Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany
RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald, and Michael Famulok LIMES Program Unit Chemical Biology & Medicinal Chemistry, c/o Kekulé Institute for Organic Chemistry & Biochemistry, University of Bonn, Gerhard-Domagk-Strasse 1, D-53121 Bonn, Germany. [ ] Dr. Günter Mayer, Dipl. Chem. Marie-Sophie L. Raddatz, Dipl. Chem. Julia D. Grunwald, and Prof. Dr. Michael Famulok Life and Medical Sciences (LIMES), Program Unit Chemical Biology and Medicinal Chemistry, c/o Kekulé-Institut für Organische Chemie und Biochemie, Universität Bonn, Gerhard-Domagk-Str. 1, 53121 Bonn, Germany Fax. +49-228-734809 Email: m.famulok@uni-bonn.de 1
Oligonucleotides and Primers: Primer: 1. 5 TCGTAATACGACTCACTATAGGAACCAAACGACTCG3 (5 tpp) 2. 5 TTGCGCTGGATCCAGCAGGTCGA3 (3 tpp) 3. 5 CGTGACTTCCCTACGCTGGCAT3 (3 tpp.91) 4. 5 TCGTAATACGACTCACTATAGACCACCAGGTCATTG3 (5 -tpp.74) 5. 5 GCATTGGAATTCCTGCCGTTTTTCCTCGTTTACAA3 tpp.rs 5 GGAACCAAACGACTCGGGGTGCCCTTCTGCGTGAAGGCTGAGAA ATACCCGTATCACCTGATCTGGATAATGCCAGCGTAGGGAAGTCACGGACCACCAGG TCATTGCTTCTTCACGTTATGGCAGGAGCAAACTATGCAAGTCGACCTGCTGGATCCA GCGCAA3 RNA library N25: 5 GGGAGAGAGAGACAGUCUACGUAUU-N25-UUCACUGCAGACGUAGUACA3 blocking oligos: N25.21 5 TGTACCTACGTCTGCAGTGAA3 5 -oligo1 5 AATACGTAGACTGTCT CTCTCTCCC3 N25.3.25 25.3F: 5 TAATACGACTCACTATAGACACTTCGAG CGGGTACGAGTGTC3 25.3R: 5 GACACTCGTACCCGCTCGAAGTG TCTATAGTGAGTCGTATTA3 N25.1.22 22.1F 5 TAATACGACTCACTATAGGCATACCTGGTGCTCTGTGCC3 22.1R 5 GGCACAGAGCACCAGGTA TGCCTATAGTGAGTCGTATTA3 Preparation of Oligonucleotides. The thim riboswitch was prepared from dsdna templates, generated with PCR using the appropriate primers, by in vitro transcription and purified by PAGE. 5 -biotinylated RNA was prepared by GMPS transcription, using 4-fold excess of GMPS over GTP, and subsequent treatment with iodo-acetyl biotin (Pierce). The aptamer domain (AD) and the expression domain (ED) of the thim riboswitch were transcribed from dsdna templates, generated by PCR with the primers 1 and 3 (AD), and 4 and 2 (ED), respectively. For the preparation of RNA hairpins N25.3.25 and N25.1.22 the complementary oligos 25.3F and 25.3R, and 22.1F and 22.1R were hybridized and used for in vitro transcription by T7 RNA polymerase. 2
In vitro selection. Biotinylated thim (10 pmol) was coupled to streptavidin-coated magnetic beads (500 µg, Dynal). The thim-beads were equilibrated in SELEX buffer (10 mm Hepes ph 7.5, 100 mm KCl and 5 mm MgCl2). The RNA library N25 was diluted in 10 mm Hepes, ph 7.5, 100 mm KCl, blocking oligos N25.21 and 5 -oligo1 were added, heated to 80º C for 3 minutes and cooled to RT for 15 min. After addition of 5 mm MgCl 2, equal volumes of the RNA solution and the thim-beads were incubated for 30 min at RT and washed 4-8 times with 100µl SELEX buffer. Bound RNA molecules were eluted by incubation with TPP for 15 min at RT (cycle 1-7: 50 µm; cycle 8: 5 µm). The eluted RNA molecules were used for RT-PCR and in vitro transcription. Selection cycles 7 and 8 included pre-elution steps with 50 µm thiamine in SELEX buffer prior the elution with TPP. Analytical selection cycles were done essentially as described here but to facilitate scintillation counting of bound and eluted RNA radioactive labeled blocking oligos were used. ThiM lacz fusion and thiamine-repression ß-galactosidase assays. The region spanning nucleotides 67 to 163 of the E. coli thim gene was amplified by PCR from E. coli strain DH10b as EcoR1-BamHI fragment and ligated into EcoR1- and BamH1-digested prs414 plasmid DNA. The plasmids were transformed into Top10 cells (Invitrogen). All site-directed mutations were introduced into thim regulatory regions using the QuikChange site-directed mutagenesis kit (Stratagene) and the appropriate mutagenic DNA primers. All mutations were confirmed by DNA sequencing. β-galactosidase activity assays were done as described.[15] All experiments were performed in duplicate, with Miller unit values reflecting the average of these analyses. Metabolite competition assays. Biotinylated thim RNA (35 nm) was incubated with 32 P-end labeled RNA hairpins (N25.3.25 and N25.1.22) (1 nm), 35 nm soluble streptavidin, and increasing concentrations of either thiamine or TPP in SELEX buffer for 30 min at RT. After incubation, the reactions were passed through 0.45µm nitrocellulose membranes and washed 4 with 200µl SELEX buffer. Bound RNA was quantified by PhosphorImaging. All assays were performed in duplicates or quadruplicates. Electrophoretic Mobility Shift Assays. 32 P-end labeled RNA hairpins (N35.3.25 and N25.1.22) (1 nm ) were incubated either in the absence or presence of thim or the indicated mutant (60 nm N25.3.25 and 40 nm N25.1.22, respectively). Incubation of RNA hairpins with thim or mutants was done in SELEX 3
buffer supplemented with 10% glycerol. After loading, gels were run for at least 2-3 h at 4º C on 6% native polyacrylamide gels in SELEX buffer (pre-run for 1.5 h at 4ºC). Bands were quantified by PhosphorImaging. (Note: The thim riboswitch used in this study bears two point mutations compared to the wildtype sequence, namely G155A and U157C also used in ref. 6. The RNA depicted as wt thim in Fig. 2 represents the wildtype sequence and was included as further control RNA). Isothermal Titration Calorimetry. RNA for isothermal titration calorimetry (ITC) was transcribed and purified as described above and dialyzed against buffer (10 mm HEPES ph 7.5, 100 mm KCl and 5 mm MgCl 2 ) at 4 C o/n. Following dialysis, the buffer was used to prepare a TPP solution at a concentration that was approximately 7.5-fold higher than the RNA (typically about 112.5 µm and 15 µm, respectively). All experiments were performed with a CSC ITC instrument at 25 C by titrating 23-33 injections of 3 µl of TPP into the RNA sample. Data was analyzed using BindWorks ITC software and fit to a single-site binding model. 4
Supplementary Figure S1 Sequences of the selected RNA molecules. Only the initial random regions are shown. Sequences can be grouped into two motifs, one unique sequence N25.3 and the motif I sharing the consensus sequence ACCUGG shown in blue. Sequences that are complementary to the thim riboswitch are highlighted in blue and red, respectively. 5
Supplementary Figure S2 Characterization of the selected RNA molecules by EMSA. a, Electrophoretic mobility shift assays using radiolabeled N25.1.22 (bottom) and N25.3.25 (top) and increasing concentrations of thim. 6
Supplementary Figure S3. Isothermal titration calorimetry of thim and mutants. a, Representative titration curve and fitted data resulting from consecutive TPP injections to a solution containing the thim riboswitch in binding buffer substituted with 5 mm MgCl 2.b, Dissociation constants [nm] and H [kj/mol] values obtained from ITC experiments of the respective thim riboswitch, aptamer domain or mutant. n.d. not detectable. 7
Supplementary Figure S4. Analytical selection cycle using radioactive labeled blocking oligos (according to the in vitro selection protocol described above). The amount of RNA relative to the total input is given. Elution of RNA libraries was monitored by scintillation counting after elution of thim bound RNA with either buffer, thiamine or thiaminepyrophosphate (TPP) [5µM]. 8
Supplementary Figure S5. Competition assays of RNA hairpins with TPP and pyrithiamine pyrophosphate (PTPP). A. Structures of TPP (blue) and PTPP (purple). B. Competition of N25.1.22 with TPP and pyrithiamine pyrophosphate (PTPP) for thim binding. C. Competition of N25.3.25 with TPP and pyrithiamine pyrophosphate (PTPP) for thim binding. Blue bars: competition with TPP; purple bars: competition with PTPP. PTPP was synthesized as described in Ref. 5. 9