 promoter fused to the S. cerevisiae a-mating factor prepro signal peptide followed by a multiple cloning site and the 3 0 AOX1 transcriptional termination region. The 600-bp PmeI NotI fragment of ppiczb (Invitrogen, Carlsbad, CA) was then used to replace the 950-bp PmeI NotI of pblmet SX to create pdt12. Approximately 40 bp were then deleted from the AOX1 5 0 UTR of pdt12 using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) in order to optimize the length of the region. Oligonucleotide primers 5 0 CAACTAATTATTC- GAAACGCTCGACCCGCGGC 3 0 and the 5 0 GCC- GCGGCTCGAGCGTTTCGAATAATTAGTTG 3 0 were employed to remove the sequence AGGAATT- CACGTGGCCCAGCCGGCCCGTCTCGGATCGG- TAC from pdt12 to create pblmet IX. Sequencing was performed to confirm the deletion. pblmet IX and pblmet SX were then used to electroporate ydt39 (his4 met2) cells as described above. pdt105 was constructed by amplifying the coding sequence of a region of the b-lactamase gene from E. coli (bla) from phw018 [17] with the primers pcaactc- GAGATGTCCGGTCACCCAGAAAC and pgaa- GCGGCCGCCCAATGCTTAATCAGTG. The 800-bp PCR product was digested and inserted into the XhoI and NotI sites in the multiple-cloning site of pblmet IX. Regions surrounding the cloning junctions were sequenced to confirm a correct reading frame. The pdt105 construct contains the intracellular form of b-lactamase coding sequence under the regulation of the AOX1 promoter in a plasmid backbone containing the MET2 gene as a selectable marker. Prior to transformation of ydt39, pblmet IX, pblmet SX, and pdt105 were linearized within MET2 with BamH1 or

938 D. Thor et al. / FEMS Yeast Research 5 (2005) 935 942 within the AOX1 promoter with NsiI and subsequently purified with the QIAprep PCR Purification Kit (Qiagen, Valencia, CA). 2.7. Colony PCR To test for the presence of the b-lactamase gene in Met + strains transformed with pdt105 and other plasmids, a modified version of the rapid colony PCR method was performed as described previously [9], using the primers pcaactcgagatgtccggtcaccca- GAAAC and pgaagcggccgcccaatgct- TAATCAGTG on a sample of approximately 5 10 7 cells from selected colonies. Approximately 10% of the PCR samples were run on agarose gels to determine if an 800-bp b-lactamase sequence had been amplified. 2.8. Enzyme activities For b-lactamase expression studies, replicate samples of the selected strains were first grown overnight in YPD medium. Aliquots of the stationary cultures were used to inoculate an appropriate volume of YND medium containing the necessary nutritional supplements and grown to an OD 600 of approximately 0.5. An aliquot of these glucose-grown cells (approximately 25 OD 600 units) was removed and the cells were pelleted, washed with water, and frozen away at 80 C. The remainder of the culture was centrifuged for 3 min at 2000xg and the cell pellet, after being washed with 1 ml of water, was resusupended in approximately 10 ml prewarmed YNM (minimal medium supplemented with 0.5% methanol) containing the necessary nutritional supplements. The cells were induced with vigorous shaking at 30 C for 8 h, and cell pellets were harvested by centrifugation as described above. Cell pellets were then processed for protein extraction by glass bead lysis [18]. Enzyme assays for b-lactamase [17] and glyceraldehyde-3-phosphatase dehydrogenase [17] were performed at room temperature using standard protocols. For specificactivity determination, total-protein concentration in cellular extracts was determined using the Pierce (Rockford, IL) BCA protein assay kit with bovine serum albumin as a standard. 2.9. Miscellaneous methods Standard procedures were used for recombinant DNA manipulations [15]. Oligonucleotides were synthesized by Sigma Genosys (Plano, TX). DNA sequencing was performed at the DNA Sequencing Core laboratory, University of Florida (Gainesville, FL) and Gene Gateway, LLC (Hayward, CA). Newly determined gene sequences were analyzed using Jellyfish software (Lab- Velocity, Los Angeles, CA), and BLAST programs (NCBI, Bethesda, MD) and by the Expert Protein Analysis System (http://www.expasy.ch/tools/dna.html). Alignments were generated using LALIGN (http:// www.ch.embnet.org). The GenBank Accession No. for P. pastoris MET2 is AY876284 and for P. pastoris MET10 is AY878119. 3. Results 3.1. Isolation of the P. pastoris MET2 gene The strain yjc239 (met2) was generated previously by nitrosoguanidine mutagenesis of the wild-type P. pastoris strain NRRL Y-11430 [11]. Because many auxotrophic strains of P. pastoris grow significantly slower than wild-type strains even when supplemented with appropriate nutrients, we first determined the doubling time of the met2 strain, comparing it to other auxotrophic 4.00 O.D. 3.50 3.00 2.50 2.00 Wild Type adearghismetura- 1.50 1.00 0.50 0.00 0 hrs 3 hrs 5 hrs 7 hrs 9 hrs 11 hrs 13 hrs Time Fig. 1. Growth rates of P. pastoris wild type and various auxotrophic strains on YPD medium.

D. Thor et al. / FEMS Yeast Research 5 (2005) 935 942 939 strains used for recombinant expression [9,19]. As indicated in Fig. 1, the yjc239 strain, on rich medium, has a growth rate comparable to that of the wild type, his4 and arg4 strains, but significantly higher than that of the ura3 and ade1 strains. This result suggested that the met auxotrophy present in yjc239, with its normal doubling time, could be useful for heterologous expression work if the complementing biosynthetic gene could be isolated. To isolate the complementing gene, competent ydt39 (his4 met2) cells were transformed by electroporation with a P. pastoris genomic library constructed in the HIS4-containing P. pastoris E. coli shuttle vector pym8 [14]. Several library plasmids conferring both a His + and Met + phenotype were recovered, and restriction analysis indicated that several of the plasmids contained overlapping genomic inserts. The smallest common fragment (approximately 3.8 kb) was sequenced and revealed an ORF of 1428 bp, which had the potential to encode a 476-amino-acid polypeptide with 53% amino acid identity to the predicted product of the S. cerevisiae MET2 gene (Fig. 2). MET2 encodes homoserine-o-transacetylase, an enzyme which catalyzes a step in the biosynthesis of methionine [20]. The standard protein protein BLAST also revealed that the putative P. pastoris MET2 protein (GenBank Accession No. AY876284) shared a conserved a/b hydrolase domain, between the 88th and the 252nd amino acids, with its S. cerevisiae counterpart. These results suggested that the 1428-bp ORF was the P. pastoris homologue of the MET2 gene of bakerõs yeast [20]. To confirm that the specific homologous sequence was responsible for complementation of the auxotrophic met2 P. pastoris strain, we inserted a minimal MET2 fragment at a non-homologous site, the his4 gene, in the P. pastoris genome. A 2.2-kb fragment, containing the putative MET2 promoter, ORF and transcriptional termination regions, was inserted into the previously constructed pblhis vector [9] which harbors the HIS4-selectable marker. This plasmid, designated pdt10, was then integrated into ydt39 (his4 met2) at the mutant his4 locus and resulted in the growth of transformants on medium lacking both amino acids. A control transformation performed with pblhis alone yielded His + but not Met + transformants, as expected. Thus, complementation of the met2 auxotrophy by pdt10 suggested that the 2.2-kb MET2 fragment contained enough 5 0 and 3 0 non-coding regions to provide sufficient expression of the Met2 protein. The S. cerevisiae MET2 gene, which was inserted into pblhis as well, also complemented the P. pastoris met2 strain, although these transformants grew more slowly than those strains complemented with the P. pastoris MET2. Conversely, when the 2.2-kb P. pastoris MET2 Fig. 2. A partial amino acid alignment of the P. pastoris MET2 gene with the S. cerevisiae MET2 gene. The P. pastoris MET2 (GenBank Accession No. AY876284) has 53% identity, with 68% similarity, to the S. cerevisiae MET2. The shaded amino acid residues indicate identical amino acids and positive residues (changes that do not affect the overall structure and function). The conserved a/b hydrolase domain is located between the 88th and the 252nd amino acids. The sequence of XXXX from 282 to 299 is a result of filtering the P. pastoris MET2 protein for low-complexity sequences to prevent artifactual hits.

940 D. Thor et al. / FEMS Yeast Research 5 (2005) 935 942 was cloned into prs425, containing the S. cerevisiae LEU2 marker, and introduced into leu2 met2 S. cerevisiae cells, Leu + transformants still displayed a met phenotype. This lack of reciprocal complementation between bakerõs yeast and P. pastoris has been seen previously [9]. Using a similar strategy, the P. pastoris homologue of S. cerevisiae MET10 was also cloned (GenBank Accession No. AY878119); however, because of its length (>4 kb), it was not pursued further as a useful selectable marker. 3.2. Construction of P. pastoris expression strains and vectors Having identified the P. pastoris MET2, we constructed new expression vectors and a series of corresponding strains utilizing the biosynthetic gene as a selectable marker. A set of strains containing all possible combinations of the available auxotrophic markers, ade1, arg4, his4 and ura3 and met2 are shown in Table 1. Only strains containing combinations of his4, arg4 and met2 show doubling times similar to that of the wild type. The MET2 gene was incorporated into two expression vectors, one designed for secretion of heterologous proteins using the S. cerevisiae a-mating factor prepro peptide (pblmet SX), and the other designed for intracellular expression (pblmet IX). Both plasmids are similar to the previously constructed expression vectors based on the biosynthetic selectable markers HIS4, ADE1, ARG4, and URA3 [9]. Both pblmet IX and pblmet SX contain: (a) sequences from pblue- SCRIPT II SK needed for plasmid maintenance in E. coli; (b) the P. pastoris MET2-selectable marker; and (c) an expression cassette composed of the P. pastoris AOXI promoter and transcriptional terminator separated by a multiple-cloning site containing unique restriction sites for the insertion of heterologous genes (Fig. 3). 3.3. Use of pblmet IX for heterologous expression To demonstrate that the new expression vectors and strains could be used for heterologous expression, the E. coli b-lactamase-coding sequence was cloned into pblmet IX to create pdt105, which was subsequently transformed into ydt39 (his4 met2). Met + transformants could be divided into two groups: those that contain the entire plasmid, including the AOX1 promoter/ b-lactamase expression cassette, and those that are the product of gene conversion events, which contain a functional MET2 but lack all other portions of the plasmid. In order to differentiate between these two types of transformants, a rapid colony PCR reaction was performed on the Met + colonies. If the genomic DNA of Fig. 3. Plasmids pblmet IX for intracellular expression and pblmet SX for secreted expression. The significant regions of each expression plasmid are shown. The unique restriction sites in the pblmet IX multiple-cloning site (MCS) are XhoI, SacII, NotI, and XbaI while the unique sites in the pblmet SX MCS are PstI, SfiI, SacII, and NotI. the cells contained the entire plasmid, an 800-bp fragment from the b-lactamase gene should be amplified. Of the 25 colonies tested, 24 were positive for containing the heterologous gene. When similar transformation experiments were done using a plasmid with the same b-lactamase expression cassette but containing the HIS4 gene as the selectable marker [17], only about 60% of transformant colonies were shown to harbor the b-lactamase gene. Thus, the use of the MET2- selectable marker appears to reduce the number of gene conversion events and increase the likelihood that a transformed colony contains the recombinant gene in an expression cassette. Finally, we expected that strains containing the entire pdt105 plasmid should express b-lactamase activity only under conditions where the AOX1 promoter is induced, i.e., in medium containing methanol as a sole carbon source [21]. As a control, ydt39 was also transformed with phw018, which contained the same AOX1 promoter/b-lactamase expression cassette as

D. Thor et al. / FEMS Yeast Research 5 (2005) 935 942 941 Table 2 Specific activities of b-lactamase and GAPDH in transformed strains Construct Description Specific activity in MeOH b-lactamase a GAPDH b pblmet IX MET2 0.00 1.174 phw018 HIS4 P AOX1 -bla 5.43 0.626 pdt105 MET2 P AOX1 -bla 9.64 0.878 a DA 415 lg 1 min 1. b DA 340 lg 1 min 1. pdt105 but contained HIS4 as a selectable marker. The transformation efficiency using the MET2 marker was about 50% of that using the HIS4 marker. Several transformants were grown on glucose and then shifted to methanol medium for 8 h to trigger the expression of intracellular b-lactamase. As shown in Table 2, methanol-induced cell extracts from strains harboring either a HIS4-based (phwo18) or MET2-based (pdt105) expression vector contained similar levels of b-lactamase-specific activity. As expected, no b-lactamase activity was found in any of these strains when grown on glucose medium (data not shown). Additionally, as a control to ensure that all extracts were processed correctly, the constitutively expressed enzyme, glyceraldehyde-3-phosphatase dehydrogenase (GAPDH), was also assayed. Thus, pblmet IX provides for the transformation and regulated expression of heterologous proteins when used with met2 strains. 4. Discussion In this report, we describe the development of a new P. pastoris biosynthetic gene/auxotrophic host combination which can be employed as a selectable marker for molecular-genetic manipulation of this yeast. The P. pastoris MET2 gene was incorporated into expression plasmids that can be used for either intracellular or extracellular localization of recombinant proteins. Moreover, the intracellular expression vector was successfully used to express a biologically active bacterial enzyme, b-lactamase. The creation of vectors containing MET2 as a selectable marker along with met2 strains contributes several advantages to the P. pastoris expression system. First, it adds another selectable marker to the list of choices for transformation and other types of molecular-genetic manipulation, providing for greater flexibility. Second, unlike ade1 and ura3 strains, met2 strains grow at a rate similar to that of the wild type. Slow growth of the host strain may decrease the yield of heterologous protein or may complicate phenotypic comparisons used in functional analysis studies. Third, the MET2 gene appears to reduce the incidence of gene conversion events among selected transformants compared to HIS4-based selection. Finally, met2 strains may be an ideal choice when performing S 35 methionine-labeling experiments. Thus, this new selectable marker should make P. pastoris more amenable to genetic manipulation and appealing as host for foreign protein expression. Acknowledgements This work was supported by NIH AREA (GM65882) grant, a Scholarly/Artistic Activity Grant from the University of the Pacific to J.L.-C and G.P.L.-C, and a Hornage Undergraduate Research Fellowship to C.C. Orazem. We thank D. Ream-Robinson and D. De- Wald for generously providing strains and plasmids. References [1] Cregg, J.M., Lin Cereghino, J., Shi, J. and Higgins, D.R. (2000) Recombinant protein expression in Pichia pastoris. Mol. Biotechnol. 16, 23 52. [2] Lin Cereghino, J. and Cregg, J.M. (2000) Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol. Rev. 24, 45 66. [3] Lin Cereghino, G.P., Sunga, A.J., Lin Cereghino, J. and Cregg, J.M. (2001) Expression of foreign genes in the yeast Pichia pastoris. In: Genetic Engineering: Principles and Methods (Setlow, J.K., Ed.), Vol. 23, pp. 157 169. Kluwer Academic/Plenum Press, New York. [4] Faber, K.N., Elgersma, Y., Heyman, J.A., Koller, A., Luers, G.H., Nuttley, W.M., Terlecky, S.R., Wenzel, T.J. and Subramani, S. (1998) Use of Pichia pastoris as a model eukaryotic system. Peroxisome biogenesis. Methods Mol. Biol. 103, 121 147. [5] Cregg, J.M. and Madden, K.R. (1987) Development of yeast transformation systems and construction of methanol-utilizationdefective mutants of Pichia pastoris by gene disruption. In: Biological Research on Industrial Yeasts (Stewart, G.G., Russell, R.D., Klein, R.D. and Hiebsch, R.R., Eds.), Vol. 2, pp. 1 18. CRC Press, Boca Raton, FL. [6] Higgins, D.R. and Cregg, J.M. (1998) Introduction to Pichia pastoris. In: Pichia Protocols (Higgins, D.R. and Cregg, J.M., Eds.), Vol. 103, pp. 1 15. Humana Press, Totowa, NJ. [7] Higgins, D.R., Busser, K., Comiskey, J., Whittier, P.S., Purcell, T.J. and Hoeffler, J.P. (1998) Small vectors for expression based on dominant drug resistance with direct multicopy selection. Methods Mol. Biol. 103, 41 53. [8] Kimura, M., Takatsuki, A. and Yamaguchi, I. (1994) Blasticidin S deaminase gene from Aspergillus terreus (BSD): a new drug resistance gene for transfection of mammalian cells. Biochim. Biophys. Acta 1219, 653 659. [9] Lin Cereghino, G.P., Lin Cereghino, J., Sunga, A.J., Johnson, M.A., Lim, M., Gleeson, M.A.G. and Cregg, J.M. (2001) New selectable marker/auxotrophic host strain combinations for molecular genetic manipulation of Pichia pastoris. Gene 263, 159 169. [10] Nokelainen, M., Tu, H., Vuorela, A., Notbohm, H., Kivirikko, K. and Myllyharju, J. (2001) High-level production of human type I collagen in the yeast Pichia pastoris. Yeast 18, 797 806. [11] Cregg, J.M. and Russell, K.A. (1998) Transformation. In: Pichia Protocols (Higgins, D.R. and Cregg, J.M., Eds.), Vol. 103, pp. 27 39. Humana Press, Totowa, NJ. [12] Cregg, J.M., Shen, S., Johnson, M. and Waterham, H.R. (1998) Classical genetic manipulation. In: Pichia Protocols (Higgins,

942 D. Thor et al. / FEMS Yeast Research 5 (2005) 935 942 J. and Cregg, J.M., Eds.), Vol. 103, pp. 17 26. Humana Press, Totowa, NJ. [13] Winzeler, E.A., Shoemaker, D.D., Astromoff, A., Liang, H., Anderson, K., Andre, B., Bangham, R., Benito, R., Boeke, J.D., Bussey, H., Chu, A.M., Connelly, C., Davis, K., Dietrich, F., Dow, S.W., El Bakkoury, M., Foury, F., Friend, S.H., Gentalen, E., Giaever, G., Hegemann, J.H., Jones, T., Laub, M., Liao, H., Liebundguth, N., Lockhart, D.J., Lucau-Danila, A., Lussier, M., MÕRabet, N., Menard, P., Mittmann, M., Pai, C., Rebischung, C., Revuelta, J.L., Riles, L., Roberts, C.J., Ross-MacDonald, P., Scherens, B., Snyder, M., Sookhai-Mahadeo, S., Storms, R.K., Veronneau, S., Voet, M., Volckaert, G., Ward, T.R., Wysocki, R., Yen, G.S., Yu, K., Zimmermann, K., Philippsen, P., Johnston, M. and Davis, R.W. (1999) Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285, 901 906. [14] Liu, H., Tan, X., Russell, K.A., Veenhuis, M. and Cregg, J.M. (1995) PER3, a gene required for peroxisomal biogenesis in Pichia pastoris encodes a peroxisomal membrane protein involved in protein import. J. Biol. Chem. 270, 10940 10951. [15] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [16] Christianson, T.W., Sikorski, R.S., Dante, M., Shero, J.H. and Hieter, P. (1992) Multifunctional yeast high-copy-number shuttle vectors. Gene 110, 119 122. [17] Waterham, H.R., Digan, M.E., Koutz, P.J., Lair, S.V. and Cregg, J.M. (1997) Isolation of the Pichia pastoris glyceraldehyde-3- phosphate dehydrogenase gene and regulation and use of its promoter. Gene 186, 37 44. [18] Liu, H., Tan, X., Veenhuis, M., McCollum, D. and Cregg, J.M. (1992) An efficient screen for peroxisome-deficient mutants of Pichia pastoris. J. Bacteriol. 174, 4943 4951. [19] Vuorela, A., Myllyharju, J., Nissi, R., Pihlajaniemi, T. and Kivirikko, K.I. (1997) Assembly of human prolyl 4-hydroxylase and type III collagen in the yeast Pichia pastoris: formation of a stable enzyme tetramer requires coexpression with collagen and the assembly of stable collagen requires coexpression with prolyl 4-hydroxylase. EMBO J. 16, 6702 6712. [20] Langin, T., Faugeron, G., Goyon, C., Nicolas, A. and Rossignol, J. (1986) The MET2 gene of Saccharomyces cerevisiae: molecular cloning and nucleotide sequence. Gene 49, 283 293. [21] Tschopp, J.F., Brust, P.F., Cregg, J.M., Stillman, C.A. and Gingeras, T.R. (1987) Expression of the lacz gene from two methanol-regulated promoters in Pichia pastoris. Nucleic Acids Res. 15, 3859 3876.