Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of R Agami), pcdna3-myc-lats2 deletion mutants (this work), pcmv-p53 (generous gift of B. Vogelstein). sirna oligonucleotides: name sense sequence source silats2#30 GCCUUUGGAGAAGUGUGCCUUGCUU Invitrogen silats2#31 CCGCAAAGGGUACACUCAACUCUGU Invitrogen siaspp1#69 AGGCAAGCAGCUGCCUCCAAGCUAU Invitrogen siaspp1#71 GAACGGCAAUCUGUCUGCUGAAAUA Invitrogen silats2-utr GAAGAACAUUGAUGAGAAA Dharmacon siaspp1-utr GUGUAAAUGUGCACAAUAA Dharmacon siyap1-utr GCUUAUAAGGCAUGAGACA Dharmacon real-time qpcr primers: for expression: name sequence Lats2 Fw GCAGATTGTGCGGGTCATTA Lats2 Rv GGCATGAGCCCCTTTCCT ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Yap1 Fw GCCGGAGCCCAAATCC Yap1 Rv GCAGAGAAGCTGGAGAGGAATG p21 Fw GGCAGACCAGCATGACAGATT p21 Rv GCGGATTAGGGCTTCCTCTT PUMA Fw GCTGCTGTAGATACCGGAATGAA PUMA Rv AAAAAAATTAACCAAACATGTACAGAAAAT CD95 Fw CCCTCCTACCTCTGGTTCTTACG CD95 Rv TTGATGTCAGTCACTTGGGCAT Pig3 Fw AGAGACAAGGCCAGTATGACCC Pig3 Rv GTCCCAAAATGTTGCTGGCT
HPRT Fw HPRT Rv TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT for ChIP: name p21 Fw p21 Rv Bax Fw Bax Rv Gadd45a Fw Gadd45a Rv PUMA Fw PUMA Rv CD95 Fw CD95 Rv 14-3-3s Fw 14-3-3s Rv Btg2 Fw Btg2 Rv Osteocalcin Fw Osteocalcin Rv GAPDH Fw GAPDH Rv sequence GCACTCTTGTCCCCCAG TCTATGCCAGAGCTCAACAT AATCCCAGCGCTTTGGAAG TTGCTAGATCCAGGTCTCTGCA TGGACTTTCAGCCGAGATGTG GATCTCTTCCGCTGCTGGC GCGAGACTGTGGCCTTGTGT ACTTTGTGGACCCTGGAACG AAGCGGAAGTCTGGGAAGCT CTTGTCCAGGAGTTCCGCTC CCTAAGCCTCCCTCCAGGAG GCCAGGATAATTTCACAGGCC GTCTGGGAGAGGTGGTGTCAC CCTCTTCGCCCATTTTTAAGG TAGGTCTCTGATCCCCGCT GTCATCCGCCCCAGCTC GTATTCCCCCAGGTTTACAT TTCTGTCTTCCCTCACTCC Caspase assay: Cells were detached with trypsin, collected and fixed with 3% formaldehyde at 37 C for 10 min. Fixed cells were permeabilized with 90% methanol and stored at -20 C. After rehydration washes, cells were stained with anti-cleaved Caspase-3 antibody (Asp175, Cell Signaling) for 1 hour at RT, followed with Cy2 labeled 2 nd antibody for 30 min at RT. For cell cycle distribution by FACS analysis, cells were resuspended in 50 g/ml propidium iodide.
Z-VAD treatment: Cells were incubated for 24 hours with 50uM Z-VAD-fmk (Sigma), and then harvested for FACS analysis. Transwell cell migration assays: Following transfection, cells were washed and incubated in serum-free medium overnight. The following day 10 5 cells were plated in the upper compartment of a 24-well Transwell tray (Corning, Acton, MA) in serumdepleted medium. The lower compartment contained full medium, and cells were allowed to migrate through the intervening nitrocellulose membrane (8 micron pore size) during 16 h of incubation at 37 C. The filter was then removed, fixed for 15 min in phosphate-buffered saline (PBS) containing paraformaldehyde (3%), followed by cell permeabilization in Triton X-100 (0.05%, in PBS) and staining with crystal violet. Cells growing on the upper side of the filter were scraped using cotton swabs, whereas cells growing on the bottom side of the filter were photographed and counted. For a cell-count control, the same number of cells was seeded in a 24-well plate in complete medium and stained with crystal violet. Supplementary Figures Fig. 1s: (A) WI-38 cells were transfected with sirna oligonucleotides specific for ASPP1 or Lats2, or control sirna (siaspp1, silats2 and sicont). Two days later, cells were subjected to Western blot analysis to visualize endogenous ASPP1 and Lats2. GAPDH was used as a loading control. (B) WI-38 cells were retrovirally infected with H-RasV12. Two days after infection, cells were transfected with a single sirna oligos (as indicated) or control sirna (sicont). Three days after infection, cells were harvested, and RNA was extracted and subjected to qrt-pcr analysis. Values were normalized to HPRT mrna. (C) WI-38 cells were retrovirally infected with H-RasV12. 24 hours after infection, cells were transfected with sirna directed against the non-coding region of Lats2 (silats2-utr) or control sirna (sicontrol). Two days after infection, cells were infected with viruses expressing the coding region of Lats2. At day 3, cells were fixed and immunostained to visualize Lats2 and ASPP1. Nuclear DNA was visualized by DAPI staining. Fig. 2s: HCT116 cells were transiently transfected with myc-tagged Lats2 wild-type (myc-lats2 wt), myc-tagged Lats2 kinase-dead (myc-lats2 kd), V5-tagged ASPP1
(V5-ASPP1), flag-tagged Yap1 (flag-yap1) or vector. Cells were harvested 24 hours after transfection and lysates were subjected to Western blot analysis. Lats2, ASPP1 or Yap1 were detected by antibodies directed against the ectopically expressed tag or endogenous proteins. GAPDH was used as a loading control. Fig. 3s: HCT116 cells were transiently transfected with myc-tagged Lats2 together with either empty vector or V5-tagged ASPP1 lacking the N-terminus ( N ASPP1). Twenty-four hours later, cells were fixed and immunostained using anti-v5 antibodies. Nuclear DNA was visualized by DAPI staining. Fig. 4s: (A) HCT116 cells were transiently transfected with combinations of V5- tagged ASPP1 and myc-tagged Lats2. 48 hours later, cells were subjected to ChIP analysis with anti-ha antibodies as a negative control for non-specific binding. Input and bound DNA were quantified using qpcr with primer pairs corresponding to p53 responsive elements within the indicated genes. (B) HCT116 cells were transfected and subjected to ChIP analysis as in (A), using antibodies directed against p53, myc- Lats2 or V5-ASPP1. Input and bound DNA were quantified using qpcr with primer pairs corresponding to GAPDH negative control gene. (C) HCT116 cells were transiently transfected with combinations of vector, myc-lats2 wild-type (Lats2 wt), myc-lats2 kinase-dead (Lats2 kd), short-hairpin RNA against p53 (shp53) and V5- ASPP1 (ASPP1). Cells were harvested 24 hours after transfection and lysates were subjected to Western blot analysis to detect Lats2 and p53. GAPDH was used as a loading control. (D) HCT116 cells were transfected and subjected to ChIP analysis as in (C), using antibodies directed against myc-lats2. Input and bound DNA were quantified using qpcr with primer pairs corresponding to promoter regions of the indicated genes or GAPDH as a negative control gene. Fig. 5s: (A) HCT116 p53-/- cells were transiently transfected with combinations of empty vector, ASPP1 and Lats2 together with the indicated firefly luciferase reporter plasmids. Twenty-four hours later, cells were either mock-treated or treated with 5- FU (50 g/ml) for 16 hours. Luciferase assays were performed in triplicate and values represent average firefly luciferase expression after normalization for cotransfected renilla luciferase plasmid. (B) WI-38 cells were retrovirally infected with H-RasV12.
Two days after infection, cells were transfected with a single sirna oligos (as indicated) or control sirna (sicont). Three days after infection, cells were harvested, and RNA was extracted and subjected to qrt-pcr analysis. Values were normalized to HPRT mrna. Fig. 6s: (A) WI-38 cells were infected with H-RasV12. Two days later cells were transfected with sirna oligonucleotides specific for ASPP1 or Lats2, or control sirna (siaspp1, silats2 and sicont, respectively). Three days after infection, cells were labeled with BrdU and then fixed, stained with anti-brdu antibodies and with PI, and then analyzed by FACS. The X-axis represents PI incorporation (DNA content) whereas the Y-axis indicates the percentage of BrdU-positive cells. (B) WI- 38 cells were infected with H-RasV12 or vector control. Three days later, cells were treated with Z-VAD or mock-treated for 24 hours, harvested, fixed, stained with antiactivated caspase 3 antibodies and with PI and analyzed by FACS. % caspase + relates to the percentage of cells in a given DNA content subpopulation staining positive for activated caspase 3. (C) WI-38 cells were infected and treated as in (B) and analyzed by FACS. Fig. 7s: (A) Schematic representation of full-length Lats2 and the different deletion mutants lacking the UBA domain ( UBA), the PPP and PPPPYP motifs ( P), or retaining the following amino acid regions: 79-257, 255-621 or 644-855. (B) HCT116 cells were transiently transfected with myc-tagged full-length Lats2 or deletion mutants thereof, together with empty vector, V5-ASPP1 or flag-yap1. Lysates were immunoprecipitated (IP) with anti-myc antibodies. Westerns were immunoblotted (IB) using antibodies directed against Yap1, ASPP1, Mdm2 or myc-lats2. DW: Direct Western, 2.5% of each lysate subjected directly to SDS-PAGE and Western blot analysis. (C) HCT116 cells were transiently transfected with myc-lats2, V5- ASPP1 and flag-yap1. Lysates were immunoprecipitated (IP) with anti-p53 antibodies. Westerns were immunoblotted (IB) using antibodies directed against Lats2 or Mdm2. DW: Direct Western, 2.5% of each lysate subjected directly to SDS- PAGE and Western blot analysis.
Fig. 8s: (A) HCT116 cells were transiently transfected with combinations of empty vector, Yap1 and Lats2 together with the indicated firefly luciferase reporter plasmids. Twenty-four hours later, cells were treated with 5-FU (50 g/ml) for 16 hours. Luciferase assays were performed in triplicate and values represent average firefly luciferase expression after normalization for cotransfected renilla luciferase plasmid. (B) HCT116 cells were transiently transfected with combinations of sirna oligonucleotides specific for Yap1 and ASPP1, or control sirna (siyap1, siaspp1 and sicont, respectively). Twenty-four hours later, cells were either mock-treated or treated with 5-FU (50 g/ml) for 16 hours. Cells were then harvested, and RNA was extracted and subjected to qrt-pcr analysis. Values were normalized to HPRT mrna. (C) HCT116 p53-/- cells were transiently transfected with combinations of empty vector, p53, Lats2, ASPP1 and Yap1. Three days after transfection, cells were harvested, fixed, stained with PI and subjected to FACS-based DNA content analysis. (D) U2OS cells were transiently transfected with combinations of empty vector, Lats2, ASPP1 and Yap1. 24 hours after transfection, equal amounts of cells were plated in transwells and subjected to migration assays. Representative fields were photographed.