Synthetic Biology Module Lecture #1
|
|
|
- Emil Cunningham
- 5 years ago
- Views:
Transcription
1 Synthetic Biology Module Lecture #1 Ron Weiss Department of Biological Engineering MIT Department of Biological Engineering March 8, 2011
2 Synthetic biology analogy: bio bots
3 Synthetic biology analogy: bio bots Environment Robot SENSORS PROCESSING ACTUATION Electronic circuit & peripherals
4 Synthetic biology analogy: bio bots Environment Biological cell SENSORS PROCESSING ACTUATION Synthetic gene circuit
5 Synthetic biology applications Bioenergy production biodiesel hydrogen methane Microbial biochemical synthesis artemisinin other pharmaceuticals Environmental applications environmental remediation toxin sensing explosive sensing Biomedical applications cancer therapeutic agents artificial tissue homeostasis programmed tissue regeneration artificial immune system
6 From idea to implementation
7 Hierarchical organization Applications System integration Modules Genetic parts
8 Genetic Building Block Digital Inverter 0 1 input protein (repressor) output protein Transcription / Translation P CDS
9 Genetic Building Block Digital Inverter 1 0 input protein (repressor) output protein Transcription / Translation P CDS
10 Modules implemented in Weiss lab digital comm. Inverter Send/Receive Toggle switch Yeast QS Cascades Consensus 1:2 MUX Pop Ctrl Pulse Gen Band detect Amplifier analog
11 Genetic Edge Detector Goal: Implement a parallel edge detection algorithm wherein each bacterium within a population functions as an independent signal processor, and the population cooperates to find the edges. A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1273. Figure 1A
12 / System Engineering Module Our goal: Understand, analyze, and improve edge detector Specifically: One technical aspect of the presentation today is incorrect (from paper). The goal of our module is to fix this problem! Experimental Goals Design: DNA modification Sub-clone new DNA Express in bacteria Characterize new system Lab+Analytical Skills Culture bacteria Make and analyze DNA Measure enzyme levels Model/make predictions Explore modular composition
13 Genetic Edge Detection Algorithm Pseudocode: IF NOT (light) produce signal IF signal AND NOT (NOT light) produce pigment Produce signal generate diffusible communication signal Produce pigment produce black pigment A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1273. Figure 1B, 1C
14 Genetic Edge Detection Algorithm I. Photographic Bacteria using Dark Sensor II. Cell Cell Communication III. Inverter IV. Full Logic Function
15 Dark Sensor
16 II. Cell cell Communication Communicate using V. fischeri quorum sensing system Dark transcription of luxi membrane diffusible compound 3 oxohexanoyl homoserine lactone (AHL) AHL binds constitutively expressed LuxR β galactosidase Additional blurring component A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1275. Figure 3B
17 II. Cell cell Communication A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1275. Figure 3B
18 III. Inverter B gal expressed only where AHL AND light or more accurately AHL AND NOT (NOT light) NOT function = genetic inverter ci gene from phage λ dimeric transcriptional repressor turns OFF the output promoter when the input promoter is ON Negative bacterial photograph A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1275. Figure 3C
19 III. Inverter A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1275. Figure 3C
20 IV. Full Logic Function AHL AND NOT (NOT light) Two input promoter P lux λ activated by AHL/LuxR dominantly repressed by CI A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1275. Figure 3D
21 IV. Full Logic Function A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1275. Figure 3
![Logic Transfer Function X AND (NOT Y) Constitutively expressed luxr gene Exogenously vary AHL and light Measure β gal activity two dimensional transfer function of P lux λ as a function of [AHL] (u](/docs-images/96/128544782/images/22-1.jpg "1 ) and [CI] (u 2 ) A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell.")
22 Logic Transfer Function X AND (NOT Y) Constitutively expressed luxr gene Exogenously vary AHL and light Measure β gal activity two dimensional transfer function of P lux λ as a function of [AHL] (u 1 ) and [CI] (u 2 ) A synthetic genetic edge detection program. Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD. Cell Jun 26;137(7):1274 Figure 2B
23 Edge Detection of Complex Patterns
24 Next Lab exercises Understand problem with edge detector Design a fix by the second lab session
3/11/10. Genetic Circuits. Edge Detection. Genetic Edge Detection Algorithm. Goal. What I cannot create I do not understand.
What I cannot create I do not understand. ~Richard Feynman A Synthetic Genetic Edge Detection Program Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD Cell.
Digitally Programmed Cells
Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient
Computer Aided Design of Synthetic Biological Systems Using Standardized Parts
Computer Aided Design of Synthetic Biological Systems Using Standardized Parts Douglas Densmore* CHESS Seminar 11/18/08 *in cooperation with Prof. J. Christopher Anderson and Prof. Chris Voigt Outline
Ask science teachers if engineering concepts
How to incorporate engineering in the biology classroom James Dixon and Natalie Kuldell Ask science teachers if engineering concepts should be taught in the science classroom, and most will say yes. But
Design of Digital Logic by Genetic Regulatory Networks. Programming Cell Communities
Design of Digital Logic by Genetic Regulatory Networks Ron Weiss Department of Electrical Engineering Princeton University Computing Beyond Silicon Summer School, Caltech, Summer 2002 Programming Cell
Design Principles in Synthetic Biology
Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University
Module 3. Lecture 5. Regulation of Gene Expression in Prokaryotes
Module 3 Lecture 5 Regulation of Gene Expression in Prokaryotes Recap So far, we have looked at prokaryotic gene regulation using 3 operon models. lac: a catabolic operon which displays induction via negative
Synthetic Biology of Genetic Circuit
Synthetic Biology of Genetic Circuit 1 Mallar, K. N. and 2 Prasenjit, D. 1 M.Sc. (Agri.), Dept. of Biotechnology, AAU, Jorhat, Assam 2 M.Sc. (Agri.), Dept. of Biotechnology, UAS, Dharwad, Karnataka Correspondence
Spatial patterning and hardwired memory: engineering biomolecules as cellular input / output devices
Spatial patterning and hardwired memory: engineering biomolecules as cellular input / output devices Yuki Kimura, Jack Lee, Helen Lee, Kristy Hawkins, Travis Bayer Professor Christina D. Smolke Department
Synthetic Biology and Rational Design Keith Shearwin University of Adelaide
Synthetic Biology and Rational Design Keith Shearwin University of Adelaide Synthetic biology what is it? Analogy with engineering Learning by building: natural and synthetic gene circuits 1 (1) (2) 2
Imperial College London. Synthetic Biology. Engineering Biologically-based Devices and Systems. Professor Richard I Kitney
Imperial College London Synthetic Biology Engineering Biologically-based Devices and Systems Professor Richard I Kitney Developments in Biology The Molecular Biology Revolution 1953-2003 April 25 th 1953
Technologies and Tools For Programming Genetic Systems
Technologies and Tools For Programming Genetic Systems Christina D. Smolke Department of Bioengineering Stanford University July 9, 29 Opportunities and Challenges in Synthetic Biology Tools and Techniques
Chapter 14 Regulation of Transcription
Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription
chapter eight: microbial genetics
chapter eight: microbial genetics the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material Hershey Chase, 1952
Programmed Cell Applications. Programming Cells
The Device Physics of Cellular Logic Gates Ron Weiss Department of Electrical Engineering Princeton University SC-1 Programming Cells Environment actuators sensors Biochemical logic circuit.5µm Understand
Lecture Series 10 The Genetics of Viruses and Prokaryotes
Lecture Series 10 The Genetics of Viruses and Prokaryotes The Genetics of Viruses and Prokaryotes A. Using Prokaryotes and Viruses for Genetic Experiments B. Viruses: Reproduction and Recombination C.
chapter eight: microbial genetics
chapter eight: microbial genetics Revised 9/15/2016 the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material
A Living Game of Life
A Living Game of Life Mike Blain Ken Mizuno The Game of Life is a set of cellular automata rules created by John Conway in the 1970s. Since this time it has been studied extensively, and is considered
Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan. 1 day. 1 P age
1 P age Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan 1 day 2 P age Introduction In this single module students will build upon their previous knowledge of basic molecular
Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
Transcriptional Regulation in Synthetic Gene Networks
Transcriptional Regulation in Synthetic Gene Networks by Seema Nagaraj A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Edward S. Rogers Sr. Department of Electrical
Biomolecular Breadboards for Prototyping and Debugging Synthetic Biocircuits
Biomolecular Breadboards for Prototyping and Debugging Synthetic Biocircuits University of Minnesota Richard Murray Paul Rothemund Vincent Noireaux California Institute of Technology U. Minnesota. DARPA
Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes
Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Question No. 1 of 10 1. Which of the following statements about gene expression in prokaryotes is correct? Question #1 (A) In prokaryotes,
Transcriptional Regulation
Transcriptional Regulation Gene expression responds to environmental conditions. Some regulatory proteins are present at only 5 10 copies, whereas under certain conditions, the expression of these proteins
Blue Marble University. Fast Track Combination Bachelor of Science (B.S.) and Doctor of Science (D.Sc.) in Biomedical engineering
Blue Marble University Fast Track Combination Bachelor of Science (B.S.) and Doctor of Science (D.Sc.) in Biomedical engineering 5 Year program which you can enter right after High School And Complete
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Biosensors and Genetic Circuits Programmable Cells
Biosensors and Genetic Circuits Programmable Cells Technical Journal Club 24.06.2014 Rahel Gerosa http://www.engadget.com/2013/02/12/mit-crafts-genetic-circuits-that-remember-their-work-through-dna/ Synthetic
Optimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University
Optimizing Synthetic DNA for Metabolic Engineering Applications Howard Salis Penn State University Synthetic Biology Specify a function Build a genetic system (a DNA molecule) Genetic Pseudocode call producequorumsignal(luxi
Overview. Introduction. Biological model. Physical and Chemical properties of our glue. Mathematical modeling. Conclusions
Overview Introduction Biological model Physical and Chemical properties of our glue Mathematical modeling Conclusions Introduction Model : Caulobacter crescentus GRAM Motile or sessile cell Sessile stage
Lecture 18. 2) Check to see whether the mutation is recessive and trans-acting (most will be).
Lecture 18 In the preceding examples of bacterial gene regulation, we have used known regulatory mechanisms to see how mutations in different elements of the system would behave in dominance tests and
Game Plan. Lecture. Lab. Growth Curve. Biofilms Review of basic genetics Bacterial gene structure Gene regulation Mutations
Game Plan Lecture Biofilms Review of basic genetics Bacterial gene structure Gene regulation Mutations Lab Growth Curve Pre-labs Effects on growth: temp, ph, O2 What is a biofilm Biofilm = an organized
2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
Game Plan. Lecture. Lab. Biofilms Review of basic genetics Bacterial gene structure Gene regulation Mutations
Game Plan Lecture Biofilms Review of basic genetics Bacterial gene structure Gene regulation Mutations Lab Review serial dilutions and Calculate generation times Effects on growth: temp, ph, O2 Pre-labs
Genetics Lecture Notes Lectures 17 19
Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression
COMPARISON OF SIMULATED ANNEALING AND GENETIC ALGORITHM APPROACHES IN OPTIMIZING THE OUTPUT OF BIOLOGICAL PATHWAYS
COMPARISON OF SIMULATED ANNEALING AND GENETIC ALGORITHM APPROACHES IN OPTIMIZING THE OUTPUT OF BIOLOGICAL PATHWAYS RAJESH KRISHNAN University of Cincinnati Department of ECECS, ML 30 Cincinnati, Ohio 45221-0030
A Simple Approach to Study Designs in Complex Biochemical Pathways
Symposium on Complexity & Computation in the Natural Sciences A Simple Approach to Study Designs in Complex Biochemical Pathways SOMDATTA SINHA Centre for Cellular and Molecular Biology (CSIR) Hyderabad
Gene Expression Prokaryotes and Viruses. BIT 220 Chapter 23
Gene Expression Prokaryotes and Viruses BIT 220 Chapter 23 Types of Regulatory Mechanisms Rapid turn-on and turn off of gene expression (responds to some external source Expression of a cascade of gene
Einführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de
Trends in Biotechnology Investment
Trends in Biotechnology Investment National Academies Workshop Future Biotechnology Products and Opportunities to Enhance Capabilities of Biotechnology Regulatory System June 1, 2016 Theresa Good, Deputy
By Pat M. Fidopiastis Microbial Diversity, Abstract
In Search of Homoserine Lactone or Homoserine Lactone-like Autoinducer Production by Microbes from Local Environments By Pat M. Fidopiastis Microbial Diversity, 1998 Abstract The ability of certain gram-negative
2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna
GENE REGULATION Virtually every cell in your body contains a complete set of genes But they are not all turned on in every tissue Each cell in your body expresses only a small subset of genes at any time
CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
Synthetic Biology: A New Application Area for Design Automation Research
Synthetic Biology: A New Application Area for Design Automation Research Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 4, Chris Winstead 5 1 University of Utah 2 Southern
Bi 8 Lecture 10. Ellen Rothenberg 4 February 2016
Bi 8 Lecture 10 Bacterial regulation, II Ellen Rothenberg 4 February 2016 Not all bacterial promoters use the same σ factors, and this provides added regulation capability Most sigma factors are related
Synthetic Biological Systems
Synthetic Biological Systems 1. Pattern Formation 20/01/2012 Dr Tom Ellis 1 Biological Patterns 20/01/2012 Dr Tom Ellis 2 Biological Patterns 20/01/2012 Dr Tom Ellis 3 Biological Patterns 20/01/2012 Dr
Synthetic Biology. IICA First Seminar on SynBio for Biotechnology Decision Makers March 16-17, Fan-Li Chou. Foreign Agricultural Service
Synthetic Biology IICA First Seminar on SynBio for Biotechnology Decision Makers March 16-17, 2016 Fan-Li Chou U.S. Department of Agriculture Outline What is synthetic biology? Who cares? Why do we care?
B R I N G C O M P U T A T I O N T O L I F E
B R I N G C O M P U T A T I O N T O L I F E Founding team: Four biological engineers Alec Nielsen, PhD MIT Biological Engineering Genetic engineer, cell biophysicist, comp. biologist Published circuits
Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
GENE EXPRESSSION. Promoter sequence where RNA polymerase binds. Operator sequence that acts as a switch (yellow) OPERON
GENE EXPRESSSION 1 GENE REGULATION IN PROKARYOTES Bacteria can turn genes on or off depending on their environment Prokaryotes have operons clusters of related genes and regulatory sequences Promoter sequence
ECS 234: Genomic Data Integration ECS 234
: Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG
SUPPORTING INFORMATION
SUPPORTING INFORMATION Cell-free translation is more variable than transcription Fabio Chizzolini, Michele Forlin, Noël Yeh Martín, Giuliano Berloffa, Dario Cecchi, and Sheref S. Mansy Deposited DNA sequences
Einführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Twitter: @PlantDevTUM, #genetiktum FB: Plant Development TUM Prof. Dr. Claus Schwechheimer
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
Gene regulation II Biochemistry 302. Bob Kelm March 1, 2004
Gene regulation II Biochemistry 302 Bob Kelm March 1, 2004 Lessons to learn from bacteriophage λ in terms of transcriptional regulation Similarities to E. coli Cis-elements (operator elements) are adjacent
Chapter 9. Biotechnology and DNA Technology
Chapter 9 Biotechnology and DNA Technology SLOs Compare and contrast biotechnology, recombinant DNA technology, and genetic engineering. Identify the roles of a clone and a vector in making recombined
Chapter 13: Biotechnology
Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,
Gene Circuits -2. Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering
Gene Circuits -2 Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ Genes Flow of information in gene expression
Regulation of gene expression. (Lehninger pg )
Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
Microbial Miner. HNU_China
Microbial Miner HNU_China Let s start to find the treasure! Background 1. Introduction Biomining: utilize microorganisms to extract and recover metals from ores and concentrates. Advantages of Biomining
A Discovery Laboratory Investigating Bacterial Gene Regulation
Chapter 8 A Discovery Laboratory Investigating Bacterial Gene Regulation Robert Moss Wofford College 429 N. Church Street Spartanburg, SC 29307 mosssre@wofford.edu Bob Moss is an Associate Professor of
Synthetic Biology: A New Application Area for Design Automation Research
Synthetic Biology: A New Application Area for Design Automation Research Chris Myers University of Utah Carnegie Mellon University December 10, 2009 James Watson Biology has at least 50 more interesting
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
Construction and Characterization of Engineered Bacterial Cell-Cell Communication Modules
Construction and Characterization of Engineered Bacterial Cell-Cell Communication Modules Anna Labno, Barry Canton, and Andrew Endy MIT Synthetic Biology Working Group (Dated: December 15, 2005) Current
CHEMICAL ECOLOGY The Ecological and Physiological Roles of Bacterial Cell-Cell Signalling - Staffan Kjelleberg, Michael Givskov, Scott A.
THE ECOLOGICAL AND PHYSIOLOGICAL ROLES OF BACTERIAL CELL-CELL SIGNALLING Scott A. Rice The Centre for Marine Biofouling and Bio-Innovation and The School of Biotechnology and Biomolecular Science, The
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
Solutions to 7.02 Quiz III
Solutions to 7.02 Quiz III Class Average = 79 Standard Deviation = 12 Range Grade % 85-100 A 40 72-84 B 37 55-71 C 20 > 54 D/F 3 Question 1 On day 1 of the genetics lab, the entire 7.02 class did a transposon
A developmental gene regulation network for constructing electronic circuits
A developmental gene regulation network for constructing electronic circuits Song Zhan, Julian F. Miller, Andy M. Tyrrell Intelligent Systems Group, Department of Electronics, University of York, UK. (sz503,
Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
Department of Genetics
Department of Genetics Program Specific Outcomes (PSO) Program- MSc. Genetics (404) The course prepares students for pursuing further research and teaching. Key features: Students have high success rate
Gene Expression. Chapters 11 & 12: Gene Conrtrol and DNA Technology. Cloning. Honors Biology Fig
Chapters & : Conrtrol and Technology Honors Biology 0 Cloning Produced by asexual reproduction and so it is genetically identical to the parent st large cloned mammal: Dolly the sheep Animals that are
DNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
Biotechnolog y and DNA Technology
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,
Bacterial Computing
Bacterial Computing www.technicalpapers.co.nr ABSTRACT: Bacteria are wondrous creatures. They can reproduce in less than half an hour, they can rapidly adapt to changing conditions, and some strains are
Embeddable Sensor/Actuator Networks for Biological Systems
Embeddable Sensor/Actuator Networks for Biological Systems Networks of sensors and actuators that can be interfaced with biological systems at the cellular and molecular scales. Real-time, label-free sensing
BME Course Descriptions
BME Course Descriptions 2018-19 BIM 1 Introduction to Biomedical Engineering Units: 2 Fall Lecture: 1 hour; Laboratory: 3 hours. No prerequisite. Introduction to the field of biomedical engineering with
d. reading a DNA strand and making a complementary messenger RNA
Biol/ MBios 301 (General Genetics) Spring 2003 Second Midterm Examination A (100 points possible) Key April 1, 2003 10 Multiple Choice Questions-4 pts. each (Choose the best answer) 1. Transcription involves:
Old EXAM 1 BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.
Old EXAM 1 BIO409/509 NAME Please number your answers and write them on the attached, lined paper. 1) Describe euchromatin and heterochromatin. Which form of chromatin would the insulin gene be found in
Bi8 Lecture 19. Review and Practice Questions March 8th 2016
Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs
Bacterial Transformation with pglo, Part 1
Biology 211 Bacterial Transformation with pglo, Part 1 OBJECTIVES: Practice formulating predictions Describe the principles of bacterial transformation. Explain the procedure for gene transfer using plasmid
Genetic Engineering and Other Aspects of Biotechnology
Genetic Engineering and Other Aspects of Biotechnology IB Biology Outcomes 4.4.1 Outline the use of polymerase chain reaction (PCR) to copy and amplify minute quantities of DNA. 4.4.2 State that, in gel
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites
The Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho
Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying
7.1 The lac Operon 7-1
7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports
NIH Public Access Author Manuscript Cell. Author manuscript; available in PMC 2010 June 26.
NIH Public Access Author Manuscript Published in final edited form as: Cell. 2009 June 26; 137(7): 1272 1281. doi:10.1016/j.cell.2009.04.048. A Synthetic Genetic Edge Detection Program Jeffrey J. Tabor
The Lactose Intolerance of Bacteria
Contents 1 The Lactose Intolerance of Bacteria 2 The Lac Operon 3 Lac Operon Simulation 4 LacZ as a reporter gene 5 Blue-White Screening 6 References The Lactose Intolerance of Bacteria The standard growth
Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
Design of a biological half adder
Design of a biological half adder M. Terzer, M. Jovanovic, A. Choutko, O. Nikolayeva, A. Korn, D. Brockhoff, F. Zürcher, M. Friedmann, R. Schütz, E. Zitzler, J. Stelling and S. Panke Abstract: The building
Cell-free TX-TL systems for synthetic biology
Cell-free TX-TL systems for synthetic biology Vincent Noireaux, University of Minnesota Caltech workshop, August 2013 1 Outline: Introduction - Motivations. Cell-free TX-TL. Synthetic gene circuits and
DOWNLOAD OR READ : EXAMPLES OF REGULATORY PROTEINS THAT CONTROL THE CELL CYCLE PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : EXAMPLES OF REGULATORY PROTEINS THAT CONTROL THE CELL CYCLE PDF EBOOK EPUB MOBI Page 1 Page 2 examples of regulatory proteins that control the cell cycle examples of regulatory proteins
QUESTIONS 16 THROUGH 30 FROM EXAM 3 OF FALL, 2010
BISC403 Genetic and Evolutionary Biology Spring, 2011 April 19, 2011 Summary of requirements for Exam 3 (to be given on April 26 plus third exam from fall, 2010) The primary responsibility is for any topic
Regulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
Aeromonas salmonicida subsp. achromogenes and the effect of the autoinducer synthase AsaI on bacterial virulence
Aeromonas salmonicida subsp. achromogenes and the effect of the autoinducer synthase AsaI on bacterial virulence Johanna Schwenteit, Thorunn Gudmundsdottir, Bryndis Bjornsdottir and Bjarnheidur K Gudmundsdottir*
20.180:Devices. Summary. Introduction. Genetic Devices
20.180:Devices Summary The material on this page covers three topics. First, we briefly review how to make different sorts of gene-expression based devices. Second, we develop a simple framework for modeling
Chapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the