PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all the necessary components for the DNA amplification. It includes DNA marker and control DNA and primers which are sufficient for 10 PCR reactions Kit Components: Taq DNA Polymerase, Reaction Buffer (10x), dntp mix (2mM), 25mM MgCl 2, Control DNA and Primer, DNA Marker, 6x Loading Dye 50rxn 114331 PCR Master Mix (2X) 114332 The PCR master mix contains all the components required for 100 Rxns the PCR in 2X concentration except template DNA and Primers. Reaction Set up: PCR Master Mix (2x) - 25µl Forward Primer - 0.1-1µm Reverse Primer - 0.1-1µm Template DNA - 10pg 100ng Sterile H 2O - to 50µl Total Volume - 50µl DNA Polymerases 114301 Taq DNA Polymerase 50 Rxns 114302 Taq DNA Polymerase is a highly thermostable DNA polymerase. The recombinant Pol gene from Thermus aquaticus expressed in E.coli. PCR amplification of DNA fragments as long as 5 kb Generation of PCR product for TA cloning. 114311 Pfu DNA Polymerase 114312 The Pfu DNA Polymerase is a highly thermostable DNA polymerase from the hyperthermophilic archaeum Pyrococcus furiosus. The enzyme catalyzes the template-dependent polymerization of nucleotides into duplex DNA in the 5'=>3' direction. The Pfu DNA Polymerase also exhibits 3'=>5' exonuclease (proofreading) activity, which enables the polymerase to correct nucleotide incorporation errors. It has no 5'=>3' exonuclease activity. High fidelity PCR Blunt-end PCR cloning Site-directed mutagenesis 17
114231 Hot Start DNA Polymerase 114232 Hot Start Taq DNA Polymerase is designed for hot start PCR, a technique that has been shown to improve specificity, sensitivity and yield of DNA amplification during PCR. The enzyme is inactive at room temperature, avoiding extension of nonspecifically annealed primers or primer dimers and providing higher specificity of DNA amplification. The functional activity of the enzyme is restored during a short 4-minute incubation at 95 C. The activated enzyme maintains the same functionality as Taq DNA polymerase: catalyzes 5'=>3' synthesis of DNA, has no detectable 3'=>5' proofreading exonuclease activity, but possesses low 5'=>3' exonuclease activity. High yield amplification of targets up to 3 kb. Hot start PCR. RT-PCR. Highly specific amplification of complex genomic and cdna templates. Amplification of low copy DNA targets. Real-time PCR. Multiplex PCR. Generation of PCR products for TA cloning. 114361 10X Taq Buffer with KCl 10X Taq Buffer with KCl is recommended for all PCR applications with Fermentas Taq DNA Polymerases. It does not contain MgCl 2. 50U 114362 10X Taq Buffer with KCl and 15 mm MgCl 2 10X Taq Buffer with KCl and 15 mm MgCl 2 is a ready-to-use buffer recommended for PCR applications with Taq DNA Polymerases. 114363 10X Taq Buffer with (NH 4 ) 2 SO 4 10X Taq Buffer with (NH 4) 2SO 4 is recommended for PCR applications with Taq DNA Polymerases. It does not contain MgCl 2. High primer specificity is observed in this buffer within a broad range of magnesium concentrations at variety of annealing temperatures. 114364 10X Taq Buffer with (NH 4 ) 2 SO 4 and 20 mm MgCl 2 10X Taq Buffer with (NH 4) 2SO 4 and 20 mm MgCl 2 is a ready-touse buffer recommended for all PCR applications with Taq DNA Polymerases. High primer specificity is observed with this buffer within a broad range of annealing temperatures. 114371 Water (Nuclease-free) - Molecular Biology Grade 114372 The water, nuclease-free is deionized, double distilled, 0.22 µm membrane-filtered and sterilized. It is suitable for use in all 100 ml 114373 molecular biology applications. 500 ml Storage: Room Temperature 18
REVERSE TRANSCRIPTASE/RT PCR 114056 AMV Reverse Transcriptase AMV Reverse Transcriptase (RT) is a recombinant Avian Myeloblastosis Virus reverse transcriptase expressed in E.coli. AMV RT is a heterodimer composed of nonidentical subunits alfa and beta. It possesses multiple enzymatic activities including RNA- and DNA-directed DNA polymerase, DNA-RNA unwinding activity, a sequence-specific Mn 2+ -dependent endonuclease and ribonuclease H. 114057 M-MuLV Reverse Transcriptase The M-MuLV Reverse Transcriptase (RT) is an RNA- and DNAdependent DNA polymerase. It can use either RNA or DNA to prime DNA synthesis. The enzyme possesses a ribonuclease H activity specific to RNA in RNA-DNA hybrids. 1000U 114073 DNase I (RNase-free) Ready to Use DNase I, RNase-free is an endonuclease that digests single- and 114074 1000U double-stranded DNA. It hydrolyzes phosphodiester bonds producing mono- and oligodeoxyribonucleotides with 5- phosphate and 3'-OH groups Preparation of DNA-free RNA Removal of template DNA following in vitro synthesis of RNA with T7, T3, SP6 RNA Polymerases Preparation of DNA-free RNA prior to RT-PCR. etc 500U 114141 RNase Inhibitor 500U 114142 RNase Inhibitor inhibits the activity of RNases A, B and C by 1000U binding them in a noncompetitive mode at a ratio 1:1. It does not inhibit the following RNases: I, T1, T2, H, U1, U2 and CL3. 114381 Water DEPC 114382 The water, DEPC treated is distilled, 0.22 µm membrane-filtered, treated with DEPC and autoclaved. It is suitable for RNA re- 100 ml dissolving, cdna synthesis and RT-PCR etc. Storage: Room Temperature dntp MIX SOLUTION (10mM) - Molecular Biology Grade 114191 dntp Mix Solution (10mM) 100 µl 114192 dntp Mix Solution (10mM) 200 µl 114193 dntp Mix Solution (10mM) dntp MIX SOLUTION (100mM) - Molecular Biology Grade 114181 datp Solution (100mM) 114182 dctp Solution (100mM) 114183 dgtp Solution (100mM) 114184 dttp Solution (100mM) 19
dntp MIX SOLUTION (100mM) - Molecular Biology Grade 114201 dntp Mix Solution (100mM) 100 µl 114202 dntp Mix Solution (100mM) dntp SET (100mM) - Molecular Biology Grade 114206 dntp Set (100mM) 4 X 100 µl 114207 dntp Set (100mM) 4 X 200 µl 112701 Primers/ Oligonucleotides Synthesis Per Base UNIVERSAL DNA SEQUENCING PRIMER 112711 M13F primer (3 GTAAAACGACGGCCAGT 5 ) 112712 M13R primer (3 CAGGAAACAGCTATGACC 5 ) 112713 M13F primer (3 AGGGTTTTCCCAGTCACGACGTT 5 ) 112714 M13R primer (3 GAGCGGATAACAATTTCACACAGG 5 ) 112715 T7 Primer (3 TAATACGACTCACTATAGGG 5 ) 112716 T7 Terminator Primer (3 CTAGTTATTGCTCAGCGGT 5 ) 112717 T3 Primer (3 AATTAACCCTCACTAAAGGG 5 ) 112718 SP6 Primer (3 CATTTAGGTGACACTATAG 5 ) 112719 Random Hexamer 112720 Oligo dt Primer (18mer) DNA FINGER PRINTING PRIMER 112751 Bacterial RAPD Primer set (3.0 5.0 OD) 12 Nos 112752 Bacterial RAPD Primer set (3.0 5.0 OD) 25 Nos 112753 Fungal RAPD Primer set (3.0 5.0 OD) 12 Nos 112754 Fungal RAPD Primer set (3.0 5.0 OD) 25 Nos 112755 Plant RAPD primer set (3.0 5.0 OD) 12 Nos 112756 Plant RAPD primer set (3.0 5.0 OD) 25 Nos 112757 Animal RAPD primer (3.0 5.0 OD) 12 Nos 112758 Animal RAPD primer (3.0 5.0 OD) 25 Nos 112759 Human RAPD Primer (3.0 5.0 OD) 12 Nos
112760 Human RAPD Primer (3.0 5.0 OD) 25 Nos