Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line

Similar documents
Phosphorylation of the Bloom s Syndrome Helicase and Its Role in Recovery from S-Phase Arrest

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Protocol for induction of expression and cell lysate production

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

ab Ubiquitylation Assay Kit (HeLa lysate-based)

Modified Rapid MAIPA Protocol

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

MitoBiogenesis In-Cell ELISA Kit (Colorimetric)

Anti-Piscirickettsia salmonis monoclonal antibody. Product no: P05

Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP

Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

O-GlcNAcase Activity Assay

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).

*Corresponding author. Tel: ;

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

This Document Contains:

Human IL-10 ELISA MAX Set Deluxe

Anti-White Spot Syndrome Virus (WSSV) monoclonal antibody. Product no: P13

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence

Confocal immunofluorescence microscopy

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Human IgG Antigen ELISA Kit

PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY. I. Removal and Fixation of Plantar Skin (see video)

Supplemental information

Generic DELFIA Reagents

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

Detection and identification of body fluid stains using antibodynanoparticle

Human IL10RB ELISA Pair Set ( CRFB4 )

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

Whole Mount IHC Protocol

Kinase Reaction and Alkylation Protocol

For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates.

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

Human Granulin / GRN / Progranulin ELISA Pair Set

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Convoy TM Transfection Reagent

Coleman et al., Supplementary Figure 1

Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.

Mouse Factor XII Total ELISA Kit

OPPF-UK Standard Protocols: Mammalian Expression

MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit

ab G alpha i Activation Assay Kit

IMMUNOPRECIPITATION (IP)

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

ApoTrack Cytochrome c Apoptosis ICC Antibody

Immunohistochemistry with APAAPstaining Authors

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

Strep-tag detection in Western blots

Preparing Cell Cultures of Human Embryonic Kidney

Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP

Mouse ICAM-1 / CD54 ELISA Pair Set

ab Ubiquitylation Assay Kit

ab Alkaline Phosphatase Conjugation Kit Protocol

A Bridging Immunogenicity Assay Using SPARCL TM Technology

Supporting Information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

Contaminant bovine transferrin assay

Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle

ab Antibody Serum Purification Kit (Protein A) Protocol

ab Ran Activation Assay Kit

Nature Immunology: doi: /ni Supplementary Figure 1

Conjugation Kit Protocol

Total Histone H3 Acetylation Detection Fast Kit (Fluorometric)

Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated

Reducing Non-Specific Binding in Surface Plasmon Resonance Experiments

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

SUPPLEMENTARY INFORMATION

Human TGF-beta1 ELISA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents

EGFR (Phospho-Ser695)

Manufactured by. Zyagen Barnes Canyon Road San Diego, CA 92121, USA

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit

In Vitro Diagnostic Products

Supplementary Figure Legend

Transcription:

Materials and Methods Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line derived from a BS patient and contains the BLM Ash founder mutation identified in patients of Ashkenazi Jewish origin 1. The PSNF5 and PSNG13 cells have been described previously 2,3 and were derived from GM08505 cells following transfection with a construct expressing flag epitope-tagged BLM protein or the pcdna3 vector, respectively. PSNF5 cells are considered to be phenotypically corrected in that the high frequency of sister-chromatid exchanges (SCEs) diagnostic of BS cells is suppressed to near normal levels in this cell line 2,3. Stable transfectants of GM08505 cell line expressing BLM-T99A, BLM-T122A or BLM- T99A/T122A have been described previously 2. The GM08505 derivatives expressing wildtype BLM or BLM-K695T protein were a kind gift of M. Sanz and J. German, and were described elsewhere 4. All cells were grown in α-mem (minimal essential medium) culture medium containing 10% fetal calf serum and 3mM glutamine at 37 C in a humidified atmosphere containing 5% CO 2. DNA replication inhibitors and clonogenic cell survival analyses. Aphidicolin, HU, gemcytabine and cytosine arabinoside (Ara C) were obtained from Sigma. The CDK inhibitor, roscovitine, was obtained from Calbiochem. Aphidicolin was dissolved in DMSO, and the other agents were dissolved in water. Clonogenic survival analyses were performed as described by Davies et al. 2.

Western blotting. Cell extracts were prepared and Western blotting for BLM was conducted using the IHIC34 rabbit polyclonal antibody, as described by Wu et al. 5. β-tubulin was used as a loading control and was detected using the tub2.1 monoclonal antibody (Sigma). Preparation and immunolabeling of chromosome fibers. Cells were exposed to 20 M IdU for 10 minutes to label sites of active replication. Following a 15 minute exposure to 50 M thymidine, cells were left untreated or were exposed to either aphidicolin (30 M) or HU (4mM) for up to 6 hours. The cells were then incubated in drug-free medium for 20 minutes to allow for replication fork re-start in the presence of 100 M CldU, unless stated otherwise. Chromosome spreads were prepared as described by Jackson and Pombo 6 with the modifications described by Merrick et al. 7. Slides were acid treated with 2.5M HCl for 1 hour, neutralized in 0.1M Na 3 B 4 O 7, ph 8.5, for 7 minutes, and were then washed several times in phosphate buffered saline (PBS). Samples were then blocked for 30 minutes with 1% BSA and 0.1% Tween 20 in PBS. Antibodies were diluted in blocking buffer as follows: anti-cldu, 1:40; anti-mouse Alexafluor 488, 1:200; anti-idu, 1:2; anti-rat Cy3, 1:900. Incubations with antibodies were carried out at 37 C for 1 hour (for primary antibodies) or 45 minutes (for secondary antibodies). The incubation with the IdU antibody was followed by a high salt wash with buffer (29.2g NaCl, 4.44g Tris-HCI, 0.5% Tween 20 and 1 litre H 2 O) at 20 C for 7 minutes, to increase antibody specificity and discrimination. Slides were mounted in anti-fade (90% glycerol, 20mM Tris-HCl, ph 8.0, 50 g/ml paraphenylenediamine) prior to analysis using a Zeiss Axioskop microscope. Replication fork activity was calculated by dividing the number of sites of continuing replication [A+B; as depicted on the right of panel (a)] by the total number of IdU-containing sites [A+B+D]. More than 50 individual fibers were analyzed in each experiment and the data presented represent the mean of at least 3 independent experiments.

Supplementary References 1. Ellis, N.A. et al. Cell 83, 655-666 (1995). 2. Davies, S.L., North, P.S., Dart, A., Lakin, N.D. & Hickson, I.D. Mol. Cell. Biol. 24, 1279-1291 (2004). 3. Gaymes, T.J. et al. Oncogene 21, 2525-2533 (2002). 4. Neff, N.F. et al.. J. Biol. Chem. 275, 9636-9644 (2000). 6. Jackson, D.A. & Pombo, A. J. Cell Biol. 140, 1285-95 (1998). 7. Merrick, C.J., Jackson, D. & Diffley, J.F. J. Biol. Chem. 279, 20067-75 (2004).

Supplementary Figure Legends Supplementary Figure 1. BS cells are hypersensitive to drugs that inhibit DNA replication. Clonogenic cell survival analyses were conducted on PSNF5 (BLM + ; ) and PSNG13 (BLM - ; ϒ) cells following a 24 hour exposure to aphidicolin (panel a), gemcytabine (panel b) or ara C (panel c) at the doses indicated. Experiments were performed in triplicate and the error bars represent the standard errors of the mean. Supplementary Figure 2. BLM is required for efficient replication fork restart following replication blockade. (a) Effect of varying recovery time on replication fork activity following aphidicolin treatment of 30 M for 6 hours. (b) Effects of a 6 hour exposure to aphidicolin or HU compared to untreated controls in untransformed MRC5 cells (BLM + ; black bars) and GM1492 (BLM - ; open bars) cells. Supplementary Figure 3. The active site lysine (K695) and the Thr-99 target site for ATR are required for cell survival after replication blockade. Survival curves were generated for the cell lines indicated as described in the Supplementary Figure 1 legend. Panels (a) and (c) show sensitivity to aphidicoln and panels (b) and (d) show sensitivity to HU. Supplementary Figure 4. Expression of BLM proteins in transfected BS cells. Western blotting analysis to indicate levels of the BLM, BLM-T99A, BLMT122A, and BLM- T99A/T122A proteins in the different transfectants. β-tubulin was used as a loading control. Supplementary Figure 5. The active site of BLM is required for suppression of new origin firing. Number of new sites of replication visible during a 20 minute recovery period

following exposure to 30 M or 4mM HU in an isogenic set of cell lines expressing wild-type BLM (black), no BLM (white) or BLM-K695T (red).